Starting /dee2/code/volunteer_pipeline.sh SRR6892962 current disk space = 1550839635968 free memory = 1422360300 SRR6892962 SRAfilesize 76e49462243ac522b22c705fef8cfc28 SRR6892962.sra SRR6892962.sra file validated SRR6892962 is single end SRR6892962 is conventional basespace SRR6892962 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892962_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.189 34.0 31.0 34.0 31.0 34.0 2 32.6455 34.0 31.0 34.0 31.0 34.0 3 32.89075 34.0 31.0 34.0 31.0 34.0 4 36.387 37.0 37.0 37.0 35.0 37.0 5 36.36925 37.0 37.0 37.0 35.0 37.0 6 36.30375 37.0 37.0 37.0 35.0 37.0 7 36.33325 37.0 37.0 37.0 35.0 37.0 8 36.2245 37.0 37.0 37.0 35.0 37.0 9 38.136 39.0 39.0 39.0 37.0 39.0 10 38.09625 39.0 39.0 39.0 35.0 39.0 11 38.0945 39.0 39.0 39.0 37.0 39.0 12 38.0835 39.0 39.0 39.0 35.0 39.0 13 38.055 39.0 39.0 39.0 35.0 39.0 14 39.5785 41.0 40.0 41.0 37.0 41.0 15 39.4995 41.0 39.0 41.0 36.0 41.0 16 39.5425 41.0 39.0 41.0 37.0 41.0 17 39.5185 41.0 39.0 41.0 36.0 41.0 18 39.536 41.0 39.0 41.0 37.0 41.0 19 39.51375 41.0 39.0 41.0 37.0 41.0 20 39.53025 41.0 40.0 41.0 37.0 41.0 21 39.33225 41.0 39.0 41.0 36.0 41.0 22 39.01725 40.0 39.0 41.0 36.0 41.0 23 39.9445 41.0 40.0 41.0 38.0 41.0 24 39.61825 41.0 40.0 41.0 37.0 41.0 25 40.14525 41.0 40.0 41.0 38.0 41.0 26 39.8815 41.0 40.0 41.0 38.0 41.0 27 40.2315 41.0 40.0 41.0 39.0 41.0 28 39.62275 41.0 40.0 41.0 36.0 41.0 29 38.88975 41.0 38.0 41.0 35.0 41.0 30 38.80775 41.0 38.0 41.0 35.0 41.0 31 38.76475 40.0 38.0 41.0 35.0 41.0 32 39.60175 41.0 40.0 41.0 38.0 41.0 33 40.12425 41.0 40.0 41.0 39.0 41.0 34 35.79275 38.0 34.0 41.0 28.0 41.0 35 37.64375 39.0 37.0 40.0 32.0 41.0 36 38.38325 40.0 38.0 41.0 35.0 41.0 37 39.3045 40.0 39.0 41.0 37.0 41.0 38 39.27025 41.0 39.0 41.0 36.0 41.0 39 39.64225 41.0 40.0 41.0 37.0 41.0 40 39.44925 41.0 40.0 41.0 36.0 41.0 41 39.584 41.0 40.0 41.0 37.0 41.0 42 38.8795 41.0 38.0 41.0 35.0 41.0 43 39.4005 40.0 39.0 41.0 37.0 41.0 44 39.5305 41.0 40.0 41.0 37.0 41.0 45 39.4945 41.0 40.0 41.0 37.0 41.0 46 39.55025 41.0 40.0 41.0 36.0 41.0 47 39.83325 41.0 40.0 41.0 37.0 41.0 48 39.18875 41.0 39.0 41.0 36.0 41.0 49 38.5 40.0 38.0 41.0 35.0 41.0 50 38.234 40.0 38.0 41.0 34.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 3.0 21 1.0 22 1.0 23 2.0 24 0.0 25 10.0 26 6.0 27 11.0 28 7.0 29 15.0 30 14.0 31 25.0 32 33.0 33 65.0 34 96.0 35 145.0 36 193.0 37 338.0 38 593.0 39 2439.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.214194861358433 24.930043245993385 26.48181124395828 30.373950648689902 2 19.625 21.85 26.35 32.175 3 25.724999999999998 22.7 25.324999999999996 26.25 4 23.599999999999998 25.074999999999996 21.75 29.575000000000003 5 24.925 26.1 26.35 22.625 6 26.775 25.474999999999998 24.875 22.875 7 28.599999999999998 22.85 27.525 21.025 8 23.400000000000002 22.95 30.8 22.85 9 26.0 26.375 27.200000000000003 20.424999999999997 10 30.225 23.875 23.849999999999998 22.05 11 24.75 28.449999999999996 22.55 