Starting /dee2/code/volunteer_pipeline.sh SRR6892961 current disk space = 1550849859584 free memory = 1600066664 SRR6892961 SRAfilesize 8a36e590e130b5d88bb102d1bc003126 SRR6892961.sra SRR6892961.sra file validated SRR6892961 is single end SRR6892961 is conventional basespace SRR6892961 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892961_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.678 34.0 31.0 34.0 31.0 34.0 2 32.85 34.0 31.0 34.0 31.0 34.0 3 32.90425 34.0 31.0 34.0 31.0 34.0 4 36.3415 37.0 37.0 37.0 35.0 37.0 5 36.30825 37.0 37.0 37.0 35.0 37.0 6 36.23025 37.0 37.0 37.0 35.0 37.0 7 36.18325 37.0 36.0 37.0 35.0 37.0 8 36.245 37.0 37.0 37.0 35.0 37.0 9 38.0775 39.0 39.0 39.0 35.0 39.0 10 38.045 39.0 38.0 39.0 35.0 39.0 11 37.78425 39.0 38.0 39.0 35.0 39.0 12 37.81175 39.0 37.0 39.0 35.0 39.0 13 37.885 39.0 38.0 39.0 35.0 39.0 14 39.1955 40.0 39.0 41.0 36.0 41.0 15 39.08125 40.0 38.0 41.0 36.0 41.0 16 39.20175 40.0 39.0 41.0 36.0 41.0 17 39.1385 40.0 39.0 41.0 36.0 41.0 18 39.22425 41.0 39.0 41.0 36.0 41.0 19 39.18775 40.0 39.0 41.0 36.0 41.0 20 38.9735 40.0 38.0 41.0 35.0 41.0 21 38.1765 40.0 38.0 41.0 33.0 41.0 22 38.1455 40.0 38.0 41.0 33.0 41.0 23 39.51425 41.0 39.0 41.0 37.0 41.0 24 38.6425 40.0 38.0 41.0 34.0 41.0 25 39.515 40.0 39.0 41.0 37.0 41.0 26 39.23675 41.0 39.0 41.0 36.0 41.0 27 39.8945 41.0 40.0 41.0 38.0 41.0 28 39.42125 41.0 40.0 41.0 36.0 41.0 29 39.0765 41.0 39.0 41.0 35.0 41.0 30 39.218 41.0 39.0 41.0 35.0 41.0 31 39.18225 41.0 39.0 41.0 35.0 41.0 32 39.76475 41.0 40.0 41.0 38.0 41.0 33 40.11375 41.0 40.0 41.0 39.0 41.0 34 36.45725 38.0 35.0 41.0 30.0 41.0 35 35.5155 38.0 35.0 39.0 30.0 39.0 36 37.30125 39.0 37.0 40.0 32.0 40.0 37 38.66625 40.0 38.0 41.0 35.0 41.0 38 38.439 40.0 38.0 41.0 34.0 41.0 39 39.225 40.0 39.0 41.0 35.0 41.0 40 38.899 41.0 38.0 41.0 35.0 41.0 41 39.442 41.0 40.0 41.0 35.0 41.0 42 38.0355 40.0 37.0 41.0 33.0 41.0 43 38.72525 40.0 38.0 41.0 35.0 41.0 44 38.8655 40.0 38.0 41.0 35.0 41.0 45 38.90825 41.0 39.0 41.0 35.0 41.0 46 38.89375 41.0 38.0 41.0 35.0 41.0 47 39.23175 41.0 39.0 41.0 35.0 41.0 48 38.07625 40.0 37.0 41.0 34.0 41.0 49 37.71275 40.0 37.0 41.0 34.0 41.0 50 37.00325 39.0 36.0 40.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 1.0 18 0.0 19 3.0 20 0.0 21 2.0 22 2.0 23 4.0 24 6.0 25 5.0 26 6.0 27 5.0 28 9.0 29 31.0 30 33.0 31 32.0 32 61.0 33 84.0 34 104.0 35 151.0 36 257.0 37 438.0 38 653.0 39 2108.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.375 22.325 22.975 31.324999999999996 2 25.05 19.425 21.3 34.225 3 29.45 19.5 19.950000000000003 31.1 4 28.499999999999996 21.825 19.725 29.95 5 27.750000000000004 21.65 21.825 28.775000000000002 6 29.225 18.099999999999998 22.375 30.3 7 30.349999999999998 18.45 22.475 28.725 8 27.575 19.400000000000002 23.849999999999998 29.175 9 30.125 20.875 23.7 25.3 10 31.900000000000002 19.425 20.625 28.050000000000004 11 31.424999999999997 22.1 19.975 26.5 12 30.0 20.65 23.799999999999997 25.55 13 27.525 21.875 19.375 31.225 14 26.950000000000003 24.6 21.45 27.0 15 28.675 22.85 23.5 24.975 16 30.7 21.05 23.025000000000002 25.224999999999998 17 28.175 21.525 22.900000000000002 27.400000000000002 18 35.35 18.025 18.825 27.800000000000004 19 32.7 26.35 17.7 23.25 20 29.299999999999997 23.925 20.724999999999998 26.05 21 10.45 11.025 63.775000000000006 14.75 22 53.574999999999996 1.575 44.775 0.075 23 97.2 1.625 1.0999999999999999 0.075 24 44.85 53.2 1.6 0.35000000000000003 25 0.22499999999999998 97.15 1.95 0.675 26 0.22499999999999998 44.5 54.074999999999996 1.2 27 0.35000000000000003 