Starting /dee2/code/volunteer_pipeline.sh SRR6892958 current disk space = 1550911873024 free memory = 1475567572 SRR6892958 SRAfilesize 31d01060c029a3fb1acee3f2610f56b4 SRR6892958.sra SRR6892958.sra file validated SRR6892958 is single end SRR6892958 is conventional basespace SRR6892958 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892958_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.50375 30.0 16.0 31.0 2.0 33.0 2 27.021 31.0 19.0 31.0 16.0 34.0 3 29.15375 31.0 28.0 31.0 25.0 34.0 4 33.644 35.0 33.0 35.0 30.0 37.0 5 33.812 35.0 33.0 35.0 30.0 37.0 6 33.98975 35.0 33.0 37.0 30.0 37.0 7 33.83175 35.0 33.0 37.0 30.0 37.0 8 34.0735 35.0 33.0 37.0 30.0 37.0 9 35.36725 37.0 34.0 39.0 30.0 39.0 10 35.19725 37.0 34.0 39.0 30.0 39.0 11 35.233 37.0 34.0 39.0 30.0 39.0 12 35.28275 37.0 34.0 39.0 30.0 39.0 13 35.327 37.0 34.0 39.0 30.0 39.0 14 35.646 38.0 33.0 40.0 28.0 41.0 15 35.8575 38.0 34.0 40.0 28.0 41.0 16 36.05075 38.0 34.0 40.0 30.0 41.0 17 35.66225 37.0 33.0 40.0 29.0 41.0 18 35.562 37.0 33.0 40.0 27.0 41.0 19 35.9825 38.0 34.0 40.0 30.0 41.0 20 35.6835 38.0 34.0 40.0 27.0 41.0 21 36.73475 38.0 36.0 40.0 31.0 41.0 22 37.45325 39.0 36.0 40.0 33.0 41.0 23 37.72625 39.0 37.0 40.0 33.0 41.0 24 36.39275 38.0 36.0 40.0 30.0 40.0 25 36.0915 37.0 35.0 39.0 31.0 40.0 26 36.774 38.0 36.0 40.0 31.0 40.0 27 37.62875 40.0 37.0 40.0 32.0 41.0 28 38.102 40.0 37.0 40.0 33.0 41.0 29 39.4865 40.0 39.0 41.0 37.0 41.0 30 38.28175 40.0 38.0 40.0 33.0 41.0 31 36.15975 38.0 35.0 40.0 30.0 41.0 32 35.41975 37.0 34.0 39.0 30.0 40.0 33 36.264 38.0 35.0 40.0 30.0 40.0 34 38.70925 40.0 38.0 40.0 35.0 41.0 35 37.26025 39.0 35.0 40.0 31.0 41.0 36 36.00875 38.0 34.0 40.0 30.0 41.0 37 35.992 38.0 34.0 40.0 29.0 41.0 38 35.514 38.0 33.0 40.0 27.0 41.0 39 35.7315 38.0 34.0 40.0 27.0 41.0 40 38.31075 40.0 37.0 40.0 35.0 41.0 41 37.32075 40.0 36.0 40.0 31.0 41.0 42 34.233 37.0 33.0 39.0 26.0 40.0 43 35.89775 37.0 34.0 39.0 31.0 40.0 44 38.4755 39.0 38.0 40.0 36.0 41.0 45 39.39225 40.0 40.0 40.0 38.0 41.0 46 39.7685 40.0 40.0 40.0 39.0 41.0 47 2.0 2.0 2.0 2.0 2.0 2.0 48 2.0 2.0 2.0 2.0 2.0 2.0 49 2.0 2.0 2.0 2.0 2.0 2.0 50 2.0 2.0 2.0 2.0 2.0 2.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 2.0 18 1.0 19 2.0 20 0.0 21 3.0 22 6.0 23 7.0 24 19.0 25 30.0 26 61.0 27 76.0 28 120.0 29 184.0 30 263.0 31 354.0 32 537.0 33 653.0 34 727.0 35 643.0 36 309.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.547237659365805 29.32330827067669 32.23275580254985 23.896698267407647 2 20.875 22.95 30.7 25.474999999999998 3 23.849999999999998 25.775 29.349999999999998 21.025 4 24.675 25.775 27.025 22.525000000000002 5 23.225 28.999999999999996 27.775 20.0 6 25.05 24.224999999999998 30.225 20.5 7 23.875 25.474999999999998 32.425 18.224999999999998 8 22.85 24.975 34.150000000000006 18.025 9 25.75 24.075 30.75 19.425 10 25.874999999999996 25.775 28.325 20.025000000000002 11 25.224999999999998 25.4 27.750000000000004 21.625 12 28.225 24.0 28.1 19.675 13 25.71285642821411 25.337668834417208 28.53926963481741 20.410205102551277 14 25.324999999999996 23.45 27.725 23.5 15 25.374999999999996 25.324999999999996 30.025000000000002 19.275000000000002 16 28.549999999999997 21.65 29.15 20.65 17 23.65 25.224999999999998 30.875000000000004 20.25 18 27.875 24.5 29.4 18.224999999999998 19 