24.25 12 26.375 22.650000000000002 25.525 25.45 13 24.4 24.125 23.724999999999998 27.750000000000004 14 22.825 23.549999999999997 27.975 25.650000000000002 15 24.55 24.6 31.0 19.85 16 32.475 23.724999999999998 23.200000000000003 20.599999999999998 17 24.625 24.9 26.424999999999997 24.05 18 27.35 23.075000000000003 24.95 24.625 19 26.1 31.85 19.625 22.425 20 27.675 27.675 21.725 22.925 21 10.75 11.200000000000001 64.325 13.725000000000001 22 51.824999999999996 2.4250000000000003 45.45 0.3 23 95.825 2.675 1.325 0.17500000000000002 24 45.300000000000004 51.65 2.175 0.8750000000000001 25 0.375 95.85000000000001 3.0 0.775 26 0.5006257822277848 45.28160200250313 52.34042553191489 1.877346683354193 27 0.625 0.22499999999999998 96.875 2.275 28 1.0999999999999999 0.7250000000000001 46.45 51.725 29 2.7 0.125 50.925 46.25 30 3.0765382691345673 0.0750375187593797 46.07303651825913 50.775387693846916 31 53.075 0.1 0.8750000000000001 45.95 32 97.55 0.625 1.3 0.525 33 96.825 0.325 1.225 1.625 34 47.5 0.4 49.525000000000006 2.5749999999999997 35 51.025 1.375 44.824999999999996 2.775 36 45.5 2.1999999999999997 0.675 51.625 37 1.3 2.7 0.22499999999999998 95.775 38 2.1 52.525 0.125 45.25 39 3.15 96.15 0.2 0.5 40 51.800000000000004 47.375 0.17500000000000002 0.65 41 95.0 2.75 0.75 1.5 42 45.0 52.25 0.75 2.0 43 0.575 95.19999999999999 1.625 2.6 44 0.42500000000000004 45.1 1.775 52.7 45 0.8250000000000001 1.0999999999999999 50.475 47.599999999999994 46 0.8500000000000001 1.575 45.25 52.325 47 1.175 2.325 0.975 95.525 48 1.875 50.55 1.775 45.800000000000004 49 50.75452716297787 45.54828973843058 1.7857142857142856 1.9114688128772637 50 44.725 1.675 50.425 3.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.5 30 1.0 31 0.5 32 0.0 33 0.0 34 0.0 35 0.5 36 1.0 37 6.5 38 12.0 39 24.0 40 36.0 41 71.0 42 106.0 43 140.5 44 175.0 45 237.0 46 299.0 47 418.0 48 537.0 49 536.0 50 535.0 51 524.5 52 514.0 53 564.0 54 614.0 55 501.5 56 389.0 57 334.5 58 280.0 59 235.5 60 191.0 61 168.0 62 145.0 63 120.5 64 96.0 65 68.5 66 41.0 67 31.0 68 21.0 69 12.5 70 4.0 71 3.5 72 3.0 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.125 27 0.0 28 0.0 29 0.0 30 0.05 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.6 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.40264389975214 89.325 2 0.8812999173781328 1.6 3 0.1101624896722666 0.3 4 0.1101624896722666 0.4 5 0.1101624896722666 0.5 6 0.0550812448361333 0.3 7 0.0 0.0 8 0.0550812448361333 0.4 9 0.0 0.0 >10 0.24786560176259984 5.050000000000001 >50 0.02754062241806665 2.125 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source CATCGAGTAGACCTTGTTATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 85 2.125 RNA PCR Primer, Index 1 (100% over 30bp) TACCTGGTTGATCCTGCCAGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 44 1.0999999999999999 RNA PCR Primer, Index 1 (100% over 30bp) TACCTGGTTGATCCTGCCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG 40 1.0 RNA PCR