Starting /dee2/code/volunteer_pipeline.sh SRR6892960 current disk space = 1550854070272 free memory = 1602801280 SRR6892960 SRAfilesize a83a6b0ba5d51e74bd67ff336fa7ed36 SRR6892960.sra SRR6892960.sra file validated SRR6892960 is single end SRR6892960 is conventional basespace SRR6892960 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892960_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.736 34.0 31.0 34.0 31.0 34.0 2 32.9105 34.0 31.0 34.0 31.0 34.0 3 33.00175 34.0 31.0 34.0 31.0 34.0 4 36.43025 37.0 37.0 37.0 35.0 37.0 5 36.34825 37.0 37.0 37.0 35.0 37.0 6 36.321 37.0 37.0 37.0 35.0 37.0 7 36.29625 37.0 37.0 37.0 35.0 37.0 8 36.23925 37.0 36.0 37.0 35.0 37.0 9 38.132 39.0 39.0 39.0 37.0 39.0 10 38.112 39.0 39.0 39.0 35.0 39.0 11 37.74525 39.0 38.0 39.0 35.0 39.0 12 37.89275 39.0 38.0 39.0 35.0 39.0 13 38.07025 39.0 38.0 39.0 35.0 39.0 14 39.424 41.0 39.0 41.0 36.0 41.0 15 39.36375 41.0 39.0 41.0 36.0 41.0 16 39.47475 41.0 39.0 41.0 36.0 41.0 17 39.3995 41.0 39.0 41.0 36.0 41.0 18 39.41375 41.0 39.0 41.0 36.0 41.0 19 39.4045 41.0 39.0 41.0 36.0 41.0 20 39.122 40.0 39.0 41.0 36.0 41.0 21 38.44075 40.0 38.0 41.0 34.0 41.0 22 38.5435 40.0 38.0 41.0 34.0 41.0 23 39.82775 41.0 39.0 41.0 38.0 41.0 24 39.144 40.0 39.0 41.0 36.0 41.0 25 39.91025 41.0 40.0 41.0 38.0 41.0 26 39.6975 41.0 40.0 41.0 37.0 41.0 27 40.2515 41.0 40.0 41.0 39.0 41.0 28 39.7095 41.0 40.0 41.0 37.0 41.0 29 39.39275 41.0 40.0 41.0 36.0 41.0 30 39.549 41.0 40.0 41.0 37.0 41.0 31 39.553 41.0 40.0 41.0 37.0 41.0 32 40.09925 41.0 40.0 41.0 39.0 41.0 33 40.39075 41.0 40.0 41.0 40.0 41.0 34 37.24225 39.0 36.0 41.0 30.0 41.0 35 36.26275 38.0 35.0 39.0 30.0 39.0 36 37.98675 39.0 38.0 40.0 34.0 41.0 37 39.1665 40.0 39.0 41.0 37.0 41.0 38 38.794 40.0 38.0 41.0 35.0 41.0 39 39.513 41.0 39.0 41.0 37.0 41.0 40 39.24875 41.0 39.0 41.0 36.0 41.0 41 39.861 41.0 40.0 41.0 37.0 41.0 42 38.3105 40.0 38.0 41.0 34.0 41.0 43 39.0035 40.0 38.0 41.0 36.0 41.0 44 39.2845 40.0 39.0 41.0 36.0 41.0 45 39.19825 40.0 39.0 41.0 35.0 41.0 46 39.198 41.0 39.0 41.0 35.0 41.0 47 39.69525 41.0 40.0 41.0 37.0 41.0 48 37.32225 40.0 36.0 41.0 32.0 41.0 49 36.98175 40.0 36.0 41.0 31.0 41.0 50 36.8845 39.0 36.0 40.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 2.0 22 2.0 23 5.0 24 4.0 25 2.0 26 3.0 27 2.0 28 9.0 29 17.0 30 26.0 31 29.0 32 44.0 33 69.0 34 97.0 35 160.0 36 229.0 37 391.0 38 636.0 39 2269.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.925 19.825 37.35 25.900000000000002 2 17.404351087771943 30.43260815203801 22.655663915978995 29.507376844211052 3 25.074999999999996 20.025000000000002 21.4 33.5 4 20.674999999999997 25.2 18.925 35.199999999999996 5 21.575 23.775 32.1 22.55 6 32.800000000000004 22.725 21.85 22.625 7 37.525 18.95 22.775000000000002 20.75 8 22.725 20.474999999999998 35.699999999999996 21.099999999999998 9 23.825 23.375 33.625 19.175 10 43.0 18.525 20.349999999999998 18.125 11 25.424999999999997 35.65 19.7 19.225 12 23.125 21.975 34.55 20.349999999999998 13 22.575 22.075 19.325 36.025 14 24.675 20.849999999999998 21.099999999999998 33.375 15 27.775 19.525000000000002 33.5 19.2 16 38.45 19.425 20.375 21.75 17 21.5 18.3 23.875 36.325 18 27.700000000000003 18.4 21.349999999999998 32.550000000000004 19 29.4 37.675 16.150000000000002 16.775000000000002 20 36.5 23.05 17.8 22.650000000000002 21 9.175 