Starting /dee2/code/volunteer_pipeline.sh SRR6892963 current disk space = 1550782959616 free memory = 1602974648 SRR6892963 SRAfilesize 70fa52f6d5e91038abde0d4218780373 SRR6892963.sra SRR6892963.sra file validated SRR6892963 is single end SRR6892963 is conventional basespace SRR6892963 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892963_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71275 34.0 31.0 34.0 31.0 34.0 2 32.43725 34.0 31.0 34.0 31.0 34.0 3 32.854 34.0 31.0 34.0 31.0 34.0 4 36.322 37.0 37.0 37.0 35.0 37.0 5 36.30625 37.0 37.0 37.0 35.0 37.0 6 36.334 37.0 37.0 37.0 35.0 37.0 7 36.335 37.0 37.0 37.0 35.0 37.0 8 36.2445 37.0 37.0 37.0 35.0 37.0 9 38.08125 39.0 39.0 39.0 37.0 39.0 10 38.1355 39.0 39.0 39.0 35.0 39.0 11 38.09125 39.0 39.0 39.0 37.0 39.0 12 38.04325 39.0 39.0 39.0 35.0 39.0 13 38.039 39.0 38.0 39.0 35.0 39.0 14 39.46925 41.0 39.0 41.0 36.0 41.0 15 39.414 41.0 39.0 41.0 36.0 41.0 16 39.46975 41.0 39.0 41.0 36.0 41.0 17 39.46425 41.0 39.0 41.0 37.0 41.0 18 39.5325 41.0 39.0 41.0 37.0 41.0 19 39.502 41.0 39.0 41.0 37.0 41.0 20 39.55775 41.0 40.0 41.0 37.0 41.0 21 39.46925 41.0 39.0 41.0 37.0 41.0 22 38.60925 40.0 38.0 41.0 34.0 41.0 23 39.5755 41.0 40.0 41.0 37.0 41.0 24 39.326 41.0 39.0 41.0 36.0 41.0 25 39.642 41.0 40.0 41.0 37.0 41.0 26 39.6035 41.0 40.0 41.0 37.0 41.0 27 39.9995 41.0 40.0 41.0 38.0 41.0 28 39.2855 41.0 39.0 41.0 36.0 41.0 29 38.47875 40.0 38.0 41.0 34.0 41.0 30 38.1415 40.0 38.0 41.0 33.0 41.0 31 38.6335 40.0 38.0 41.0 34.0 41.0 32 39.2725 41.0 40.0 41.0 36.0 41.0 33 39.6725 41.0 40.0 41.0 37.0 41.0 34 35.8375 38.0 34.0 41.0 28.0 41.0 35 37.302 39.0 37.0 41.0 31.0 41.0 36 38.053 40.0 38.0 41.0 33.0 41.0 37 38.44525 40.0 39.0 41.0 35.0 41.0 38 38.74575 40.0 39.0 41.0 35.0 41.0 39 39.17925 41.0 39.0 41.0 36.0 41.0 40 39.17175 41.0 39.0 41.0 35.0 41.0 41 39.23925 41.0 40.0 41.0 35.0 41.0 42 38.9115 40.0 38.0 41.0 35.0 41.0 43 39.311 40.0 39.0 41.0 36.0 41.0 44 39.37475 41.0 39.0 41.0 36.0 41.0 45 39.35175 41.0 39.0 41.0 36.0 41.0 46 39.24875 41.0 39.0 41.0 36.0 41.0 47 39.40625 41.0 39.0 41.0 36.0 41.0 48 38.73075 40.0 38.0 41.0 35.0 41.0 49 38.36625 40.0 38.0 41.0 34.0 41.0 50 38.2305 40.0 37.0 41.0 34.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 3.0 20 3.0 21 2.0 22 1.0 23 1.0 24 2.0 25 3.0 26 5.0 27 6.0 28 9.0 29 13.0 30 28.0 31 44.0 32 38.0 33 72.0 34 112.0 35 153.0 36 225.0 37 400.0 38 686.0 39 2190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.10548086866598 20.372285418821097 30.532574974146847 29.98965873836608 2 23.9 25.074999999999996 22.35 28.675 3 29.099999999999998 19.275000000000002 25.3 26.325 4 25.474999999999998 23.0 20.549999999999997 30.975 5 27.450000000000003 25.924999999999997 24.075 22.55 6 27.750000000000004 22.45 24.099999999999998 25.7 7 31.25 19.950000000000003 27.224999999999998 21.575 8 25.7 19.05 28.775000000000002 26.474999999999998 9 25.85 24.0 29.125 21.025 10 34.425 18.9 21.5 25.174999999999997 11 30.225 28.199999999999996 18.7 22.875 12 