Starting /dee2/code/volunteer_pipeline.sh SRR6892955 current disk space = 1551059259392 free memory = 1601164960 SRR6892955 SRAfilesize c1fed60e1b88a40ca1863a9159058e47 SRR6892955.sra SRR6892955.sra file validated SRR6892955 is single end SRR6892955 is conventional basespace SRR6892955 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892955_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.69025 31.0 31.0 34.0 26.0 34.0 2 30.9555 34.0 31.0 34.0 26.0 34.0 3 31.751 34.0 31.0 34.0 28.0 34.0 4 35.31775 37.0 35.0 37.0 33.0 37.0 5 35.279 37.0 35.0 37.0 33.0 37.0 6 35.13 37.0 35.0 37.0 32.0 37.0 7 35.15875 37.0 35.0 37.0 32.0 37.0 8 35.0095 37.0 35.0 37.0 32.0 37.0 9 36.59025 39.0 37.0 39.0 32.0 39.0 10 36.553 39.0 37.0 39.0 32.0 39.0 11 36.479 39.0 37.0 39.0 32.0 39.0 12 36.39325 39.0 37.0 39.0 32.0 39.0 13 36.4555 39.0 37.0 39.0 32.0 39.0 14 37.63475 40.0 38.0 41.0 32.0 41.0 15 37.5705 40.0 38.0 41.0 32.0 41.0 16 37.46275 40.0 38.0 41.0 32.0 41.0 17 37.5155 40.0 38.0 41.0 32.0 41.0 18 37.47325 40.0 38.0 41.0 32.0 41.0 19 37.32825 40.0 38.0 41.0 32.0 41.0 20 37.2985 40.0 38.0 41.0 31.0 41.0 21 36.35075 39.0 36.0 41.0 29.0 41.0 22 36.24975 39.0 36.0 41.0 29.0 41.0 23 37.7155 40.0 38.0 41.0 33.0 41.0 24 37.0805 40.0 37.0 41.0 31.0 41.0 25 37.1555 40.0 37.0 41.0 32.0 41.0 26 37.23075 40.0 38.0 41.0 32.0 41.0 27 37.90325 40.0 38.0 41.0 34.0 41.0 28 37.3645 40.0 38.0 41.0 32.0 41.0 29 36.26225 39.0 36.0 40.0 30.0 41.0 30 36.63425 40.0 37.0 41.0 30.0 41.0 31 37.09 40.0 38.0 41.0 31.0 41.0 32 37.9445 40.0 39.0 41.0 34.0 41.0 33 37.95725 40.0 40.0 41.0 34.0 41.0 34 33.27425 37.0 30.0 40.0 19.0 41.0 35 30.24925 34.0 30.0 37.0 13.0 39.0 36 32.72375 37.0 32.0 39.0 16.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 0.0 4 5.0 5 13.0 6 5.0 7 7.0 8 5.0 9 5.0 10 5.0 11 2.0 12 7.0 13 4.0 14 3.0 15 2.0 16 4.0 17 6.0 18 6.0 19 7.0 20 6.0 21 4.0 22 16.0 23 17.0 24 15.0 25 29.0 26 23.0 27 35.0 28 35.0 29 42.0 30 43.0 31 57.0 32 95.0 33 116.0 34 150.0 35 240.0 36 388.0 37 628.0 38 1308.0 39 631.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.747107882701105 22.92171105730428 32.49932741458165 24.83185364541297 2 20.200000000000003 29.625 24.725 25.45 3 25.8 18.2 22.425 33.575 4 24.3993993993994 22.597597597597595 20.52052052052052 32.48248248248248 5 20.95118898623279 22.478097622027533 31.714643304130163 24.85607008760951 6 33.67654445002511 18.709191361125065 22.451029633350075 25.16323455549975 7 33.19939728779508 20.642893018583628 23.405323957810147 22.75238573581115 8 23.21024868123587 19.015322783220295 32.35367997990455 25.42074855563929 9 24.49748743718593 20.804020100502512 33.36683417085427 21.331658291457288 10 36.608040201005025 19.246231155778894 20.452261306532662 23.693467336683415 11 28.165829145728644 29.623115577889447 20.251256281407034 21.959798994974875 12 26.5393314903242 19.80397084694647 30.937421462679065 22.719276200050263 13 24.0824534942182 20.94017094017094 20.03519356460533 34.94218200100553 14 24.32092555331992 23.81790744466801 19.969818913480886 31.891348088531185 15 26.60296706059844 23.48503897410108 30.07291928589389 19.839074679406586 16 34.66566113624937 22.976370035193565 20.211161387631975 22.146807440925087 17 25.84862962031682 21.423183303997988 20.74427960774453 31.983907467940657 18 28.858722976370032 21.19155354449472 19.054801407742584 30.89492207139266 19 26.653256223283883 34.49836560221272 