11.125 67.4 12.3 22 53.225 0.5 46.2 0.075 23 99.0 0.625 0.325 0.05 24 46.375 53.075 0.475 0.075 25 0.3 98.95 0.625 0.125 26 0.125 46.375 53.225 0.27499999999999997 27 0.0 0.3 99.225 0.475 28 0.1 0.15 46.775 52.97500000000001 29 0.42500000000000004 0.0 53.075 46.5 30 0.8999999999999999 0.025 46.150000000000006 52.925 31 53.425 0.025 0.44999999999999996 46.1 32 99.25 0.025 0.4 0.325 33 99.125 0.05 0.575 0.25 34 47.449999999999996 0.025 52.125 0.4 35 53.474999999999994 0.15 45.4 0.975 36 45.975 0.42500000000000004 0.4 53.2 37 0.5 1.0 0.125 98.375 38 0.5499999999999999 53.125 0.0 46.325 39 1.175 98.32499999999999 0.025 0.475 40 53.27499999999999 46.575 0.0 0.15 41 98.1 1.7000000000000002 0.075 0.125 42 46.150000000000006 53.325 0.17500000000000002 0.35000000000000003 43 0.525 98.02499999999999 0.3 1.15 44 0.125 46.1 1.0250000000000001 52.75 45 0.05 0.7000000000000001 52.125 47.125 46 0.17500000000000002 0.44999999999999996 45.574999999999996 53.800000000000004 47 0.325 1.075 0.675 97.925 48 1.1264080100125156 51.56445556946183 0.45056320400500627 46.85857321652065 49 52.175000000000004 45.6 1.15 1.075 50 45.5 0.95 52.15 1.4000000000000001 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 1.0 36 2.0 37 4.0 38 6.0 39 14.5 40 23.0 41 35.5 42 48.0 43 95.0 44 142.0 45 197.0 46 252.0 47 307.5 48 363.0 49 435.0 50 507.0 51 479.0 52 451.0 53 687.0 54 923.0 55 663.5 56 404.0 57 346.0 58 288.0 59 239.0 60 190.0 61 168.5 62 147.0 63 161.0 64 175.0 65 115.0 66 55.0 67 37.5 68 20.0 69 11.5 70 3.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.125 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.85 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49718221665623 78.64999999999999 2 0.8140262993112084 1.3 3 0.21916092673763304 0.525 4 0.12523481527864747 0.4 5 0.031308703819661866 0.125 6 0.0 0.0 7 0.0 0.0 8 0.06261740763932373 0.4 9 0.0 0.0 >10 0.09392611145898559 1.0250000000000001 >50 0.09392611145898559 5.025 >100 0.06261740763932373 12.55 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 279 6.9750000000000005 RNA PCR Primer, Index 1 (100% over 30bp) TACCTGGTTGATCCTGCCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG 223 5.575 RNA PCR Primer, Index 1 (100% over 29bp) TCAAAAGAGGAAAGGCTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 84 2.1 RNA PCR Primer, Index 1 (100% over 30bp) GCGACCCCAGGTCAGGCGGGATGGAATTCTCGGGTGCCAAGGAACTCCAG 66 1.6500000000000001 RNA PCR Primer, Index 1 (100% over 29bp) CATCGAGTAGACCTTGTTATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 51 1.275 RNA PCR Primer, Index 1 (100% over 30bp) GCGACCCCAGGTCAGGCGGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 19 0.475 RNA PCR Primer, Index 1 (100% over 30bp) CACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 11 0.27499999999999997 RNA PCR Primer, Index 1 (100% over 30bp) TCTCATGGAGAGTTCGATCCTTGGAATTCTCGGGTGCCAAGGAACTCCAG 11 0.27499999999999997 RNA PCR Primer, Index 1 (100% over 29bp) CATCGAGTAGACCTTGTTATTTGGAATTCTCGGGTGCCAAGGAACTCCAG 8 0.2 RNA PCR Primer, Index 1 (100% over 29bp) ACTGATGATGAACTAACTCGGTGGAATTCTCGGGTGCCAAGGAACTCCAG 8 0.2 RNA PCR Primer, Index 1 (100% over 29bp) CCGTCTGCACGTACGTACGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.1 0.0 0.0 0.0 19 0.0 0.35 0.0 0.0 0.0 20 0.0 0.7 0.0 0.0 0.0 21 0.0 52.9 0.0 0.0 0.0 22 0.0 98.65 0.0 0.0 0.0 23 0.0 98.825 