Starting /dee2/code/volunteer_pipeline.sh SRR6892956 current disk space = 1551078907904 free memory = 1601243340 SRR6892956 SRAfilesize a5a2cf21bb1270d6611a57cea34f6f2d SRR6892956.sra SRR6892956.sra file validated SRR6892956 is single end SRR6892956 is conventional basespace SRR6892956 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892956_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.1665 31.0 28.0 31.0 2.0 34.0 2 28.705 31.0 28.0 34.0 16.0 34.0 3 29.623 31.0 28.0 34.0 26.0 34.0 4 33.3415 35.0 33.0 37.0 28.0 37.0 5 32.99125 35.0 33.0 37.0 27.0 37.0 6 32.54225 35.0 32.0 37.0 26.0 37.0 7 32.43775 35.0 32.0 37.0 25.0 37.0 8 32.51875 35.0 32.0 37.0 26.0 37.0 9 33.76075 37.0 33.0 39.0 25.0 39.0 10 33.535 37.0 32.0 39.0 25.0 39.0 11 33.11 37.0 32.0 39.0 23.0 39.0 12 33.14675 37.0 32.0 39.0 23.0 39.0 13 32.91525 37.0 32.0 39.0 22.0 39.0 14 33.69125 38.0 32.0 40.0 19.0 41.0 15 33.495 38.0 32.0 40.0 18.0 41.0 16 32.9665 38.0 32.0 40.0 16.0 41.0 17 32.6985 37.0 31.0 40.0 12.0 41.0 18 32.6 37.0 31.0 40.0 10.0 41.0 19 32.52225 37.0 31.0 40.0 10.0 41.0 20 32.109 37.0 31.0 40.0 8.0 41.0 21 31.4355 37.0 30.0 40.0 2.0 40.0 22 31.07525 37.0 30.0 39.0 2.0 40.0 23 31.47075 37.0 30.0 39.0 2.0 40.0 24 30.12025 36.0 27.0 39.0 2.0 40.0 25 28.29775 34.0 25.0 38.0 2.0 39.0 26 28.80625 34.0 26.0 38.0 2.0 40.0 27 29.2755 35.0 26.0 38.0 2.0 40.0 28 30.2955 36.0 30.0 39.0 2.0 40.0 29 30.3725 36.0 30.0 39.0 2.0 40.0 30 30.58925 37.0 30.0 39.0 2.0 40.0 31 28.373 35.0 24.0 38.0 2.0 40.0 32 26.72725 31.0 21.0 37.0 2.0 39.0 33 28.5195 35.0 25.0 38.0 2.0 40.0 34 29.812 36.0 30.0 39.0 2.0 40.0 35 28.722 35.0 27.0 38.0 2.0 40.0 36 26.9585 33.0 23.0 38.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 109.0 3 0.0 4 19.0 5 25.0 6 13.0 7 14.0 8 20.0 9 20.0 10 35.0 11 20.0 12 20.0 13 30.0 14 39.0 15 33.0 16 34.0 17 38.0 18 33.0 19 33.0 20 30.0 21 40.0 22 46.0 23 39.0 24 42.0 25 58.0 26 49.0 27 63.0 28 87.0 29 112.0 30 114.0 31 143.0 32 173.0 33 253.0 34 277.0 35 404.0 36 473.0 37 548.0 38 470.0 39 44.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.343844255552508 22.593912805045242 26.048807238826434 33.01343570057582 2 24.45 19.8 25.1 30.65 3 29.9 21.425 22.925 25.75 4 28.207051762940733 21.555388847211805 20.880220055013755 29.35733933483371 5 27.5887943971986 22.861430715357677 20.060030015007506 29.48974487243622 6 31.157419030881243 18.55385387898569 22.64624654782827 27.6424805423048 7 29.402910185649773 20.597089814350227 22.75464124435524 27.245358755644755 8 30.108067353606433 20.055290273938176 23.498366423724555 26.33827594873084 9 32.14375471223926 21.73913043478261 22.090977632571 24.026137220407136 10 32.4534942182001 20.03519356460533 20.53795877325289 26.97335344394168 11 30.51784816490699 20.588235294117645 20.94017094017094 27.953745600804424 12 32.6797385620915 19.934640522875817 22.046254399195576 25.339366515837103 13 31.77476118652589 21.19155354449472 20.66365007541478 26.370035193564608 14 30.36701860231272 19.859225741578683 20.13574660633484 29.638009049773757 15 31.825037707390646 20.01005530417295 24.710910005027653 23.453996983408747 16 34.590246354952235 18.225238813474107 22.071392659627953 25.1131221719457 17 28.88386123680241 19.53242835595777 26.671694318753143 24.912016088486677 18 33.10708898944193 20.6385118149824 25.339366515837103 20.915032679738562 19 35.26897938662645 