Primer, Index 1 (100% over 29bp) ACACCGATGACGACTGTGAATGGAATTCTCGGGTGCCAAGGAACTCCAGT 26 0.65 RNA PCR Primer, Index 1 (100% over 30bp) ACACCGATGACGACTGTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCAG 21 0.525 RNA PCR Primer, Index 1 (100% over 29bp) CATCGAGTAGACCTTGTTATTTGGAATTCTCGGGTGCCAAGGAACTCCAG 18 0.44999999999999996 RNA PCR Primer, Index 1 (100% over 29bp) TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC 14 0.35000000000000003 RNA PCR Primer, Index 9 (100% over 50bp) GCGACCCCAGGTCAGGCGGGATGGAATTCTCGGGTGCCAAGGAACTCCAG 14 0.35000000000000003 RNA PCR Primer, Index 1 (100% over 29bp) AGAAGATTAGAAGATTATGATGGAATTCTCGGGTGCCAAGGAACTCCAGT 13 0.325 RNA PCR Primer, Index 1 (100% over 30bp) TAAGTGGGAGCCTTTACGGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG 12 0.3 RNA PCR Primer, Index 1 (100% over 29bp) TTCAACCAATAGACACCGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 8 0.2 RNA PCR Primer, Index 1 (100% over 30bp) TAACTTGATATGTAAGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 8 0.2 RNA PCR Primer, Index 1 (100% over 30bp) CACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 6 0.15 RNA PCR Primer, Index 1 (100% over 30bp) AAGTGGGAGCCTTTACGGGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 6 0.15 RNA PCR Primer, Index 1 (100% over 30bp) NATCGAGTAGACCTTGTTATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) CCGTCTGCACGTACGTACGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) CGACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAG 5 0.125 RNA PCR Primer, Index 1 (100% over 29bp) TCTCATGGAGAGTTCGATCCTTGGAATTCTCGGGTGCCAAGGAACTCCAG 5 0.125 RNA PCR Primer, Index 1 (100% over 29bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.475 0.0 0.0 0.0 2 0.0 0.475 0.0 0.0 0.0 3 0.0 0.475 0.0 0.0 0.0 4 0.0 0.5 0.0 0.0 0.0 5 0.0 0.5 0.0 0.0 0.0 6 0.0 0.5 0.0 0.0 0.0 7 0.0 0.5 0.0 0.0 0.0 8 0.0 0.5 0.0 0.0 0.0 9 0.0 0.5 0.0 0.0 0.0 10 0.0 0.5 0.0 0.0 0.0 11 0.0 0.5 0.0 0.0 0.0 12 0.0 0.5 0.0 0.0 0.0 13 0.0 0.5 0.0 0.0 0.0 14 0.0 0.5 0.0 0.0 0.0 15 0.0 0.6 0.0 0.0 0.0 16 0.0 0.65 0.0 0.0 0.0 17 0.0 0.85 0.0 0.0 0.0 18 0.0 1.5 0.0 0.0 0.0 19 0.0 2.6 0.0 0.0 0.0 20 0.0 3.6 0.0 0.0 0.0 21 0.0 53.7 0.0 0.0 0.0 22 0.0 98.5 0.0 0.0 0.0 23 0.0 98.55 0.0 0.0 0.0 24 0.0 98.65 0.0 0.0 0.0 25 0.0 98.675 0.0 0.0 0.0 26 0.0 98.7 0.0 0.0 0.0 27 0.0 98.7 0.0 0.0 0.0 28 0.0 98.7 0.0 0.0 0.0 29 0.0 98.7 0.0 0.0 0.0 30 0.0 98.725 0.0 0.0 0.0 31 0.0 98.725 0.0 0.0 0.0 32 0.0 98.775 0.0 0.0 0.0 33 0.0 98.775 0.0 0.0 0.0 34 0.0 98.775 0.0 0.0 0.0 35 0.0 98.775 0.0 0.0 0.0 36 0.0 98.775 0.0 0.0 0.0 37 0.0 98.775 0.0 0.0 0.0 38 0.0 98.775 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAGT 245 0.0 40.362244 44 ATTGGAA 50 7.8034645E-10 39.555 19 GCTGGAA 45 1.5219484E-8 39.066666 20 TATTGGA 30 1.0911622E-4 36.625004 18 ATGGAAT 70 5.329639E-10 31.392859 20 TTGGAAT 135 0.0 30.927778 20 CCTGGAA 30 0.0051237047 29.300003 19 TGGAATT 400 0.0 25.27125 21 AATTCTC 395 0.0 25.034811 24 GAATTCT 