0.0 0.0 0.0 24 0.0 98.925 0.0 0.0 0.0 25 0.0 98.925 0.0 0.0 0.0 26 0.0 98.925 0.0 0.0 0.0 27 0.0 98.925 0.0 0.0 0.0 28 0.0 98.95 0.0 0.0 0.0 29 0.0 98.95 0.0 0.0 0.0 30 0.0 98.95 0.0 0.0 0.0 31 0.0 98.95 0.0 0.0 0.0 32 0.0 98.95 0.0 0.0 0.0 33 0.0 98.95 0.0 0.0 0.0 34 0.0 98.95 0.0 0.0 0.0 35 0.0 98.95 0.0 0.0 0.0 36 0.0 98.95 0.0 0.0 0.0 37 0.0 98.95 0.0 0.0 0.0 38 0.0 98.95 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTGC 40 5.355105E-9 43.962498 11 GTTGATC 40 5.355105E-9 43.962498 7 TGGTTGA 40 5.355105E-9 43.962498 5 GGTTGAT 40 5.355105E-9 43.962498 6 CCTGCCA 40 5.355105E-9 43.962498 13 TGATCCT 40 5.355105E-9 43.962498 9 GCCAGTG 25 3.7145066E-5 43.962498 16 CTGGTTG 40 5.355105E-9 43.962498 4 ACCTGGT 40 5.355105E-9 43.962498 2 GATCCTG 40 5.355105E-9 43.962498 10 TGCCAGT 40 5.355105E-9 43.962498 15 TTGATCC 40 5.355105E-9 43.962498 8 CTGCCAG 40 5.355105E-9 43.962498 14 TACCTGG 40 5.355105E-9 43.962498 1 TCCTGCC 40 5.355105E-9 43.962498 12 CCTGGTT 40 5.355105E-9 43.962498 3 CTCCAGT 225 0.0 40.561745 44 ATTGGAA 40 2.94267E-7 38.467186 19 CCAGTGG 35 5.6711688E-6 37.68214 17 GGATGGA 25 0.0020930516 35.17 19 >>END_MODULE Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855812 spots for SRR6892960.sra Written 1855812 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra Read 1855802 spots for SRR6892960.sra Written 1855802 spots for SRR6892960.sra SRR ids: ['SRR6892960.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_upz9s69d SRR6892960.sra spots: 37116050 blocks: [[1, 1855802], [1855803, 3711604], [3711605, 5567406], [5567407, 7423208], [7423209, 9279010], [9279011, 11134812], [11134813, 12990614], [12990615, 14846416], [14846417, 16702218], [16702219, 18558020], [18558021, 20413822], [20413823, 22269624], [22269625, 24125426], [24125427, 25981228], [25981229, 27837030], [27837031, 29692832], [29692833, 31548634], [31548635, 33404436], [33404437, 35260238], [35260239, 37116050]] SRR6892960 file size 6422487 SRR6892960 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892960 SRR6892960_1.fastq Input file: SRR6892960_1.fastq trimmed: SRR6892960-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:44:00 2024 >> started Fri Dec 6 13:44:27 2024 >> done (26.952s) 37116050 reads processed; of these: 6595 ( 0.02%) short reads filtered out after trimming by size control 43 ( 0.00%) empty reads filtered out after trimming by size control 37109412 (99.98%) reads available; of these: 1151615 ( 3.10%) trimmed reads available after processing 35957797 (96.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4075 0.01% 19 5586 0.02% 20 7978 0.02% 21 2176 0.01% 22 928 0.00% 23 7701 0.02% 24 3649 0.01% 25 3972 0.01% 26 2470 0.01% 27 26273 0.07% 28 3538 0.01% 29 593 0.00% 30 713 0.00% 31 1164 0.00% 32 3231 0.01% 33 52026 0.14% 34 20622 0.06% 35 12611 0.03% 36 7647 0.02% 37 12610 0.03% 38 10619 0.03% 39 9379 0.03% 40 5980 0.02% 41 32320 0.09% 42 9261 0.02% 43 76515 0.21% 44 20758 0.06% 45 10579 0.03% 46 27904 0.08% 47 533653 1.44% 48 140072 0.38% 49 95012 0.26% 50 35957797 96.90% 37109412 reads passed initial QC criterion=sequence-density sequence-density=98.76 sequence-density-rank=1 fanout-score=33.21 fanout-score-rank=3 prefix-density=99.04 prefix-fanout=33.1 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACC criterion=fanout-score sequence-density=2.33 