29.299999999999997 20.724999999999998 25.15 24.825 13 26.974999999999998 20.925 21.975 30.125 14 25.6 20.775 29.075 24.55 15 30.425 20.8 29.725 19.05 16 33.85 22.425 21.475 22.25 17 23.0 25.924999999999997 24.349999999999998 26.724999999999998 18 25.174999999999997 25.3 25.025 24.5 19 24.65 34.1 18.9 22.35 20 30.65 26.775 19.55 23.025000000000002 21 15.5 14.099999999999998 54.7 15.7 22 44.5 8.05 46.275 1.175 23 87.875 8.200000000000001 3.075 0.8500000000000001 24 46.025 44.224999999999994 5.2 4.55 25 0.8250000000000001 87.775 8.799999999999999 2.6 26 1.0007505629221916 45.809357017763325 46.10958218663998 7.080310232674505 27 1.8499999999999999 0.625 89.85 7.675 28 3.55 3.95 47.575 44.925 29 9.0 0.8 42.875 47.325 30 7.076769192298074 0.8252063015753939 49.16229057264316 42.93573393348337 31 47.425 0.75 2.85 48.975 32 91.475 3.875 2.875 1.775 33 89.775 0.8250000000000001 2.725 6.675000000000001 34 47.949999999999996 1.4000000000000001 41.5 9.15 35 43.15 6.225 44.65 5.975 36 49.55 4.95 0.7250000000000001 44.775 37 3.4750000000000005 8.825 0.525 87.175 38 5.175 45.85 3.6249999999999996 45.35 39 5.8500000000000005 88.9 0.675 4.575 40 44.7 53.05 0.775 1.4749999999999999 41 86.125 5.8999999999999995 4.475 3.5000000000000004 42 44.875 44.824999999999996 2.35 7.95 43 0.8500000000000001 87.0 6.225 5.925 44 0.8750000000000001 45.675 3.4250000000000003 50.025 45 4.625 2.775 42.4 50.2 46 2.5749999999999997 3.2750000000000004 48.35 45.800000000000004 47 3.0 7.225 2.85 86.925 48 3.4000000000000004 42.825 6.45 47.325 49 45.196889892149485 46.576373212942066 3.4612490594431904 4.765487835465263 50 44.25 4.05 42.199999999999996 9.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 1.0 32 2.0 33 2.0 34 2.0 35 1.5 36 1.0 37 2.5 38 4.0 39 12.5 40 21.0 41 40.0 42 59.0 43 90.0 44 121.0 45 180.0 46 239.0 47 359.5 48 480.0 49 475.0 50 470.0 51 534.0 52 598.0 53 591.0 54 584.0 55 503.0 56 422.0 57 369.0 58 316.0 59 285.5 60 255.0 61 208.5 62 162.0 63 159.0 64 156.0 65 108.5 66 61.0 67 46.5 68 32.0 69 23.0 70 14.0 71 7.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.075 27 0.0 28 0.0 29 0.0 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.325 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4927536231884 84.95 2 0.6376811594202898 1.0999999999999999 3 0.2898550724637681 0.75 4 0.11594202898550725 0.4 5 0.057971014492753624 0.25 6 0.028985507246376812 0.15 7 0.028985507246376812 0.17500000000000002 8 0.028985507246376812 0.2 9 0.028985507246376812 0.22499999999999998 >10 0.17391304347826086 2.4 >50 0.057971014492753624 3.05 >100 0.057971014492753624 6.35 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source CATCGAGTAGACCTTGTTATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 133 3.325 RNA PCR Primer, Index 1 (100% over 30bp) TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGC 121 3.025 RNA PCR Primer, Index 7 (100% over 50bp) TACCTGGTTGATCCTGCCAGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 68 1.7000000000000002 RNA PCR Primer, Index 