Starting /dee2/code/volunteer_pipeline.sh SRR6892957 current disk space = 1551068155904 free memory = 1603768560 SRR6892957 SRAfilesize 841c21d668f848858221f14d5ea99159 SRR6892957.sra SRR6892957.sra file validated SRR6892957 is single end SRR6892957 is conventional basespace SRR6892957 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892957_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.63325 31.0 28.0 31.0 2.0 34.0 2 28.6815 31.0 28.0 34.0 16.0 34.0 3 29.957 31.0 28.0 34.0 25.0 34.0 4 33.82475 35.0 33.0 37.0 30.0 37.0 5 33.4065 35.0 33.0 37.0 28.0 37.0 6 33.42075 35.0 33.0 37.0 28.0 37.0 7 33.36275 35.0 33.0 37.0 28.0 37.0 8 33.19425 35.0 33.0 37.0 27.0 37.0 9 34.55575 37.0 34.0 39.0 27.0 39.0 10 34.506 38.0 34.0 39.0 27.0 39.0 11 34.29175 37.0 34.0 39.0 27.0 39.0 12 34.342 37.0 34.0 39.0 27.0 39.0 13 34.05225 37.0 33.0 39.0 26.0 39.0 14 34.947 38.0 34.0 40.0 26.0 41.0 15 34.63525 38.0 33.0 40.0 25.0 41.0 16 34.49875 38.0 33.0 40.0 25.0 41.0 17 34.3205 38.0 33.0 40.0 24.0 41.0 18 34.0595 38.0 33.0 40.0 22.0 41.0 19 34.0515 38.0 33.0 40.0 22.0 41.0 20 34.021 38.0 33.0 40.0 21.0 41.0 21 33.59475 38.0 32.0 40.0 18.0 41.0 22 33.6965 38.0 32.0 40.0 23.0 41.0 23 33.75875 38.0 33.0 40.0 21.0 41.0 24 32.064 37.0 31.0 39.0 9.0 40.0 25 30.82675 36.0 30.0 38.0 8.0 39.0 26 31.18375 36.0 29.0 39.0 9.0 40.0 27 31.97675 37.0 30.0 40.0 9.0 40.0 28 32.613 38.0 32.0 40.0 8.0 40.0 29 33.415 38.0 33.0 40.0 9.0 40.0 30 33.00675 38.0 32.0 40.0 2.0 41.0 31 31.16525 37.0 30.0 39.0 2.0 40.0 32 29.9025 35.0 27.0 38.0 2.0 39.0 33 31.3025 37.0 30.0 39.0 2.0 40.0 34 32.62925 38.0 33.0 40.0 2.0 40.0 35 31.26 37.0 30.0 39.0 2.0 40.0 36 29.33925 35.0 27.0 38.0 2.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 78.0 3 0.0 4 12.0 5 18.0 6 14.0 7 15.0 8 7.0 9 14.0 10 13.0 11 17.0 12 12.0 13 16.0 14 12.0 15 20.0 16 19.0 17 18.0 18 24.0 19 27.0 20 30.0 21 34.0 22 32.0 23 48.0 24 36.0 25 50.0 26 60.0 27 81.0 28 69.0 29 85.0 30 90.0 31 111.0 32 162.0 33 214.0 34 250.0 35 371.0 36 497.0 37 656.0 38 701.0 39 87.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.496018202502842 24.971558589306028 30.062571103526736 28.46985210466439 2 20.4 23.45 31.624999999999996 24.525 3 25.95 23.275000000000002 27.85 22.925 4 25.756439109777446 24.706176544136035 25.256314078519633 24.281070267566893 5 26.588294147073537 25.337668834417208 25.53776888444222 22.536268134067033 6 27.539503386004515 21.896162528216703 27.48934035615751 23.07499372962127 7 29.062186559679038 22.617853560682047 28.43530591775326 19.884653961885657 8 27.3365071410674 21.523427712352795 30.243046855424705 20.8970182911551 9 29.26278836509529 21.940822467402207 28.761283851554666 20.035105315947842 10 30.198143967895664 22.72385252069225 24.70529219964886 22.37271131176323 11 27.61212728639439 22.851415685291908 25.281884239538964 24.25457278877474 12 28.36008024072217 21.489468405215646 27.708124373119357 22.442326980942827 13 27.74015550539253 23.175319789315274 24.630047654878354 24.454477050413846 14 28.582183186951067 22.233375156838143 25.62107904642409 23.5633626097867 15 29.460476787954832 22.910915934755334 28.306148055207025 19.32245922208281 16 32.47176913425346 19.673776662484315 25.972396486825595 21.882057716436638 17 26.14805520702635 21.104140526976163 29.33500627352572 