30.15 26.025 26.924999999999997 16.900000000000002 20 30.75 24.95 27.35 16.950000000000003 21 13.100000000000001 11.1 64.725 11.075 22 0.625 0.025 50.724999999999994 48.625 23 48.65 0.075 0.75 50.525 24 50.724999999999994 0.575 48.525 0.17500000000000002 25 0.2 48.575 51.1 0.125 26 0.625 50.525 48.699999999999996 0.15 27 48.65 0.125 50.6 0.625 28 50.6 0.05 0.17500000000000002 49.175000000000004 29 0.675 0.025 0.15 99.15 30 48.625 0.0 0.65 50.724999999999994 31 50.775000000000006 0.0 48.475 0.75 32 0.125 0.0 51.05 48.825 33 0.075 0.0 49.275000000000006 50.64999999999999 34 0.075 0.0 99.225 0.7000000000000001 35 0.075 0.0 51.275000000000006 48.65 36 0.5499999999999999 0.0 48.8 50.64999999999999 37 48.6 0.0 50.724999999999994 0.675 38 50.5 0.025 0.8250000000000001 48.65 39 0.2001000500250125 0.05002501250625312 49.17458729364682 50.57528764382191 40 0.6003001500750376 0.12506253126563283 99.12456228114057 0.1500750375187594 41 48.562140535133786 0.6751687921980495 50.71267816954238 0.05001250312578145 42 50.575 49.15 0.22499999999999998 0.05 43 0.15 99.75 0.1 0.0 44 0.05 99.9 0.05 0.0 45 0.025 99.95 0.025 0.0 46 0.0 100.0 0.0 0.0 47 NaN NaN NaN NaN 48 NaN NaN NaN NaN 49 NaN NaN NaN NaN 50 NaN NaN NaN NaN >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 2.0 27 5.5 28 9.0 29 27.0 30 45.0 31 102.5 32 160.0 33 224.5 34 289.0 35 391.0 36 493.0 37 556.0 38 619.0 39 623.5 40 628.0 41 612.5 42 597.0 43 538.0 44 479.0 45 389.5 46 300.0 47 238.5 48 177.0 49 133.5 50 90.0 51 78.0 52 66.0 53 46.5 54 27.0 55 18.5 56 10.0 57 8.0 58 6.0 59 3.5 60 1.0 61 0.5 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.05 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.05 40 0.05 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 100.0 48 100.0 49 100.0 50 100.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67829764736982 93.325 2 0.5551149881046789 1.05 3 0.23790642347343377 0.675 4 0.1586042823156225 0.6 5 0.10573618821041501 0.5 6 0.05286809410520751 0.3 7 0.0 0.0 8 0.026434047052603753 0.2 9 0.026434047052603753 0.22499999999999998 >10 0.1586042823156225 3.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACACCGATGACGACTGTGAATCGTATGCCGTCTTCTGCTTGAAAAANNNN 32 0.8 Illumina Single End Adapter 2 (95% over 22bp) ACACCGATGACGACTGTGAAGTCGTATGCCGTCTTCTGCTTGAAAANNNN 30 0.75 Illumina Single End Adapter 2 (95% over 22bp) AGAAGATTAGAAGATTATGATCGTATGCCGTCTTCTGCTTGAAAAANNNN 25 0.625 Illumina Single End Adapter 2 (95% over 23bp) NCACCGATGACGACTGTGAATCGTATGCCGTCTTCTGCTTGAAAAANNNN 15 0.375 Illumina Single End Adapter 2 (95% over 22bp) TAACTTGATATGTAAGTGGGTCGTATGCCGTCTTCTGCTTGAAAAANNNN 12 0.3 Illumina PCR Primer Index 1 (95% over 22bp) NCACCGATGACGACTGTGAAGTCGTATGCCGTCTTCTGCTTGAAAANNNN 11 0.27499999999999997 Illumina Single End Adapter 2 (95% over 22bp) TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTCTGCTTGAAAANNNN 9 0.22499999999999998 Illumina Single End Adapter 2 (95% over 24bp) CTACGTGAGCCCGGAGAGAGTCGTATGCCGTCTTCTGCTTGAAAAANNNN 8 0.2 Illumina Single End Adapter 1 (95% over 22bp) CGACACGACTCTCGGCAACGGTCGTATGCCGTCTTCTGCTTGAAAANNNN 6 0.15 Illumina Single End Adapter 2 (95% over 23bp) AGATAACTTGATATGTAAGTTCGTATGCCGTCTTCTGCTTGAAAAANNNN 6 0.15 Illumina Single End Adapter 2 (95% over 24bp) CATCGAGTAGACCTTGTTATTCGTATGCCGTCTTCTGCTTGAAAAANNNN 5 0.125 Illumina