21.794871794871796 21.19155354449472 21.74459527400704 20 38.159879336349924 21.518350930115638 20.26143790849673 20.060331825037707 21 17.621920563097035 8.848667672197084 58.32076420311715 15.208647561588737 22 1.6842634489693313 0.4524886877828055 54.499748617395674 43.36349924585219 23 43.21266968325792 0.22624434389140274 0.7541478129713424 55.80693815987934 24 57.10334422931859 0.5280362081971335 41.589137540859944 0.77948202162434 25 1.6842634489693313 42.86073403720462 54.55002513826043 0.904977375565611 26 1.0055304172951232 54.952237305178485 43.31322272498743 0.7290095525389643 27 44.09250879839115 0.40221216691804923 54.77626948215184 0.7290095525389643 28 55.957767722473605 0.47762694821518353 0.6787330316742082 42.885872297637 29 1.7596782302664655 0.47762694821518353 0.4273504273504274 97.33534439416792 30 43.51432880844646 0.301659125188537 0.6535947712418301 55.53041729512318 31 56.711915535444945 0.22624434389140274 41.377576671694314 1.6842634489693313 32 2.1367521367521367 0.32679738562091504 53.94670688788336 43.58974358974359 33 0.8250000000000001 0.375 44.35 54.449999999999996 34 0.44999999999999996 0.075 98.575 0.8999999999999999 35 0.4506760140210316 0.3254882323485228 57.51126690035052 41.71256885327992 36 0.9600808489135927 0.15159171298635674 44.18898433552299 54.69934310257706 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 2.0 6 2.0 7 3.5 8 5.0 9 5.0 10 6.0 11 7.0 12 7.0 13 7.0 14 7.0 15 4.0 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 3.0 26 3.0 27 3.0 28 3.0 29 4.5 30 6.0 31 6.0 32 10.0 33 14.0 34 14.0 35 34.5 36 55.0 37 55.0 38 81.5 39 108.0 40 166.5 41 225.0 42 225.0 43 260.0 44 295.0 45 295.0 46 339.0 47 383.0 48 383.0 49 406.5 50 430.0 51 418.5 52 407.0 53 407.0 54 390.5 55 374.0 56 374.0 57 377.5 58 381.0 59 381.0 60 390.0 61 399.0 62 399.0 63 361.5 64 324.0 65 313.5 66 303.0 67 303.0 68 226.0 69 149.0 70 149.0 71 110.5 72 72.0 73 72.0 74 52.0 75 32.0 76 20.0 77 8.0 78 8.0 79 6.0 80 4.0 81 4.0 82 2.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.825 2 0.0 3 0.0 4 0.025 5 0.05 6 0.42500000000000004 7 0.35000000000000003 8 0.525 9 0.525 10 0.5499999999999999 11 0.5499999999999999 12 0.5499999999999999 13 0.5499999999999999 14 0.5499999999999999 15 0.5499999999999999 16 0.5499999999999999 17 0.5499999999999999 18 0.5499999999999999 19 0.5499999999999999 20 0.5499999999999999 21 0.5499999999999999 22 0.5499999999999999 23 0.5499999999999999 24 0.575 25 0.5499999999999999 26 0.5499999999999999 27 0.5499999999999999 28 0.5499999999999999 29 0.5499999999999999 30 0.5499999999999999 31 0.5499999999999999 32 0.5499999999999999 33 0.0 34 0.0 35 0.15 36 1.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.38453389830508 92.875 2 0.9004237288135594 1.7000000000000002 3 0.15889830508474578 0.44999999999999996 4 0.1059322033898305 0.4 5 0.026483050847457626 0.125 6 0.026483050847457626 0.15 7 0.07944915254237289 0.525 8 0.1059322033898305 0.8 9 0.05296610169491525 0.44999999999999996 >10 0.15889830508474578 2.5250000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACACCGATGACGACTGTGAATCGTATGCCGTCTTCT 28 0.7000000000000001 No Hit GCGACCCCAGGTCAGGCGGGATCGTATGCCGTCTTC 23 0.575 No Hit CCACCAACACCGGCCCTAGTGTCGTATGCCGTCTTC 15 0.375 No Hit ACACCGATGACGACTGTGAAGTCGTATGCCGTCTTC 13 0.325 No Hit GCGACCCCAGGTCAGGCGGGTCGTATGCCGTCTTCT 11 