395 0.0 25.034811 23 ATTCTCG 395 0.0 25.034811 25 GGAATTC 395 0.0 25.034811 22 AGGAACT 400 0.0 24.721874 39 ACTCCAG 400 0.0 24.721874 43 AACTCCA 400 0.0 24.721874 42 CGGGTGC 400 0.0 24.721874 30 TCTCGGG 400 0.0 24.721874 27 TTCTCGG 400 0.0 24.721874 26 GAACTCC 400 0.0 24.721874 41 TGCCAAG 400 0.0 24.721874 34 >>END_MODULE Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733504 spots for SRR6892962.sra Written 3733504 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra Read 3733497 spots for SRR6892962.sra Written 3733497 spots for SRR6892962.sra SRR ids: ['SRR6892962.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_389151a5 SRR6892962.sra spots: 74669947 blocks: [[1, 3733497], [3733498, 7466994], [7466995, 11200491], [11200492, 14933988], [14933989, 18667485], [18667486, 22400982], [22400983, 26134479], [26134480, 29867976], [29867977, 33601473], [33601474, 37334970], [37334971, 41068467], [41068468, 44801964], [44801965, 48535461], [48535462, 52268958], [52268959, 56002455], [56002456, 59735952], [59735953, 63469449], [63469450, 67202946], [67202947, 70936443], [70936444, 74669947]] SRR6892962 file size 12931244 SRR6892962 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892962 SRR6892962_1.fastq Input file: SRR6892962_1.fastq trimmed: SRR6892962-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:50:14 2024 >> started Fri Dec 6 13:51:11 2024 >> done (57.011s) 74669947 reads processed; of these: 12242 ( 0.02%) short reads filtered out after trimming by size control 180 ( 0.00%) empty reads filtered out after trimming by size control 74657525 (99.98%) reads available; of these: 2187768 ( 2.93%) trimmed reads available after processing 72469757 (97.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7254 0.01% 19 10362 0.01% 20 12982 0.02% 21 8324 0.01% 22 6308 0.01% 23 14965 0.02% 24 11271 0.02% 25 12801 0.02% 26 15629 0.02% 27 64455 0.09% 28 21016 0.03% 29 7303 0.01% 30 8031 0.01% 31 8977 0.01% 32 14696 0.02% 33 121441 0.16% 34 59434 0.08% 35 21329 0.03% 36 27852 0.04% 37 28795 0.04% 38 27195 0.04% 39 25501 0.03% 40 26607 0.04% 41 46951 0.06% 42 32383 0.04% 43 124156 0.17% 44 72543 0.10% 45 42583 0.06% 46 62920 0.08% 47 558529 0.75% 48 520056 0.70% 49 165119 0.22% 50 72469757 97.07% 74657525 reads passed initial QC criterion=sequence-density sequence-density=98.56 sequence-density-rank=1 fanout-score=47.90 fanout-score-rank=1 prefix-density=98.62 prefix-fanout=47.9 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC criterion=fanout-score sequence-density=98.56 sequence-density-rank=1 fanout-score=47.90 fanout-score-rank=1 prefix-density=98.62 prefix-fanout=47.9 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC -o SRR6892962 - Input file: STDIN trimmed: SRR6892962-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:53:54 2024 >> started Fri Dec 6 13:55:22 2024 >> done (88.680s) 73149292 reads processed; of these: 990966 ( 1.35%) short reads filtered out after trimming by size control 215245 ( 0.29%) empty reads filtered out after trimming by size control 71943081 (98.35%) reads available; of these: 71528664 (99.42%) trimmed reads available after processing 414417 ( 0.