Single End Adapter 1 (95% over 22bp) TTCAACCAATAGACACCGATTCGTATGCCGTCTTCTGCTTGAAAAANNNN 5 0.125 Illumina Single End Adapter 1 (95% over 22bp) TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCTGCTTGAAAAANNNN 5 0.125 Illumina Single End Adapter 2 (95% over 22bp) NGAAGATTAGAAGATTATGATCGTATGCCGTCTTCTGCTTGAAAAANNNN 5 0.125 Illumina Single End Adapter 2 (95% over 23bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAAAA 205 0.0 38.817074 40 ACTCGTA 25 0.0034151915 31.829998 19 CTTCGTA 25 0.0034151915 31.829998 20 AATCGTA 25 0.0034151915 31.829998 19 TTCGTAT 100 0.0 27.851248 21 GCTCGTA 50 3.6864058E-6 27.851248 19 CTCGTAT 110 0.0 27.127842 20 GATCGTA 45 6.2779494E-5 26.525 20 AGTCGTA 45 0.0021031117 22.104166 19 ATCGTAT 100 2.5174813E-9 21.883123 20 GTATGCC 400 0.0 19.89375 23 TGCCGTC 400 0.0 19.89375 26 GTCGTAT 90 6.293394E-7 19.89375 21 TATGCCG 400 0.0 19.89375 24 TTCTGCT 400 0.0 19.89375 33 CCGTCTT 400 0.0 19.89375 28 TCTGCTT 400 0.0 19.89375 34 TGCTTGA 400 0.0 19.89375 36 ATGCCGT 400 0.0 19.89375 25 GTCTTCT 400 0.0 19.89375 30 >>END_MODULE Read 3598801 spots for SRR6892958.sra Written 3598801 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra Read 3598796 spots for SRR6892958.sra Written 3598796 spots for SRR6892958.sra SRR ids: ['SRR6892958.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r2y5my8s SRR6892958.sra spots: 71975925 blocks: [[1, 3598796], [3598797, 7197592], [7197593, 10796388], [10796389, 14395184], [14395185, 17993980], [17993981, 21592776], [21592777, 25191572], [25191573, 28790368], [28790369, 32389164], [32389165, 35987960], [35987961, 39586756], [39586757, 43185552], [43185553, 46784348], [46784349, 50383144], [50383145, 53981940], [53981941, 57580736], [57580737, 61179532], [61179533, 64778328], [64778329, 68377124], [68377125, 71975925]] SRR6892958 file size 12499322 SRR6892958 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892958 SRR6892958_1.fastq Input file: SRR6892958_1.fastq trimmed: SRR6892958-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:45:41 2024 >> started Fri Dec 6 13:50:05 2024 >> done (263.326s) 71975925 reads processed; of these: 13536 ( 0.02%) short reads filtered out after trimming by size control 91 ( 0.00%) empty reads filtered out after trimming by size control 71962298 (99.98%) reads available; of these: 71962298 (100.00%) trimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7352 0.01% 19 10598 0.01% 20 24327 0.03% 21 42765 0.06% 22 35180 0.05% 23 33029 0.05% 24 12787 0.02% 25 3727 0.01% 26 4981 0.01% 27 2670 0.00% 28 4944 0.01% 29 43848 0.06% 30 17584 0.02% 31 8425 0.01% 32 1019 0.00% 33 1509 0.00% 34 24702 0.03% 35 14002 0.02% 36 6661 0.01% 37 4136 0.01% 38 3473 0.00% 39 11205 0.02% 40 8133 0.01% 41 64318 0.09% 42 195786 0.27% 43 631363 0.88% 44 61257 0.09% 45 11594290 16.11% 46 22980034 31.93% 47 23424875 32.55% 48 32242 0.04% 49 12651076 17.58% 71962298 reads passed initial QC criterion=sequence-density sequence-density=98.47 sequence-density-rank=1 fanout-score=45.73 fanout-score-rank=1 prefix-density=99.01 prefix-fanout=45.5 sequence=TCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=98.47 sequence-density-rank=1 fanout-score=45.73 fanout-score-rank=1 prefix-density=99.01 prefix-fanout=45.5 sequence=TCGTATGCCGTCTTCTGCTTGAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGAAAAA -o SRR6892958 - Input file: STDIN trimmed: SRR6892958-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGAAAAA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 14:00:46 2024 >> started Fri Dec 6 14:08:10 2024 >> done (443.619s) 70508514 reads processed; of these: 51942 ( 0.07%) short reads filtered out after trimming by size control 308 ( 0.00%) empty reads filtered out after trimming by size control 70456264 (99.93%) reads available; of these: 70291608 (99.77%) trimmed reads available after processing 164656 ( 0.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 62580 0.09% 19 259506 0.37% 20 33625123 47.72% 21 36243258 51.44% 22 135479 0.19% 23 75440 0.11% 24 26949 0.04% 25 6765 0.01% 26 2085 0.00% 27 943 0.00% 28 618 0.00% 29 2817 0.00% 30 670 0.00% 31 550 0.00% 32 257 0.00% 33 261 0.00% 34 1520 0.00% 35 419 0.00% 36 320 0.00% 37 165 0.00% 38 197 0.00% 39 173 0.00% 40 570 0.00% 41 934 0.00% 42 1016 0.00% 43 421 0.00% 44 88 0.00% 45 905 0.00% 46 2249 0.00% 47 1935 0.00% 48 18 0.00% 49 2033 0.00% criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=1.00 fanout-score-rank=4 prefix-density=0.88 prefix-fanout=1.0 sequence=AGAAGATTAGAAGATTATGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=18 fanout-score=159.93 fanout-score-rank=1 prefix-density=2.86 prefix-fanout=1.0 sequence=GATGACGACTGGGAAG Started job on | Dec 06 14:12:30 Started mapping on | Dec 06 14:12:31 Finished on | Dec 06 14:34:21 Mapping speed, Million of reads per hour | 197.62 Number of input reads | 71910048 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 63700654 Uniquely mapped reads % | 88.58% Average mapped length | 20.46 Number of splices: Total | 2017138 Number of splices: Annotated (sjdb) | 1942485 Number of splices: GT/AG | 1996145 Number of splices: GC/AG | 19565 Number of splices: AT/AC | 1410 Number of splices: Non-canonical | 18 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5545190 % of reads mapped to multiple loci | 7.71% Number of reads mapped to too many loci | 1082193 % of reads mapped to too many loci | 1.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2664204 2664204 2664204 N_multimapping 5545190 5545190 5545190 N_noFeature 4906926 5402879 61812546 N_ambiguous 1466130 84810 6825 UnstrandedReadsAssigned:57327598 PositiveStrandReadsAssigned:58212965 NegativeStrandReadsAssigned:1881283 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=20 echo kmer=19 SRR6892958 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892958-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 71,910,048 reads, 54,379,634 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52973 SRR6892958.ke.tsv 35125 SRR6892958.se.tsv 88098 total ==> SRR6892958.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 20.293 0.608791 PNS24249 1928 1829 121.862 1.88889 PNS24246 1044 945 20.293 0.608791 PNS24248 1044 945 20.293 0.608791 PNS24244 1471 1372 2651.26 54.7837 PNS24243 293 194 4 0.584536 KQK14069 1603 1504 71064.3 1339.54 KQK14071 474 375 657.146 49.6803 ==> SRR6892958.se.tsv <== BRADI_1g14170v3 71204 BRADI_1g53295v3 294 BRADI_1g59795v3 641 BRADI_1g07683v3 1 BRADI_1g00485v3 41 BRADI_1g20270v3 1209 BRADI_1g74790v3 2249 BRADI_1g09890v3 0 BRADI_1g77505v3 894 BRADI_1g48960v3 1 SRR6892958 completed mapping pipeline successfully