0.27499999999999997 No Hit TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTC 11 0.27499999999999997 No Hit CTACGTGAGCCCGGAGAGAGTCGTATGCCGTCTTCT 9 0.22499999999999998 No Hit ACGTGTCAGTTGGACCAGGATCGTATGCCGTCTTCT 9 0.22499999999999998 No Hit AGAGAGGGTATTGGTAATAATTCGTATGCCGTCTTC 8 0.2 No Hit GCAATGAAAGGCTTGATTTGCTCGTATGCCGTCTTC 8 0.2 No Hit CTACGTGAGCCCGGAGAGAGTTCGTATGCCGTCTTC 8 0.2 No Hit ACTGATGATGAACTAACTCGGTCGTATGCCGTCTTC 8 0.2 No Hit CGACACGACTCTCGGCAACGGTCGTATGCCGTCTTC 7 0.17500000000000002 No Hit TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCT 7 0.17500000000000002 No Hit TCTCATGGAGAGTTCGATCCTTCGTATGCCGTCTTC 7 0.17500000000000002 No Hit CCGCTGGAGAACTACTGCAAGTCGTATGCCGTCTTC 6 0.15 No Hit CATCGAGTAGACCTTGTTATTCGTATGCCGTCTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTCT 155 0.0 29.873419 30 ACTCGTA 30 0.0010490434 24.894516 20 TTCGTAT 90 8.0035534E-10 19.915611 21 GCTCGTA 45 4.3815674E-4 19.915611 20 GTTCGTA 45 4.3815674E-4 19.915611 20 CTCGTAT 115 1.8189894E-12 19.482664 21 GTCGTAT 95 1.5734258E-9 18.867422 20 GGTCGTA 50 8.9195906E-4 17.924051 19 CGTCTTC 350 0.0 17.070526 30 ATCGTAT 70 2.1105789E-5 17.070524 21 GTATGCC 360 0.0 17.011251 24 TATGCCG 360 0.0 17.011251 25 CGTATGC 360 0.0 17.011251 23 TGCCGTC 355 0.0 16.830095 27 CCGTCTT 355 0.0 16.830095 29 GCCGTCT 355 0.0 16.830095 28 TCGTATG 365 0.0 16.778221 22 ATGCCGT 360 0.0 16.596342 26 >>END_MODULE Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838748 spots for SRR6892956.sra Written 4838748 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra Read 4838732 spots for SRR6892956.sra Written 4838732 spots for SRR6892956.sra SRR ids: ['SRR6892956.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9mht2mqp SRR6892956.sra spots: 96774656 blocks: [[1, 4838732], [4838733, 9677464], [9677465, 14516196], [14516197, 19354928], [19354929, 24193660], [24193661, 29032392], [29032393, 33871124], [33871125, 38709856], [38709857, 43548588], [43548589, 48387320], [48387321, 53226052], [53226053, 58064784], [58064785, 62903516], [62903517, 67742248], [67742249, 72580980], [72580981, 77419712], [77419713, 82258444], [82258445, 87097176], [87097177, 91935908], [91935909, 96774656]] SRR6892956 file size 14169081 SRR6892956 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892956 SRR6892956_1.fastq Input file: SRR6892956_1.fastq trimmed: SRR6892956-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:37:24 2024 >> started Fri Dec 6 13:38:32 2024 >> done (68.334s) 96774656 reads processed; of these: 3955669 ( 4.09%) short reads filtered out after trimming by size control 2223883 ( 2.30%) empty reads filtered out after trimming by size control 90595104 (93.61%) reads available; of these: 8492774 ( 9.37%) trimmed reads available after processing 82102330 (90.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 381645 0.42% 19 434435 0.48% 20 624979 0.69% 21 720547 0.80% 22 542187 0.60% 23 470898 0.52% 24 235624 0.26% 25 63314 0.07% 26 55500 0.06% 27 80681 0.09% 28 98705 0.11% 29 542287 0.60% 30 370130 0.41% 31 402620 0.44% 32 98575 0.11% 33 139031 0.15% 34 1867697 2.06% 35 1363919 1.51% 36 82102330 90.63% 90595104 reads passed initial QC criterion=sequence-density sequence-density=88.12 sequence-density-rank=1 fanout-score=45.46 fanout-score-rank=1 prefix-density=90.77 prefix-fanout=44.1 sequence=TCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=88.12 