Starting /dee2/code/volunteer_pipeline.sh SRR6892954 current disk space = 1551072219136 free memory = 1601252704 SRR6892954 SRAfilesize 1a20c7285856cd10d897383ae8da08df SRR6892954.sra SRR6892954.sra file validated SRR6892954 is single end SRR6892954 is conventional basespace SRR6892954 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892954_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.846 31.0 30.0 33.0 25.0 34.0 2 29.762 31.0 30.0 34.0 24.0 34.0 3 30.30525 31.0 30.0 34.0 26.0 34.0 4 33.98075 35.0 35.0 37.0 30.0 37.0 5 33.70125 35.0 35.0 37.0 28.0 37.0 6 33.506 35.0 35.0 37.0 28.0 37.0 7 33.456 35.0 35.0 37.0 28.0 37.0 8 33.4185 35.0 35.0 37.0 28.0 37.0 9 34.49425 38.0 34.0 39.0 27.0 39.0 10 34.6895 38.0 35.0 39.0 27.0 39.0 11 34.49025 38.0 34.0 39.0 27.0 39.0 12 34.359 37.0 34.0 39.0 27.0 39.0 13 34.04425 37.0 34.0 39.0 25.0 39.0 14 34.89625 38.0 34.0 40.0 25.0 41.0 15 34.69525 38.0 33.0 40.0 25.0 41.0 16 34.04175 38.0 33.0 40.0 21.0 41.0 17 34.24625 38.0 33.0 40.0 23.0 41.0 18 34.31 38.0 33.0 40.0 23.0 41.0 19 34.183 38.0 33.0 40.0 21.0 41.0 20 34.38025 38.0 34.0 40.0 23.0 41.0 21 34.15225 38.0 33.0 40.0 23.0 41.0 22 33.9775 38.0 33.0 40.0 23.0 41.0 23 34.09275 38.0 34.0 40.0 23.0 41.0 24 32.2245 37.0 31.0 39.0 15.0 40.0 25 30.94625 36.0 30.0 38.0 8.0 39.0 26 31.654 36.0 30.0 39.0 10.0 40.0 27 32.27725 37.0 31.0 40.0 10.0 40.0 28 32.711 38.0 32.0 40.0 10.0 40.0 29 33.58125 38.0 34.0 40.0 16.0 40.0 30 33.232 38.0 32.0 40.0 9.0 41.0 31 31.1045 36.0 30.0 39.0 2.0 40.0 32 30.3175 35.0 30.0 38.0 2.0 39.0 33 31.9275 37.0 31.0 39.0 2.0 40.0 34 33.27375 38.0 34.0 40.0 2.0 41.0 35 31.29625 36.0 31.0 39.0 2.0 40.0 36 29.926 35.0 28.0 38.0 2.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 76.0 3 0.0 4 14.0 5 15.0 6 11.0 7 16.0 8 13.0 9 13.0 10 16.0 11 13.0 12 12.0 13 13.0 14 14.0 15 16.0 16 12.0 17 29.0 18 19.0 19 24.0 20 25.0 21 27.0 22 25.0 23 41.0 24 34.0 25 42.0 26 46.0 27 62.0 28 74.0 29 71.0 30 107.0 31 115.0 32 179.0 33 191.0 34 248.0 35 385.0 36 493.0 37 622.0 38 774.0 39 113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.369250985545335 24.021024967148488 29.540078843626805 27.06964520367937 2 21.625 31.2 23.400000000000002 23.775 3 22.425 22.400000000000002 21.95 33.225 4 24.85 24.349999999999998 20.65 30.15 5 22.75 28.425 27.325 21.5 6 30.703731530177812 19.033308289506635 23.64137240170298 26.62158777861257 7 31.663326653306612 21.793587174348698 27.404809619238478 19.138276553106213 8 21.417835671342687 22.595190380761522 29.909819639278556 26.077154308617235 9 22.138742799899823 19.058352116203356 35.987978963185576 22.814926120711245 10 29.04034076672513 18.967677273866197 24.630418441493358 27.36156351791531 11 27.029058116232463 25.425851703406817 24.574148296593187 22.970941883767534 12 27.61904761904762 19.598997493734334 31.428571428571427 21.353383458646615 13 25.331996993234778 20.195439739413683 21.899273365071412 32.57328990228013 14 29.158316633266534 24.774549098196395 20.415831663326653 25.651302605210418 15 26.102204408817638 24.874749498997996 27.730460921843687 21.29258517034068 16 30.451127819548873 24.536340852130326 21.127819548872182 23.884711779448622 17 26.666666666666668 26.416040100250626 21.629072681704262 25.288220551378448 18 29.899749373433583 21.478696741854638 