sequence-density-rank=2 fanout-score=47.81 fanout-score-rank=1 prefix-density=2.34 prefix-fanout=47.6 sequence=GAGTGGAATTCT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACC -o SRR6892960 - Input file: STDIN trimmed: SRR6892960-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:45:17 2024 >> started Fri Dec 6 13:45:49 2024 >> done (32.332s) 36359727 reads processed; of these: 56617 ( 0.16%) short reads filtered out after trimming by size control 218 ( 0.00%) empty reads filtered out after trimming by size control 36302892 (99.84%) reads available; of these: 36146135 (99.57%) trimmed reads available after processing 156757 ( 0.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 73381 0.20% 19 130958 0.36% 20 18583931 51.19% 21 17326323 47.73% 22 40280 0.11% 23 8899 0.02% 24 2477 0.01% 25 2328 0.01% 26 1075 0.00% 27 5924 0.02% 28 951 0.00% 29 335 0.00% 30 343 0.00% 31 295 0.00% 32 623 0.00% 33 1755 0.00% 34 2175 0.01% 35 5117 0.01% 36 3334 0.01% 37 1776 0.00% 38 1294 0.00% 39 1466 0.00% 40 614 0.00% 41 1894 0.01% 42 1339 0.00% 43 1454 0.00% 44 691 0.00% 45 754 0.00% 46 1273 0.00% 47 790 0.00% 48 587 0.00% 49 554 0.00% 50 97902 0.27% criterion=sequence-density sequence-density=12.49 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=15 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=38.60 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=17.6 sequence=TGGAATTCTCGTATGCCGTCTTCTGCTTGA Started job on | Dec 06 13:46:14 Started mapping on | Dec 06 13:46:14 Finished on | Dec 06 13:47:39 Mapping speed, Million of reads per hour | 1569.29 Number of input reads | 37052577 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 24842098 Uniquely mapped reads % | 67.05% Average mapped length | 20.40 Number of splices: Total | 922449 Number of splices: Annotated (sjdb) | 883542 Number of splices: GT/AG | 912569 Number of splices: GC/AG | 9325 Number of splices: AT/AC | 502 Number of splices: Non-canonical | 53 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4811184 % of reads mapped to multiple loci | 12.98% Number of reads mapped to too many loci | 6475162 % of reads mapped to too many loci | 17.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7399295 7399295 7399295 N_multimapping 4811184 4811184 4811184 N_noFeature 1527590 1796668 24133193 N_ambiguous 487529 48657 2318 UnstrandedReadsAssigned:22826979 PositiveStrandReadsAssigned:22996773 NegativeStrandReadsAssigned:706587 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892960 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892960-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,052,577 reads, 24,176,428 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52973 SRR6892960.ke.tsv 35125 SRR6892960.se.tsv 88098 total ==> SRR6892960.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 4.57946 0.286657 PNS24249 1928 1829 93.025 3.00861 PNS24246 1044 945 4.57946 0.286657 PNS24248 1044 945 4.57946 0.286657 PNS24244 1471 1372 461.237 19.8861 PNS24243 293 194 0 0 KQK14069 1603 1504 3097.67 121.834 KQK14071 474 375 102.031 16.0947 ==> SRR6892960.se.tsv <== BRADI_1g14170v3 3028 BRADI_1g53295v3 206 BRADI_1g59795v3 262 BRADI_1g07683v3 1 BRADI_1g00485v3 10 BRADI_1g20270v3 1249 BRADI_1g74790v3 233 BRADI_1g09890v3 7 BRADI_1g77505v3 405 BRADI_1g48960v3 2 SRR6892960 completed mapping pipeline successfully