17.752074427960775 21.09630374654262 20 36.409353784259494 23.33417148604476 19.361327633894895 20.895147095800855 21 10.311871227364184 12.776659959758552 63.355130784708244 13.556338028169016 22 47.48490945674044 0.6287726358148894 51.65995975855131 0.22635814889336017 23 98.49056603773585 0.8301886792452831 0.628930817610063 0.05031446540880503 24 52.67924528301887 46.465408805031444 0.4528301886792453 0.4025157232704402 25 0.4779874213836478 98.11320754716981 0.9811320754716981 0.42767295597484273 26 0.17605633802816903 52.21327967806842 46.98189134808853 0.6287726358148894 27 0.37735849056603776 0.25157232704402516 98.61635220125787 0.7547169811320755 28 0.5534591194968553 0.1509433962264151 53.10691823899371 46.18867924528302 29 0.9056603773584906 0.10062893081761005 46.76729559748428 52.226415094339615 30 1.1823899371069182 0.1761006289308176 52.15094339622641 46.490566037735846 31 47.471698113207545 0.12578616352201258 0.42767295597484273 51.97484276729559 32 99.04402515723271 0.22641509433962265 0.3018867924528302 0.42767295597484273 33 98.5 0.17500000000000002 0.8500000000000001 0.475 34 55.00000000000001 0.27499999999999997 44.074999999999996 0.65 35 49.298597194388776 0.45090180360721444 49.223446893787575 1.0270541082164328 36 52.15745647236941 0.6813020439061317 0.40373454453696694 46.75750693918748 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 4.0 9 4.0 10 5.5 11 7.0 12 7.0 13 6.5 14 6.0 15 4.5 16 3.0 17 3.0 18 2.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.0 24 1.0 25 0.0 26 0.0 27 0.0 28 0.0 29 1.5 30 3.0 31 3.0 32 3.0 33 3.0 34 3.0 35 11.5 36 20.0 37 20.0 38 47.5 39 75.0 40 106.5 41 138.0 42 138.0 43 209.5 44 281.0 45 281.0 46 341.5 47 402.0 48 402.0 49 458.0 50 514.0 51 626.5 52 739.0 53 739.0 54 683.5 55 628.0 56 628.0 57 525.5 58 423.0 59 423.0 60 361.0 61 299.0 62 299.0 63 246.0 64 193.0 65 163.5 66 134.0 67 134.0 68 105.5 69 77.0 70 77.0 71 52.0 72 27.0 73 27.0 74 20.5 75 14.0 76 9.0 77 4.0 78 4.0 79 3.0 80 2.0 81 2.0 82 1.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.074999999999999 2 0.0 3 0.0 4 0.1 5 0.125 6 0.44999999999999996 7 0.44999999999999996 8 0.475 9 0.5 10 0.5 11 0.5 12 0.525 13 0.5499999999999999 14 0.6 15 0.575 16 0.5499999999999999 17 0.575 18 0.5499999999999999 19 0.575 20 0.575 21 0.6 22 0.6 23 0.625 24 0.625 25 0.625 26 0.6 27 0.625 28 0.625 29 0.625 30 0.625 31 0.625 32 0.625 33 0.0 34 0.0 35 0.2 36 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6861313868613 84.5 2 0.5547445255474452 0.95 3 0.23357664233576644 0.6 4 0.0875912408759124 0.3 5 0.0875912408759124 0.375 6 0.05839416058394161 0.3 7 0.0 0.0 8 0.029197080291970805 0.2 9 0.0 0.0 >10 0.20437956204379565 3.8249999999999997 >50 0.0 0.0 >100 0.05839416058394161 8.95 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTTGGAATTCTCGGGTG 212 5.3 No Hit TACCTGGTTGATCCTGCCAGTGGAATTCTCGGGTGC 146 3.65 No Hit CACGACTCTCGGCAACGGATTGGAATTCTCGGGTGC 49 1.225 No Hit GCGACCCCAGGTCAGGCGGGATGGAATTCTCGGGTG 40 1.0 No Hit GCGACCCCAGGTCAGGCGGGTGGAATTCTCGGGTGC 15 0.375 No Hit GACACGACTCTCGGCAACGGTGGAATTCTCGGGTGC 14 0.35000000000000003 No Hit CGACACGACTCTCGGCAACGGTGGAATTCTCGGGTG 13 0.325 No Hit GACACGACTCTCGGCAACGGATGGAATTCTCGGGTG 11 0.27499999999999997 No Hit NACCTGGTTGATCCTGCCAGTGGAATTCTCGGGTGC 11 0.27499999999999997 No Hit ACACCGATGACGACTGTGAATGGAATTCTCGGGTGC 8 0.2 No Hit ACACGACTCTCGGCAACGGATTGGAATTCTCGGGTG 6 0.15 