19.348370927318296 29.273182957393484 19 28.07017543859649 32.88220551378446 17.894736842105264 21.152882205513784 20 33.50877192982456 22.431077694235587 25.438596491228072 18.62155388471178 21 9.849624060150376 9.197994987468672 69.3984962406015 11.553884711779448 22 0.6268806419257773 0.12537612838515547 46.63991975927783 52.60782347041123 23 51.83049147442327 0.07522567703109327 0.4012036108324975 47.693079237713135 24 49.29789368104313 0.4262788365095286 49.89969909729188 0.37612838515546637 25 0.5267118133935289 52.39528467519439 46.42588412340105 0.6521193880110359 26 0.551654964894684 47.36710130391174 51.8555667001003 0.22567703109327986 27 52.407221664994985 0.07522567703109327 47.19157472417252 0.3259779338014042 28 47.66800401203611 0.07522567703109327 0.15045135406218654 52.10631895687061 29 0.6521193880110359 0.05016302984700275 0.07524454477050413 99.22247303737146 30 51.880641925777326 0.05015045135406219 0.3259779338014042 47.7432296890672 31 49.222668004012036 0.05015045135406219 50.075225677031085 0.6519558676028084 32 0.551654964894684 0.20060180541624875 46.56469408224674 52.68304914744233 33 0.2 0.125 52.849999999999994 46.825 34 0.075 0.0 99.55000000000001 0.375 35 0.12603982858583312 0.025207965717166627 49.23115704562642 50.617595160070586 36 0.4522613065326633 0.10050251256281408 52.462311557788944 46.984924623115575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 3.0 8 5.0 9 5.0 10 3.5 11 2.0 12 2.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 3.0 22 4.0 23 4.0 24 3.0 25 2.0 26 3.5 27 5.0 28 5.0 29 8.0 30 11.0 31 11.0 32 19.5 33 28.0 34 28.0 35 56.0 36 84.0 37 84.0 38 122.0 39 160.0 40 203.0 41 246.0 42 246.0 43 320.5 44 395.0 45 395.0 46 433.5 47 472.0 48 472.0 49 469.0 50 466.0 51 565.5 52 665.0 53 665.0 54 599.5 55 534.0 56 534.0 57 452.0 58 370.0 59 370.0 60 331.5 61 293.0 62 293.0 63 210.0 64 127.0 65 94.5 66 62.0 67 62.0 68 51.5 69 41.0 70 41.0 71 28.5 72 16.0 73 16.0 74 11.0 75 6.0 76 4.0 77 2.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.17500000000000002 7 0.2 8 0.2 9 0.17500000000000002 10 0.22499999999999998 11 0.2 12 0.25 13 0.22499999999999998 14 0.2 15 0.2 16 0.25 17 0.25 18 0.25 19 0.25 20 0.25 21 0.25 22 0.3 23 0.3 24 0.3 25 0.325 26 0.3 27 0.3 28 0.3 29 0.325 30 0.3 31 0.3 32 0.3 33 0.0 34 0.0 35 0.8250000000000001 36 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39685420447671 81.325 2 0.6957047791893527 1.15 3 0.21173623714458562 0.525 4 0.18148820326678766 0.6 5 0.06049606775559589 0.25 6 0.09074410163339383 0.44999999999999996 7 0.030248033877797946 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.18148820326678766 2.175 >50 0.09074410163339383 6.625 >100 0.06049606775559589 6.7250000000000005 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTC 137 3.4250000000000003 No Hit CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCT 132 3.3000000000000003 No Hit CGACACGACTCTCGGCAACGGTCGTATGCCGTCTTC 99 2.475 No Hit TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCT 91 2.275 No Hit GACACGACTCTCGGCAACGGTCGTATGCCGTCTTCT 75 1.875 No Hit GACACGACTCTCGGCAACGGATCGTATGCCGTCTTC 20 0.5 No Hit ACACGACTCTCGGCAACGGATCGTATGCCGTCTTCT 17 0.42500000000000004 No Hit TCCCGCGCGCTGTGGACCTTTCGTATGCCGTCTTCT 14 0.35000000000000003 No Hit ACGACTCTCGGCAACGGATATTCGTATGCCGTCTTC 