23.41279799247177 18 31.66875784190715 20.903387703889585 27.95483061480552 19.47302383939774 19 34.730238393977416 25.345043914680048 21.329987452948558 18.59473023839398 20 36.060225846925974 22.33375156838143 21.9573400250941 19.648682559598495 21 14.228356336260978 9.008782936010038 64.366373902133 12.396486825595986 22 0.7779171894604767 0.17565872020075282 50.16311166875784 48.883312421580925 23 48.5069008782936 0.2509410288582183 0.4767879548306148 50.76537013801756 24 51.96988707653701 0.32622333751568383 47.00125470514429 0.7026348808030113 25 0.8030112923462985 48.45671267252196 49.91217063989962 0.8281053952321205 26 0.7277289836888331 50.36386449184441 48.45671267252196 0.451693851944793 27 48.782936010037645 0.150564617314931 50.53952321204517 0.5269761606022585 28 51.06649937264742 0.150564617314931 0.2258469259723965 48.55708908406525 29 0.9535759096612296 0.2258469259723965 0.301129234629862 98.51944792973651 30 48.80803011292346 0.2258469259723965 0.40150564617314927 50.56461731493099 31 51.819322459222086 0.10037641154328732 47.1267252195734 0.9535759096612296 32 0.9786700125470514 0.20075282308657463 50.08782936010038 48.732747804266 33 0.3 0.35000000000000003 49.3 50.05 34 0.25012506253126565 0.0 99.19959979989996 0.5502751375687844 35 0.27548209366391185 0.12521913348359628 52.191334835962934 47.40796393688956 36 0.6555723651033787 0.27735753908219873 49.62178517397882 49.4452849218356 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 1.5 5 2.0 6 2.0 7 2.0 8 2.0 9 2.0 10 3.5 11 5.0 12 5.0 13 3.5 14 2.0 15 2.0 16 2.0 17 2.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 2.0 29 2.5 30 3.0 31 3.0 32 14.0 33 25.0 34 25.0 35 48.5 36 72.0 37 72.0 38 117.5 39 163.0 40 237.5 41 312.0 42 312.0 43 388.5 44 465.0 45 465.0 46 514.0 47 563.0 48 563.0 49 565.5 50 568.0 51 577.5 52 587.0 53 587.0 54 480.0 55 373.0 56 373.0 57 359.0 58 345.0 59 345.0 60 294.0 61 243.0 62 243.0 63 185.5 64 128.0 65 105.5 66 83.0 67 83.0 68 58.0 69 33.0 70 33.0 71 22.5 72 12.0 73 12.0 74 9.0 75 6.0 76 3.5 77 1.0 78 1.0 79 1.0 80 1.0 81 1.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.1 2 0.0 3 0.0 4 0.025 5 0.05 6 0.325 7 0.3 8 0.22499999999999998 9 0.3 10 0.325 11 0.22499999999999998 12 0.3 13 0.325 14 0.375 15 0.375 16 0.375 17 0.375 18 0.375 19 0.375 20 0.375 21 0.375 22 0.375 23 0.375 24 0.375 25 0.375 26 0.375 27 0.375 28 0.375 29 0.375 30 0.375 31 0.375 32 0.375 33 0.0 34 0.05 35 0.17500000000000002 36 0.8500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.09906291834002 91.60000000000001 2 1.0977242302543508 2.0500000000000003 3 0.1606425702811245 0.44999999999999996 4 0.107095046854083 0.4 5 0.02677376171352075 0.125 6 0.107095046854083 0.6 7 0.0535475234270415 0.35000000000000003 8 0.08032128514056225 0.6 9 0.02677376171352075 0.22499999999999998 >10 0.24096385542168677 3.5999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCT 21 0.525 No Hit ACACCGATGACGACTGTGAATCGTATGCCGTCTTCT 21 0.525 No Hit TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTC 18 0.44999999999999996 No Hit ACACCGATGACGACTGTGAAGTCGTATGCCGTCTTC 17 0.42500000000000004 No Hit CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCT 16 0.4 No Hit CTACGTGAGCCCGGAGAGAGTCGTATGCCGTCTTCT 14 0.35000000000000003 No Hit CATCGAGTAGACCTTGTTATTCGTATGCCGTCTTCT 