No Hit NACCTGGTTGATCCTGCCAGTTGGAATTCTCGGGTG 6 0.15 No Hit CCATATGTTCCTTGCCAACCTGGAATTCTCGGGTGC 5 0.125 No Hit TACCTGGTTGATCCTGCCAGTGGAATTCTCGGGGGC 5 0.125 No Hit ACACCGATGACGACTGTGAAGTGGAATTCTCGGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.075 0.0 0.0 0.0 2 0.0 0.075 0.0 0.0 0.0 3 0.0 0.075 0.0 0.0 0.0 4 0.0 0.075 0.0 0.0 0.0 5 0.0 0.075 0.0 0.0 0.0 6 0.0 0.075 0.0 0.0 0.0 7 0.0 0.075 0.0 0.0 0.0 8 0.0 0.1 0.0 0.0 0.0 9 0.0 0.1 0.0 0.0 0.0 10 0.0 0.1 0.0 0.0 0.0 11 0.0 0.1 0.0 0.0 0.0 12 0.0 0.1 0.0 0.0 0.0 13 0.0 0.125 0.0 0.0 0.0 14 0.0 0.125 0.0 0.0 0.0 15 0.0 0.125 0.0 0.0 0.0 16 0.0 0.125 0.0 0.0 0.0 17 0.0 0.275 0.0 0.0 0.0 18 0.0 0.45 0.0 0.0 0.0 19 0.0 0.65 0.0 0.0 0.0 20 0.0 1.025 0.0 0.0 0.0 21 0.0 45.8 0.0 0.0 0.0 22 0.0 95.75 0.0 0.0 0.0 23 0.0 95.9 0.0 0.0 0.0 24 0.0 95.925 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCTGG 60 1.8189894E-12 31.92 1 CGGGTGC 215 0.0 30.303797 30 ATCCTGC 60 5.456968E-12 29.925001 11 GTTGATC 60 5.456968E-12 29.925001 7 TGGTTGA 60 5.456968E-12 29.925001 5 GGTTGAT 60 5.456968E-12 29.925001 6 CAGTTGG 25 3.5796018E-4 29.925001 18 CCAGTTG 25 3.5796018E-4 29.925001 17 CCTGCCA 60 5.456968E-12 29.925001 13 TGATCCT 60 5.456968E-12 29.925001 9 TGCTGGA 20 0.004620802 29.925001 19 GCCAGTT 25 3.5796018E-4 29.925001 16 CTGGTTG 60 5.456968E-12 29.925001 4 ACCTGGT 60 5.456968E-12 29.925001 2 GATCCTG 60 5.456968E-12 29.925001 10 TGCCAGT 60 5.456968E-12 29.925001 15 TTGATCC 60 5.456968E-12 29.925001 8 CTGCCAG 60 5.456968E-12 29.925001 14 TCCTGCC 60 5.456968E-12 29.925001 12 CCTGGTT 60 5.456968E-12 29.925001 3 >>END_MODULE Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592106 spots for SRR6892955.sra Written 3592106 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra Read 3592089 spots for SRR6892955.sra Written 3592089 spots for SRR6892955.sra SRR ids: ['SRR6892955.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_inazm7ix SRR6892955.sra spots: 71841797 blocks: [[1, 3592089], [3592090, 7184178], [7184179, 10776267], [10776268, 14368356], [14368357, 17960445], [17960446, 21552534], [21552535, 25144623], [25144624, 28736712], [28736713, 32328801], [32328802, 35920890], [35920891, 39512979], [39512980, 43105068], [43105069, 46697157], [46697158, 50289246], [50289247, 53881335], [53881336, 57473424], [57473425, 61065513], [61065514, 64657602], [64657603, 68249691], [68249692, 71841797]] SRR6892955 file size 10515625 SRR6892955 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892955 SRR6892955_1.fastq Input file: SRR6892955_1.fastq trimmed: SRR6892955-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:34:17 2024 >> started Fri Dec 6 13:34:58 2024 >> done (41.085s) 71841797 reads processed; of these: 913815 ( 1.27%) short reads filtered out after trimming by size control 425994 ( 0.59%) empty reads filtered out after trimming by size control 70501988 (98.14%) reads available; of these: 4322618 ( 6.13%) trimmed reads available after processing 66179370 (93.