13 0.325 No Hit TCCCGCGCGCTGTGGACCTTCTCGTATGCCGTCTTC 12 0.3 No Hit NACACGACTCTCGGCAACGGTCGTATGCCGTCTTCT 11 0.27499999999999997 No Hit NACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCT 7 0.17500000000000002 No Hit ACACGACTCTCGGCAACGGATTCGTATGCCGTCTTC 6 0.15 No Hit CGACACGACTCTCGGCAACGTCGTATGCCGTCTTCT 6 0.15 No Hit ATGCGTGCGAGTCGACGGGTTCGTATGCCGTCTTCT 6 0.15 No Hit ACCGTGCCGCGATAGTAATTCTCGTATGCCGTCTTC 5 0.125 No Hit NACGACTCTCGGCAACGGATTCGTATGCCGTCTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCTGG 30 1.581153E-5 32.351353 1 ATCCTGC 30 2.7547034E-5 29.925001 11 GTTGATC 25 3.5796018E-4 29.925001 7 TGGTTGA 25 3.5796018E-4 29.925001 5 GGTTGAT 25 3.5796018E-4 29.925001 6 CAGTCGT 20 0.004620802 29.925001 18 CCTGCCA 30 2.7547034E-5 29.925001 13 GGATTCG 20 0.004620802 29.925001 17 CGGATTC 20 0.004620802 29.925001 16 CTGGTTG 25 3.5796018E-4 29.925001 4 ACCTGGT 25 3.5796018E-4 29.925001 2 TGCCAGT 25 3.5796018E-4 29.925001 15 ATGCCGG 20 0.004620802 29.925001 25 GTCTTCT 200 0.0 29.925001 30 TTGATCC 25 3.5796018E-4 29.925001 8 TCCTGCC 30 2.7547034E-5 29.925001 12 AACGGAT 20 0.004620802 29.925001 14 ACGGATT 20 0.004620802 29.925001 15 CAACGGA 20 0.004620802 29.925001 13 ATTCGTA 50 3.3434844E-8 26.932503 19 >>END_MODULE Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641125 spots for SRR6892954.sra Written 5641125 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra Read 5641107 spots for SRR6892954.sra Written 5641107 spots for SRR6892954.sra SRR ids: ['SRR6892954.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gwt9rdj4 SRR6892954.sra spots: 112822158 blocks: [[1, 5641107], [5641108, 11282214], [11282215, 16923321], [16923322, 22564428], [22564429, 28205535], [28205536, 33846642], [33846643, 39487749], [39487750, 45128856], [45128857, 50769963], [50769964, 56411070], [56411071, 62052177], [62052178, 67693284], [67693285, 73334391], [73334392, 78975498], [78975499, 84616605], [84616606, 90257712], [90257713, 95898819], [95898820, 101539926], [101539927, 107181033], [107181034, 112822158]] SRR6892954 file size 16531974 SRR6892954 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892954 SRR6892954_1.fastq Input file: SRR6892954_1.fastq trimmed: SRR6892954-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:35:16 2024 >> started Fri Dec 6 13:36:11 2024 >> done (54.173s) 112822158 reads processed; of these: 3814415 ( 3.38%) short reads filtered out after trimming by size control 3022363 ( 2.68%) empty reads filtered out after trimming by size control 105985380 (93.94%) reads available; of these: 9183763 ( 8.67%) trimmed reads available after processing 96801617 (91.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 390514 0.37% 19 416465 0.39% 20 610335 0.58% 21 933371 0.88% 22 440134 0.42% 23 312596 0.29% 24 192949 0.18% 25 44058 0.04% 26 32604 0.03% 27 51690 0.05% 28 55423 0.05% 29 627682 0.59% 30 283339 0.27% 31 355420 0.34% 32 64899 0.06% 33 93263 0.09% 34 2701268 2.55% 35 1577753 1.49% 36 96801617 91.33% 105985380 reads passed initial QC criterion=sequence-density sequence-density=93.08 sequence-density-rank=1 fanout-score=35.52 fanout-score-rank=2 prefix-density=94.45 prefix-fanout=35.0 sequence=TCGTATGCCGTCTTCTGCT criterion=fanout-score sequence-density=1.59 sequence-density-rank=3 