0.125 98.125 1.4000000000000001 28 0.95 0.05 45.4 53.6 29 1.925 0.075 52.775000000000006 45.225 30 2.4 0.15 44.7 52.75 31 54.6 0.1 0.75 44.55 32 98.4 0.2 0.975 0.42500000000000004 33 97.925 0.15 0.975 0.95 34 46.425 0.4 51.625 1.55 35 53.37499999999999 0.975 43.525000000000006 2.125 36 44.574999999999996 1.7000000000000002 0.25 53.474999999999994 37 1.075 2.25 0.075 96.6 38 1.625 53.675 0.075 44.625 39 2.325 97.3 0.1 0.27499999999999997 40 53.7 45.800000000000004 0.05 0.44999999999999996 41 96.275 2.6 0.325 0.8 42 44.324999999999996 53.675 0.675 1.325 43 0.27499999999999997 96.35000000000001 1.05 2.325 44 0.05 44.4 1.55 54.0 45 0.3 0.975 52.275000000000006 46.45 46 0.675 1.15 44.2 53.974999999999994 47 1.0250000000000001 1.6500000000000001 0.9249999999999999 96.39999999999999 48 1.6541353383458646 52.10526315789473 1.2030075187969926 45.037593984962406 49 52.0 44.5 1.7500000000000002 1.7500000000000002 50 43.9 1.7000000000000002 51.925 2.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.5 34 1.0 35 0.5 36 0.0 37 1.0 38 2.0 39 3.0 40 4.0 41 17.0 42 30.0 43 52.0 44 74.0 45 100.5 46 127.0 47 187.5 48 248.0 49 309.0 50 370.0 51 425.5 52 481.0 53 544.0 54 607.0 55 571.5 56 536.0 57 497.5 58 459.0 59 427.0 60 395.0 61 327.0 62 259.0 63 255.5 64 252.0 65 172.5 66 93.0 67 65.0 68 37.0 69 28.0 70 19.0 71 11.0 72 3.0 73 2.0 74 1.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.25 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49562363238512 90.025 2 0.7658643326039387 1.4000000000000001 3 0.2188183807439825 0.6 4 0.05470459518599562 0.2 5 0.02735229759299781 0.125 6 0.10940919037199125 0.6 7 0.02735229759299781 0.17500000000000002 8 0.05470459518599562 0.4 9 0.0 0.0 >10 0.16411378555798686 2.175 >50 0.08205689277899343 4.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source CACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 61 1.525 RNA PCR Primer, Index 1 (100% over 30bp) TACCTGGTTGATCCTGCCAGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 59 1.4749999999999999 RNA PCR Primer, Index 1 (100% over 30bp) GCGACCCCAGGTCAGGCGGGATGGAATTCTCGGGTGCCAAGGAACTCCAG 52 1.3 RNA PCR Primer, Index 1 (100% over 29bp) TACCTGGTTGATCCTGCCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG 26 0.65 RNA PCR Primer, Index 1 (100% over 29bp) ACGTGTCAGTTGGACCAGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT 15 0.375 RNA PCR Primer, Index 1 (100% over 30bp) ACACCGATGACGACTGTGAATGGAATTCTCGGGTGCCAAGGAACTCCAGT 14 0.35000000000000003 RNA PCR Primer, Index 1 (100% over 30bp) GACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 12 0.3 RNA PCR Primer, Index 1 (100% over 30bp) CATCGAGTAGACCTTGTTATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 10 0.25 RNA PCR Primer, Index 1 (100% over 30bp) CGACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAG 10 0.25 RNA PCR Primer, Index 1 (100% over 29bp) TCAAAAGAGGAAAGGCTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 8 0.2 RNA PCR Primer, Index 1 (100% over 30bp) GACACGACTCTCGGCAACGGATGGAATTCTCGGGTGCCAAGGAACTCCAG 8 0.2 RNA PCR Primer, Index 1 (100% over 29bp) GCGACCCCAGGTCAGGCGGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 7 0.17500000000000002 RNA PCR Primer, Index 1 (100% over 30bp) TAGGCCGTGTTTTCACGGGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 6 0.15 RNA PCR Primer, Index 1 (100% over 30bp) ATGCGTGCGAGTCGACGGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG 6 0.15 RNA PCR Primer, Index 1 (100% over 29bp) ACGACTCTCGGCAACGGATATTGGAATTCTCGGGTGCCAAGGAACTCCAG 6 0.15 RNA PCR Primer, Index 1 (100% over 29bp) ACACCGATGACGACTGTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCAG 6 0.15 RNA PCR Primer, Index 1 (100% over 29bp) ACGTGTCAGTTGGACCAGGAGTGGAATTCTCGGGTGCCAAGGAACTCCAG 5 0.125 RNA PCR Primer, Index 1 (100% over 29bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.025 0.0 0.0 0.0 15 0.0 0.075 0.0 0.0 0.0 16 0.0 0.075 0.0 0.0 0.0 17 0.0 0.25 0.0 0.0 0.0 18 0.0 0.8 0.0 0.0 0.0 19 0.0 1.65 0.0 0.0 0.0 20 0.0 2.325 0.0 0.0 0.0 21 0.0 54.1 0.0 0.0 0.0 22 0.0 98.075 0.0 0.0 0.0 23 0.0 98.15 0.0 0.0 0.0 24 0.0 98.175 0.0 0.0 0.0 25 0.0 98.175 0.0 0.0 0.0 26 0.0 98.175 0.0 0.0 0.0 27 0.0 98.175 0.0 0.0 0.0 28 0.0 98.175 0.0 0.0 0.0 29 0.0 98.175 0.0 0.0 0.0 30 0.0 98.175 0.0 0.0 0.0 31 0.0 98.175 0.0 0.0 0.0 32 0.0 98.175 0.0 0.0 0.0 33 0.0 98.175 0.0 0.0 0.0 34 0.0 98.175 0.0 0.0 0.0 35 0.0 98.175 0.0 0.0 0.0 36 0.0 98.175 0.0 0.0 0.0 37 0.0 98.175 0.0 0.0 0.0 38 0.0 98.175 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAGT 200 0.0 40.699997 44 TCTGGAA 35 5.6380304E-6 37.714287 19 ATTGGAA 50 1.6800313E-6 30.8 19 GATGGAA 30 0.005095276 29.333332 19 GGCTGGA 30 0.005095276 29.333332 18 GCTGGAA 55 1.240733E-4 24.0 20 TTGGAAT 85 1.3691351E-7 23.294119 20 ATGGAAT 95 1.38206815E-8 23.157894 21 GAATTCT 395 0.0 22.835443 23 CTGGAAT 135 1.8189894E-12 22.814814 20 AATTCTC 390 0.0 22.564102 24 TCTCGGG 390 0.0 22.564102 27 TTCTCGG 390 0.0 22.564102 26 ATTCTCG 390 0.0 22.564102 25 GGAATTC 400 0.0 22.55 22 TGGAATT 405 0.0 22.271605 21 GTGGAAT 90 2.3813118E-7 22.000002 20 GCCAAGG 390 0.0 22.0 35 CCAAGGA 390 0.0 22.0 36 AGGAACT 395 0.0 21.72152 39 >>END_MODULE Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450635 spots for SRR6892961.sra Written 2450635 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra Read 2450616 spots for SRR6892961.sra Written 2450616 spots for SRR6892961.sra SRR ids: ['SRR6892961.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z9g9pjnx SRR6892961.sra spots: 49012339 blocks: [[1, 2450616], [2450617, 4901232], [4901233, 7351848], [7351849, 9802464], [9802465, 12253080], [12253081, 14703696], [14703697, 17154312], [17154313, 19604928], [19604929, 22055544], [22055545, 24506160], [24506161, 26956776], [26956777, 29407392], [29407393, 31858008], [31858009, 34308624], [34308625, 36759240], [36759241, 39209856], [39209857, 41660472], [41660473, 44111088], [44111089, 46561704], [46561705, 49012339]] SRR6892961 file size 8484436 SRR6892961 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892961 SRR6892961_1.fastq Input file: SRR6892961_1.fastq trimmed: SRR6892961-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:45:16 2024 >> started Fri Dec 6 13:45:45 2024 >> done (29.016s) 49012339 reads processed; of these: 12074 ( 0.02%) short reads filtered out after trimming by size control 41 ( 0.00%) empty reads filtered out after trimming by size control 49000224 (99.98%) reads available; of these: 1213698 ( 2.48%) trimmed reads available after processing 47786526 (97.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3501 0.01% 19 5451 0.01% 20 8815 0.02% 21 3348 0.01% 22 1288 0.00% 23 18248 0.04% 24 8051 0.02% 25 8262 0.02% 26 4160 0.01% 27 39164 0.08% 28 5732 0.01% 29 811 0.00% 30 1221 0.00% 31 2213 0.00% 32 4007 0.01% 33 85396 0.17% 34 33482 0.07% 35 18541 0.04% 36 10943 0.02% 37 13324 0.03% 38 10676 0.02% 39 13599 0.03% 40 9128 0.02% 41 52728 0.11% 42 13114 0.03% 43 92996 0.19% 44 28784 0.06% 45 16470 0.03% 46 44074 0.09% 47 406376 0.83% 48 124348 0.25% 49 125447 0.26% 50 47786526 97.52% 49000224 reads passed initial QC criterion=sequence-density sequence-density=98.48 