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 60656 0.09% 19 60366 0.09% 20 57306 0.08% 21 34178 0.05% 22 15343 0.02% 23 67603 0.10% 24 31878 0.05% 25 26519 0.04% 26 12784 0.02% 27 207650 0.29% 28 40505 0.06% 29 8490 0.01% 30 6919 0.01% 31 14005 0.02% 32 57520 0.08% 33 1608737 2.28% 34 1674688 2.38% 35 337471 0.48% 36 66179370 93.87% 70501988 reads passed initial QC criterion=sequence-density sequence-density=96.55 sequence-density-rank=1 fanout-score=38.67 fanout-score-rank=1 prefix-density=97.51 prefix-fanout=38.3 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTG criterion=fanout-score sequence-density=96.55 sequence-density-rank=1 fanout-score=38.67 fanout-score-rank=1 prefix-density=97.51 prefix-fanout=38.3 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTG -o SRR6892955 - Input file: STDIN trimmed: SRR6892955-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:36:57 2024 >> started Fri Dec 6 13:38:06 2024 >> done (68.726s) 69048339 reads processed; of these: 204166 ( 0.30%) short reads filtered out after trimming by size control 57740 ( 0.08%) empty reads filtered out after trimming by size control 68786433 (99.62%) reads available; of these: 67685393 (98.40%) trimmed reads available after processing 1101040 ( 1.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 178840 0.26% 19 290445 0.42% 20 32747286 47.61% 21 34456081 50.09% 22 93923 0.14% 23 46747 0.07% 24 31204 0.05% 25 30953 0.04% 26 24979 0.04% 27 40060 0.06% 28 11240 0.02% 29 4342 0.01% 30 2902 0.00% 31 2068 0.00% 32 5182 0.01% 33 37357 0.05% 34 20476 0.03% 35 40012 0.06% 36 722336 1.05% criterion=sequence-density sequence-density=9.82 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=17 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=364.22 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=35.9 sequence=TGGAATTCTGGGTGCC Started job on | Dec 06 13:38:34 Started mapping on | Dec 06 13:38:34 Finished on | Dec 06 13:40:20 Mapping speed, Million of reads per hour | 2385.51 Number of input reads | 70240082 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 51751959 Uniquely mapped reads % | 73.68% Average mapped length | 20.47 Number of splices: Total | 2081452 Number of splices: Annotated (sjdb) | 2018612 Number of splices: GT/AG | 2058851 Number of splices: GC/AG | 19817 Number of splices: AT/AC | 1182 Number of splices: Non-canonical | 1602 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5354710 % of reads mapped to multiple loci | 7.62% Number of reads mapped to too many loci | 10876552 % of reads mapped to too many loci | 15.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 13133413 13133413 13133413 N_multimapping 5354710 5354710 5354710 N_noFeature 2065226 2474617 50468905 N_ambiguous 938096 65200 4227 UnstrandedReadsAssigned:48748637 PositiveStrandReadsAssigned:49212142 NegativeStrandReadsAssigned:1278827 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=20 echo kmer=19 SRR6892955 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892955-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 70,240,082 reads, 51,839,116 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,349 rounds 52973 SRR6892955.ke.tsv 35125 SRR6892955.se.tsv 88098 total ==> SRR6892955.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 15.9872 0.472036 PNS24249 1928 1829 286.297 4.36753 PNS24246 1044 945 15.9872 0.472036 PNS24248 1044 945 15.9872 0.472036 PNS24244 1471 1372 1219.74 24.8055 PNS24243 293 194 1 0.143824 KQK14069 1603 1504 13030 241.73 KQK14071 474 375 284.327 21.1553 ==> SRR6892955.se.tsv <== BRADI_1g14170v3 12425 BRADI_1g53295v3 25 BRADI_1g59795v3 282 BRADI_1g07683v3 2 BRADI_1g00485v3 30 BRADI_1g20270v3 3573 BRADI_1g74790v3 302 BRADI_1g09890v3 68 BRADI_1g77505v3 774 BRADI_1g48960v3 27 SRR6892955 completed mapping pipeline successfully