fanout-score=56.30 fanout-score-rank=1 prefix-density=1.60 prefix-fanout=55.8 sequence=TGGTCGTATGCC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCT -o SRR6892954 - Input file: STDIN trimmed: SRR6892954-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:39:41 2024 >> started Fri Dec 6 13:41:30 2024 >> done (109.431s) 103730372 reads processed; of these: 35030 ( 0.03%) short reads filtered out after trimming by size control 843 ( 0.00%) empty reads filtered out after trimming by size control 103694499 (99.97%) reads available; of these: 100650136 (97.06%) trimmed reads available after processing 3044363 ( 2.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 414550 0.40% 19 613833 0.59% 20 53299951 51.40% 21 48498967 46.77% 22 504645 0.49% 23 235077 0.23% 24 27160 0.03% 25 6527 0.01% 26 3846 0.00% 27 10850 0.01% 28 10082 0.01% 29 10133 0.01% 30 6936 0.01% 31 3325 0.00% 32 1624 0.00% 33 1100 0.00% 34 7358 0.01% 35 4210 0.00% 36 34325 0.03% criterion=sequence-density sequence-density=5.65 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=19 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=474.50 fanout-score-rank=1 prefix-density=12.46 prefix-fanout=1.0 sequence=CTCGGCAACGGGT Started job on | Dec 06 13:42:16 Started mapping on | Dec 06 13:42:16 Finished on | Dec 06 13:45:58 Mapping speed, Million of reads per hour | 1718.10 Number of input reads | 105949507 Average input read length | 20 UNIQUE READS: Uniquely mapped reads number | 72454812 Uniquely mapped reads % | 68.39% Average mapped length | 20.38 Number of splices: Total | 1959639 Number of splices: Annotated (sjdb) | 1772668 Number of splices: GT/AG | 1929924 Number of splices: GC/AG | 26388 Number of splices: AT/AC | 879 Number of splices: Non-canonical | 2448 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.24 Insertion rate per base | 0.00% Insertion average length | 1.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 8841528 % of reads mapped to multiple loci | 8.35% Number of reads mapped to too many loci | 22257274 % of reads mapped to too many loci | 21.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 24653167 24653167 24653167 N_multimapping 8841528 8841528 8841528 N_noFeature 3829807 4665497 69907341 N_ambiguous 1782702 68897 10464 UnstrandedReadsAssigned:66842303 PositiveStrandReadsAssigned:67720418 NegativeStrandReadsAssigned:2537007 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892954 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892954-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 105,949,507 reads, 65,746,252 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,351 rounds 52973 SRR6892954.ke.tsv 35125 SRR6892954.se.tsv 88098 total ==> SRR6892954.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 5.70422 0.12945 PNS24249 1928 1829 289.54 3.39495 PNS24246 1044 945 5.70422 0.12945 PNS24248 1044 945 5.70422 0.12945 PNS24244 1471 1372 1742.8 27.2416 PNS24243 293 194 3 0.331633 KQK14069 1603 1504 27360.9 390.14 KQK14071 474 375 233.677 13.3636 ==> SRR6892954.se.tsv <== BRADI_1g14170v3 27001 BRADI_1g53295v3 59 BRADI_1g59795v3 236 BRADI_1g07683v3 3 BRADI_1g00485v3 42 BRADI_1g20270v3 863 BRADI_1g74790v3 2475 BRADI_1g09890v3 11 BRADI_1g77505v3 710 BRADI_1g48960v3 6 SRR6892954 completed mapping pipeline successfully