1 (100% over 30bp) TACCTGGTTGATCCTGCCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG 54 1.35 RNA PCR Primer, Index 1 (100% over 29bp) GCGACCCCAGGTCAGGCGGGATGGAATTCTCGGGTGCCAAGGAACTCCAG 24 0.6 RNA PCR Primer, Index 1 (100% over 29bp) CACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 20 0.5 RNA PCR Primer, Index 1 (100% over 30bp) TCTCATGGAGAGTTCGATCCTTGGAATTCTCGGGTGCCAAGGAACTCCAG 17 0.42500000000000004 RNA PCR Primer, Index 1 (100% over 29bp) ACACCGATGACGACTGTGAATGGAATTCTCGGGTGCCAAGGAACTCCAGT 14 0.35000000000000003 RNA PCR Primer, Index 1 (100% over 30bp) CATCGAGTAGACCTTGTTATTTGGAATTCTCGGGTGCCAAGGAACTCCAG 11 0.27499999999999997 RNA PCR Primer, Index 1 (100% over 29bp) GACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 10 0.25 RNA PCR Primer, Index 1 (100% over 30bp) CGACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAG 9 0.22499999999999998 RNA PCR Primer, Index 1 (100% over 29bp) TCAAAAGAGGAAAGGCTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 8 0.2 RNA PCR Primer, Index 1 (100% over 30bp) ACACCGATGACGACTGTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCAG 7 0.17500000000000002 RNA PCR Primer, Index 1 (100% over 29bp) GCGACCCCAGGTCAGGCGGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 6 0.15 RNA PCR Primer, Index 1 (100% over 30bp) TCCGCATCATCGGCTTCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) ACACGACTCTCGGCAACGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 3.45 0.0 0.0 0.0 2 0.0 3.45 0.0 0.0 0.0 3 0.0 3.475 0.0 0.0 0.0 4 0.0 3.8 0.0 0.0 0.0 5 0.0 3.925 0.0 0.0 0.0 6 0.0 3.925 0.0 0.0 0.0 7 0.0 4.025 0.0 0.0 0.0 8 0.0 4.1 0.0 0.0 0.0 9 0.0 4.15 0.0 0.0 0.0 10 0.0 4.175 0.0 0.0 0.0 11 0.0 4.25 0.0 0.0 0.0 12 0.0 4.3 0.0 0.0 0.0 13 0.0 4.35 0.0 0.0 0.0 14 0.0 4.375 0.0 0.0 0.0 15 0.0 4.45 0.0 0.0 0.0 16 0.0 4.8 0.0 0.0 0.0 17 0.0 5.475 0.0 0.0 0.0 18 0.0 7.125 0.0 0.0 0.0 19 0.0 9.325 0.0 0.0 0.0 20 0.0 11.075 0.0 0.0 0.0 21 0.0 52.725 0.0 0.0 0.0 22 0.0 97.05 0.0 0.0 0.0 23 0.0 97.25 0.0 0.0 0.0 24 0.0 97.35 0.0 0.0 0.0 25 0.0 97.45 0.0 0.0 0.0 26 0.0 97.675 0.0 0.0 0.0 27 0.0 97.75 0.0 0.0 0.0 28 0.0 97.8 0.0 0.0 0.0 29 0.0 97.8 0.0 0.0 0.0 30 0.0 97.8 0.0 0.0 0.0 31 0.0 97.9 0.0 0.0 0.0 32 0.0 97.9 0.0 0.0 0.0 33 0.0 97.9 0.0 0.0 0.0 34 0.0 97.975 0.0 0.0 0.0 35 0.0 98.0 0.0 0.0 0.0 36 0.0 98.0 0.0 0.0 0.0 37 0.0 98.0 0.0 0.0 0.0 38 0.0 98.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTATGC 20 6.5511954E-4 44.518986 44 TCGTATG 20 6.5511954E-4 44.518986 43 TACCTGG 20 6.5511954E-4 44.518986 1 ATCCTGC 20 6.981332E-4 43.962498 11 GTTGATC 20 6.981332E-4 43.962498 7 TGGTTGA 20 6.981332E-4 43.962498 5 GGTTGAT 20 6.981332E-4 43.962498 6 ATCTCGT 20 6.981332E-4 43.962498 40 CCTGCCA 20 6.981332E-4 43.962498 13 CATCTCG 20 6.981332E-4 43.962498 39 TGATCCT 20 6.981332E-4 43.962498 9 CTGGTTG 20 6.981332E-4 43.962498 4 ACCTGGT 20 6.981332E-4 43.962498 2 TCTCGTA 20 6.981332E-4 43.962498 41 GATCCTG 20 6.981332E-4 43.962498 10 TGCCAGT 20 6.981332E-4 43.962498 15 TTGATCC 20 6.981332E-4 43.962498 8 GATCATC 20 6.981332E-4 43.962498 36 ATCATCT 20 6.981332E-4 43.962498 37 CTGCCAG 20 6.981332E-4 43.962498 14 >>END_MODULE Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261512 spots for SRR6892963.sra Written 8261512 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra Read 8261501 spots for SRR6892963.sra Written 8261501 spots for SRR6892963.sra SRR ids: ['SRR6892963.