14 0.35000000000000003 No Hit GCGACCCCAGGTCAGGCGGGTCGTATGCCGTCTTCT 13 0.325 No Hit CGACACGACTCTCGGCAACGGTCGTATGCCGTCTTC 10 0.25 No Hit AGAGAGGGTATTGGTAATAATTCGTATGCCGTCTTC 9 0.22499999999999998 No Hit GCGACCCCAGGTCAGGCGGGATCGTATGCCGTCTTC 8 0.2 No Hit CTACGTGAGCCCGGAGAGAGTTCGTATGCCGTCTTC 8 0.2 No Hit ACTGATGATGAACTAACTCGGTCGTATGCCGTCTTC 8 0.2 No Hit AGAAGATTAGAAGATTATGAGTCGTATGCCGTCTTC 7 0.17500000000000002 No Hit NACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCT 7 0.17500000000000002 No Hit TAACTTGATATGTAAGTGGGTTCGTATGCCGTCTTC 6 0.15 No Hit AGAAGATTAGAAGATTATGATCGTATGCCGTCTTCT 6 0.15 No Hit TAGGCCGTGTTTTCACGGGCTCGTATGCCGTCTTCT 6 0.15 No Hit TCTCATGGAGAGTTCGATCCTTCGTATGCCGTCTTC 6 0.15 No Hit TCAAAAGAGGAAAGGCTTGCTCGTATGCCGTCTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCGTA 20 0.004633486 29.898735 19 GTCTTCT 180 0.0 29.898733 30 GTTCGTA 35 0.0025635096 21.356237 20 CTCGTAT 80 5.14774E-9 20.555382 21 GGTCGTA 45 4.3565483E-4 19.93249 20 GTCGTAT 80 1.3366298E-7 18.68671 21 TTCGTAT 135 1.4551915E-11 16.610407 20 GTATGCC 375 0.0 16.344643 24 TATGCCG 375 0.0 16.344643 25 CGTATGC 375 0.0 16.344643 23 TCGTATG 375 0.0 16.344643 22 TGCCGTC 370 0.0 15.7574415 27 CCGTCTT 370 0.0 15.7574415 29 ATGCCGT 370 0.0 15.7574415 26 GCCGTCT 370 0.0 15.7574415 28 CGTCTTC 370 0.0 15.7574415 30 ATCGTAT 80 6.606201E-5 14.949368 20 >>END_MODULE Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302546 spots for SRR6892957.sra Written 5302546 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra Read 5302542 spots for SRR6892957.sra Written 5302542 spots for SRR6892957.sra SRR ids: ['SRR6892957.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ogpiyf5 SRR6892957.sra spots: 106050844 blocks: [[1, 5302542], [5302543, 10605084], [10605085, 15907626], [15907627, 21210168], [21210169, 26512710], [26512711, 31815252], [31815253, 37117794], [37117795, 42420336], [42420337, 47722878], [47722879, 53025420], [53025421, 58327962], [58327963, 63630504], [63630505, 68933046], [68933047, 74235588], [74235589, 79538130], [79538131, 84840672], [84840673, 90143214], [90143215, 95445756], [95445757, 100748298], [100748299, 106050844]] SRR6892957 file size 15533943 SRR6892957 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892957 SRR6892957_1.fastq Input file: SRR6892957_1.fastq trimmed: SRR6892957-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:37:36 2024 >> started Fri Dec 6 13:38:43 2024 >> done (66.989s) 106050844 reads processed; of these: 3521200 ( 3.32%) short reads filtered out after trimming by size control 2740116 ( 2.58%) empty reads filtered out after trimming by size control 99789528 (94.10%) reads available; of these: 8249457 ( 8.27%) trimmed reads available after processing 91540071 (91.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 302758 0.30% 19 361274 0.36% 20 558307 0.56% 21 739336 0.74% 22 503236 0.50% 23 377708 0.38% 24 169516 0.17% 25 44980 0.05% 26 33731 0.03% 27 56744 0.06% 28 66269 0.07% 29 527949 0.53% 30 252227 0.25% 31 300921 0.30% 32 66789 0.07% 33 97358 0.10% 34 2257267 2.26% 35 1533087 1.54% 36 91540071 91.73% 99789528 reads passed initial QC criterion=sequence-density sequence-density=92.18 sequence-density-rank=1 fanout-score=43.76 fanout-score-rank=1 prefix-density=93.89 prefix-fanout=43.0 