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 965209 1.34% 19 643572 0.89% 20 36590339 50.86% 21 33109790 46.02% 22 131918 0.18% 23 69852 0.10% 24 33079 0.05% 25 11499 0.02% 26 7978 0.01% 27 9931 0.01% 28 7035 0.01% 29 8502 0.01% 30 6459 0.01% 31 2737 0.00% 32 2755 0.00% 33 3595 0.00% 34 15821 0.02% 35 6901 0.01% 36 10104 0.01% 37 5531 0.01% 38 2388 0.00% 39 2337 0.00% 40 1461 0.00% 41 1404 0.00% 42 1321 0.00% 43 2341 0.00% 44 2230 0.00% 45 2416 0.00% 46 3183 0.00% 47 3033 0.00% 48 3167 0.00% 49 3950 0.01% 50 271243 0.38% criterion=sequence-density sequence-density=1.50 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=16 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=8 fanout-score=66.13 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=27.4 sequence=TGGAATTCTCGTATGCCGTCTTCTGCTTGAAAA Started job on | Dec 06 13:55:55 Started mapping on | Dec 06 13:55:55 Finished on | Dec 06 13:57:49 Mapping speed, Million of reads per hour | 2319.52 Number of input reads | 73451314 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 60520903 Uniquely mapped reads % | 82.40% Average mapped length | 20.38 Number of splices: Total | 2533971 Number of splices: Annotated (sjdb) | 2472897 Number of splices: GT/AG | 2510682 Number of splices: GC/AG | 21466 Number of splices: AT/AC | 1696 Number of splices: Non-canonical | 127 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 8091959 % of reads mapped to multiple loci | 11.02% Number of reads mapped to too many loci | 2866537 % of reads mapped to too many loci | 3.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4838452 4838452 4838452 N_multimapping 8091959 8091959 8091959 N_noFeature 3704642 4225957 59040276 N_ambiguous 1032047 75258 6902 UnstrandedReadsAssigned:55784214 PositiveStrandReadsAssigned:56219688 NegativeStrandReadsAssigned:1473725 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892962 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892962-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 73,451,314 reads, 57,312,551 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52973 SRR6892962.ke.tsv 35125 SRR6892962.se.tsv 88098 total ==> SRR6892962.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 11.9759 0.332095 PNS24249 1928 1829 256.683 3.67763 PNS24246 1044 945 11.9759 0.332095 PNS24248 1044 945 11.9759 0.332095 PNS24244 1471 1372 747.389 14.275 PNS24243 293 194 2 0.270155 KQK14069 1603 1504 18606.4 324.19 KQK14071 474 375 656.664 45.8878 ==> SRR6892962.se.tsv <== BRADI_1g14170v3 19024 BRADI_1g53295v3 78 BRADI_1g59795v3 305 BRADI_1g07683v3 2 BRADI_1g00485v3 122 BRADI_1g20270v3 1834 BRADI_1g74790v3 206 BRADI_1g09890v3 3 BRADI_1g77505v3 743 BRADI_1g48960v3 3 SRR6892962 completed mapping pipeline successfully