sequence-density-rank=1 fanout-score=45.46 fanout-score-rank=1 prefix-density=90.77 prefix-fanout=44.1 sequence=TCGTATGCCGTCTTCTGCTTGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGA -o SRR6892956 - Input file: STDIN trimmed: SRR6892956-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:40:26 2024 >> started Fri Dec 6 13:41:29 2024 >> done (63.511s) 88559259 reads processed; of these: 178557 ( 0.20%) short reads filtered out after trimming by size control 7451 ( 0.01%) empty reads filtered out after trimming by size control 88373251 (99.79%) reads available; of these: 85286301 (96.51%) trimmed reads available after processing 3086950 ( 3.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 434161 0.49% 19 698158 0.79% 20 39050772 44.19% 21 46661835 52.80% 22 682487 0.77% 23 426218 0.48% 24 129406 0.15% 25 71259 0.08% 26 65687 0.07% 27 45563 0.05% 28 26723 0.03% 29 18155 0.02% 30 13685 0.02% 31 7329 0.01% 32 2677 0.00% 33 1833 0.00% 34 5948 0.01% 35 4570 0.01% 36 26785 0.03% criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=18 prefix-density=0.00 prefix-fanout=1.0 sequence=CCACCAACACCGGCCCTAGTGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=13.49 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.4 sequence=CGCCGCCGCCGCAGGCTCCATTGCTGA Started job on | Dec 06 13:42:09 Started mapping on | Dec 06 13:42:09 Finished on | Dec 06 13:44:11 Mapping speed, Million of reads per hour | 2667.81 Number of input reads | 90409096 Average input read length | 20 UNIQUE READS: Uniquely mapped reads number | 76982708 Uniquely mapped reads % | 85.15% Average mapped length | 20.48 Number of splices: Total | 2478963 Number of splices: Annotated (sjdb) | 2325449 Number of splices: GT/AG | 2456228 Number of splices: GC/AG | 19989 Number of splices: AT/AC | 1093 Number of splices: Non-canonical | 1653 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.83 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 8463722 % of reads mapped to multiple loci | 9.36% Number of reads mapped to too many loci | 2816836 % of reads mapped to too many loci | 3.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4962666 4962666 4962666 N_multimapping 8463722 8463722 8463722 N_noFeature 4824045 5901042 74522738 N_ambiguous 1497991 116318 10457 UnstrandedReadsAssigned:70660672 PositiveStrandReadsAssigned:70965348 NegativeStrandReadsAssigned:2449513 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=20 echo kmer=19 SRR6892956 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892956-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 90,409,096 reads, 69,772,342 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,509 rounds 52973 SRR6892956.ke.tsv 35125 SRR6892956.se.tsv 88098 total ==> SRR6892956.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 32.4648 0.737189 PNS24249 1928 1829 821.696 9.64042 PNS24246 1044 945 32.4648 0.737189 PNS24248 1044 945 32.4648 0.737189 PNS24244 1471 1372 4898.91 76.6202 PNS24243 293 194 1 0.110611 KQK14069 1603 1504 42345.7 604.17 KQK14071 474 375 840.016 48.0678 ==> SRR6892956.se.tsv <== BRADI_1g14170v3 40759 BRADI_1g53295v3 165 BRADI_1g59795v3 536 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 314 BRADI_1g74790v3 1000 BRADI_1g09890v3 6 BRADI_1g77505v3 849 BRADI_1g48960v3 4 SRR6892956 completed mapping pipeline successfully