sequence=TCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=92.18 sequence-density-rank=1 fanout-score=43.76 fanout-score-rank=1 prefix-density=93.89 prefix-fanout=43.0 sequence=TCGTATGCCGTCTTCTGCTTGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGA -o SRR6892957 - Input file: STDIN trimmed: SRR6892957-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:40:41 2024 >> started Fri Dec 6 13:42:30 2024 >> done (108.953s) 97643517 reads processed; of these: 195105 ( 0.20%) short reads filtered out after trimming by size control 4666 ( 0.00%) empty reads filtered out after trimming by size control 97443746 (99.80%) reads available; of these: 94604680 (97.09%) trimmed reads available after processing 2839066 ( 2.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 341485 0.35% 19 688688 0.71% 20 45096047 46.28% 21 50132151 51.45% 22 592038 0.61% 23 342149 0.35% 24 68058 0.07% 25 27754 0.03% 26 21684 0.02% 27 20873 0.02% 28 16550 0.02% 29 16866 0.02% 30 12928 0.01% 31 6570 0.01% 32 3214 0.00% 33 2745 0.00% 34 7910 0.01% 35 6108 0.01% 36 39928 0.04% criterion=sequence-density sequence-density=1.46 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=8 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=1.96 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.0 sequence=GCCTTCAAGCCACCGGGCTGCGAGGAATCC Started job on | Dec 06 13:43:04 Started mapping on | Dec 06 13:43:04 Finished on | Dec 06 13:45:16 Mapping speed, Million of reads per hour | 2716.08 Number of input reads | 99589757 Average input read length | 20 UNIQUE READS: Uniquely mapped reads number | 84383252 Uniquely mapped reads % | 84.73% Average mapped length | 20.45 Number of splices: Total | 2576383 Number of splices: Annotated (sjdb) | 2415016 Number of splices: GT/AG | 2549908 Number of splices: GC/AG | 24201 Number of splices: AT/AC | 1420 Number of splices: Non-canonical | 854 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 8583115 % of reads mapped to multiple loci | 8.62% Number of reads mapped to too many loci | 4370183 % of reads mapped to too many loci | 4.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6623390 6623390 6623390 N_multimapping 8583115 8583115 8583115 N_noFeature 5746829 6628160 81892047 N_ambiguous 1714718 112759 9899 UnstrandedReadsAssigned:76921705 PositiveStrandReadsAssigned:77642333 NegativeStrandReadsAssigned:2481306 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=20 echo kmer=19 SRR6892957 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892957-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 99,589,757 reads, 75,230,007 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,415 rounds 52973 SRR6892957.ke.tsv 35125 SRR6892957.se.tsv 88098 total ==> SRR6892957.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 16.2677 0.35028 PNS24249 1928 1829 250.717 2.78929 PNS24246 1044 945 16.2677 0.35028 PNS24248 1044 945 16.2677 0.35028 PNS24244 1471 1372 2663.48 39.5019 PNS24243 293 194 4 0.419548 KQK14069 1603 1504 70715.9 956.735 KQK14071 474 375 368.184 19.9782 ==> SRR6892957.se.tsv <== BRADI_1g14170v3 68645 BRADI_1g53295v3 208 BRADI_1g59795v3 519 BRADI_1g07683v3 6 BRADI_1g00485v3 83 BRADI_1g20270v3 5560 BRADI_1g74790v3 676 BRADI_1g09890v3 70 BRADI_1g77505v3 1267 BRADI_1g48960v3 4 SRR6892957 completed mapping pipeline successfully