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_njqfr2vi SRR6892963.sra spots: 165230031 blocks: [[1, 8261501], [8261502, 16523002], [16523003, 24784503], [24784504, 33046004], [33046005, 41307505], [41307506, 49569006], [49569007, 57830507], [57830508, 66092008], [66092009, 74353509], [74353510, 82615010], [82615011, 90876511], [90876512, 99138012], [99138013, 107399513], [107399514, 115661014], [115661015, 123922515], [123922516, 132184016], [132184017, 140445517], [140445518, 148707018], [148707019, 156968519], [156968520, 165230031]] SRR6892963 file size 28691076 SRR6892963 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892963 SRR6892963_1.fastq Input file: SRR6892963_1.fastq trimmed: SRR6892963-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:57:16 2024 >> started Fri Dec 6 13:58:42 2024 >> done (86.455s) 165230031 reads processed; of these: 32552 ( 0.02%) short reads filtered out after trimming by size control 87 ( 0.00%) empty reads filtered out after trimming by size control 165197392 (99.98%) reads available; of these: 6218122 ( 3.76%) trimmed reads available after processing 158979270 (96.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14021 0.01% 19 23112 0.01% 20 32659 0.02% 21 23985 0.01% 22 17021 0.01% 23 42795 0.03% 24 37800 0.02% 25 46274 0.03% 26 56875 0.03% 27 169938 0.10% 28 51705 0.03% 29 25314 0.02% 30 27033 0.02% 31 31746 0.02% 32 39176 0.02% 33 210885 0.13% 34 158201 0.10% 35 97661 0.06% 36 102565 0.06% 37 82169 0.05% 38 56125 0.03% 39 60310 0.04% 40 59171 0.04% 41 142077 0.09% 42 80718 0.05% 43 351128 0.21% 44 199596 0.12% 45 141410 0.09% 46 262980 0.16% 47 1642495 0.99% 48 1040701 0.63% 49 890476 0.54% 50 158979270 96.24% 165197392 reads passed initial QC criterion=sequence-density sequence-density=97.80 sequence-density-rank=1 fanout-score=43.79 fanout-score-rank=1 prefix-density=94.71 prefix-fanout=43.8 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGCC criterion=fanout-score sequence-density=97.80 sequence-density-rank=1 fanout-score=43.79 fanout-score-rank=1 prefix-density=94.71 prefix-fanout=43.8 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGCC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGCC -o SRR6892963 - Input file: STDIN trimmed: SRR6892963-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGCC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 14:02:37 2024 >> started Fri Dec 6 14:05:46 2024 >> done (189.208s) 161826017 reads processed; of these: 6197609 ( 3.83%) short reads filtered out after trimming by size control 5968930 ( 3.69%) empty reads filtered out after trimming by size control 149659478 (92.48%) reads available; of these: 148520986 (99.24%) trimmed reads available after processing 1138492 ( 0.