sequence-density-rank=1 fanout-score=39.04 fanout-score-rank=1 prefix-density=98.76 prefix-fanout=38.9 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGC criterion=fanout-score sequence-density=98.48 sequence-density-rank=1 fanout-score=39.04 fanout-score-rank=1 prefix-density=98.76 prefix-fanout=38.9 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGC -o SRR6892961 - Input file: STDIN trimmed: SRR6892961-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:46:59 2024 >> started Fri Dec 6 13:47:55 2024 >> done (55.460s) 48010321 reads processed; of these: 572547 ( 1.19%) short reads filtered out after trimming by size control 7478 ( 0.02%) empty reads filtered out after trimming by size control 47430296 (98.79%) reads available; of these: 47144798 (99.40%) trimmed reads available after processing 285498 ( 0.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 468176 0.99% 19 286025 0.60% 20 25108363 52.94% 21 21246270 44.79% 22 41921 0.09% 23 8678 0.02% 24 3764 0.01% 25 4646 0.01% 26 1892 0.00% 27 10779 0.02% 28 1710 0.00% 29 728 0.00% 30 802 0.00% 31 745 0.00% 32 948 0.00% 33 2759 0.01% 34 3364 0.01% 35 8089 0.02% 36 4785 0.01% 37 2340 0.00% 38 1456 0.00% 39 2238 0.00% 40 1015 0.00% 41 3620 0.01% 42 2576 0.01% 43 1674 0.00% 44 1114 0.00% 45 1290 0.00% 46 2532 0.01% 47 1755 0.00% 48 926 0.00% 49 858 0.00% 50 202458 0.43% criterion=sequence-density sequence-density=1.90 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=19 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=8 fanout-score=103.12 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=26.4 sequence=TGGAATTCTCGTATGCCGTCTTCTGCTTGA Started job on | Dec 06 13:48:18 Started mapping on | Dec 06 13:48:18 Finished on | Dec 06 13:49:55 Mapping speed, Million of reads per hour | 1797.04 Number of input reads | 48420199 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 38408774 Uniquely mapped reads % | 79.32% Average mapped length | 20.36 Number of splices: Total | 1268253 Number of splices: Annotated (sjdb) | 1204070 Number of splices: GT/AG | 1255976 Number of splices: GC/AG | 11400 Number of splices: AT/AC | 810 Number of splices: Non-canonical | 67 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4722640 % of reads mapped to multiple loci | 9.75% Number of reads mapped to too many loci | 3995117 % of reads mapped to too many loci | 8.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5288785 5288785 5288785 N_multimapping 4722640 4722640 4722640 N_noFeature 1794027 2220674 37313655 N_ambiguous 736621 70670 4320 UnstrandedReadsAssigned:35878126 PositiveStrandReadsAssigned:36117430 NegativeStrandReadsAssigned:1090799 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892961 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892961-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,420,199 reads, 37,125,499 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52973 SRR6892961.ke.tsv 35125 SRR6892961.se.tsv 88098 total ==> SRR6892961.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 23.3141 0.977836 PNS24249 1928 1829 427.373 9.26134 PNS24246 1044 945 23.3141 0.977836 PNS24248 1044 945 23.3141 0.977836 PNS24244 1471 1372 737.684 21.3106 PNS24243 293 194 0 0 KQK14069 1603 1504 63432.7 1671.65 KQK14071 474 375 6077.86 642.391 ==> SRR6892961.se.tsv <== BRADI_1g14170v3 64107 BRADI_1g53295v3 52 BRADI_1g59795v3 280 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 1349 BRADI_1g74790v3 312 BRADI_1g09890v3 11 BRADI_1g77505v3 584 BRADI_1g48960v3 1 SRR6892961 completed mapping pipeline successfully