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4116229 2.75% 19 2122841 1.42% 20 70454498 47.08% 21 70175108 46.89% 22 305569 0.20% 23 186352 0.12% 24 197036 0.13% 25 228400 0.15% 26 285359 0.19% 27 207063 0.14% 28 169721 0.11% 29 122048 0.08% 30 77827 0.05% 31 58236 0.04% 32 43323 0.03% 33 40922 0.03% 34 48557 0.03% 35 48911 0.03% 36 50118 0.03% 37 25233 0.02% 38 9679 0.01% 39 9496 0.01% 40 7196 0.00% 41 7044 0.00% 42 4809 0.00% 43 9969 0.01% 44 9248 0.01% 45 8457 0.01% 46 10919 0.01% 47 9654 0.01% 48 9701 0.01% 49 5955 0.00% 50 594000 0.40% criterion=sequence-density sequence-density=4.55 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=17 prefix-density=0.00 prefix-fanout=1.0 sequence=CATCGAGTAGACCTTGTTATTGGAATTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=9 fanout-score=24.70 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=14.9 sequence=TGGAATTCTCGTATGCCGTCTTCTGCTTGAAAAA Started job on | Dec 06 14:06:33 Started mapping on | Dec 06 14:06:33 Finished on | Dec 06 14:10:09 Mapping speed, Million of reads per hour | 2550.51 Number of input reads | 153030853 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 118737457 Uniquely mapped reads % | 77.59% Average mapped length | 20.40 Number of splices: Total | 3894997 Number of splices: Annotated (sjdb) | 3683843 Number of splices: GT/AG | 3849314 Number of splices: GC/AG | 42503 Number of splices: AT/AC | 2160 Number of splices: Non-canonical | 1020 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 20695671 % of reads mapped to multiple loci | 13.52% Number of reads mapped to too many loci | 9079007 % of reads mapped to too many loci | 5.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 13597725 13597725 13597725 N_multimapping 20695671 20695671 20695671 N_noFeature 6157079 7328437 115052595 N_ambiguous 2698703 194224 10856 UnstrandedReadsAssigned:109881675 PositiveStrandReadsAssigned:111214796 NegativeStrandReadsAssigned:3674006 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892963 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892963-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 153,030,853 reads, 115,347,732 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,437 rounds 52973 SRR6892963.ke.tsv 35125 SRR6892963.se.tsv 88098 total ==> SRR6892963.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 43.069 0.570928 PNS24249 1928 1829 863.259 5.91257 PNS24246 1044 945 43.069 0.570928 PNS24248 1044 945 43.069 0.570928 PNS24244 1471 1372 3509.53 32.0438 PNS24243 293 194 4.10243 0.264904 KQK14069 1603 1504 236035 1965.97 KQK14071 474 375 13744.7 459.147 ==> SRR6892963.se.tsv <== BRADI_1g14170v3 232274 BRADI_1g53295v3 164 BRADI_1g59795v3 1096 BRADI_1g07683v3 3 BRADI_1g00485v3 60 BRADI_1g20270v3 4459 BRADI_1g74790v3 1968 BRADI_1g09890v3 35 BRADI_1g77505v3 2976 BRADI_1g48960v3 3 SRR6892963 completed mapping pipeline successfully