Starting /dee2/code/volunteer_pipeline.sh SRR6892964 current disk space = 1550669144064 free memory = 1603353584 SRR6892964 SRAfilesize 762fc61f465c9300faee97341b1d1644 SRR6892964.sra SRR6892964.sra file validated SRR6892964 is single end SRR6892964 is conventional basespace SRR6892964 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892964_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4125 34.0 31.0 34.0 31.0 34.0 2 32.73925 34.0 31.0 34.0 31.0 34.0 3 32.85875 34.0 31.0 34.0 31.0 34.0 4 36.3285 37.0 37.0 37.0 35.0 37.0 5 36.25975 37.0 37.0 37.0 35.0 37.0 6 36.25775 37.0 37.0 37.0 35.0 37.0 7 36.19525 37.0 37.0 37.0 35.0 37.0 8 36.24875 37.0 37.0 37.0 35.0 37.0 9 38.10575 39.0 39.0 39.0 37.0 39.0 10 38.08475 39.0 39.0 39.0 37.0 39.0 11 38.021 39.0 39.0 39.0 35.0 39.0 12 38.078 39.0 39.0 39.0 35.0 39.0 13 37.97125 39.0 38.0 39.0 35.0 39.0 14 39.35275 41.0 39.0 41.0 36.0 41.0 15 39.50775 41.0 39.0 41.0 36.0 41.0 16 39.45525 41.0 39.0 41.0 36.0 41.0 17 39.50525 41.0 39.0 41.0 36.0 41.0 18 39.30025 41.0 39.0 41.0 36.0 41.0 19 39.46675 41.0 39.0 41.0 36.0 41.0 20 39.4105 41.0 39.0 41.0 36.0 41.0 21 39.24625 41.0 39.0 41.0 36.0 41.0 22 39.223 41.0 39.0 41.0 36.0 41.0 23 40.0965 41.0 40.0 41.0 39.0 41.0 24 39.50425 41.0 40.0 41.0 37.0 41.0 25 40.17375 41.0 40.0 41.0 39.0 41.0 26 39.88425 41.0 40.0 41.0 38.0 41.0 27 40.36825 41.0 40.0 41.0 39.0 41.0 28 39.547 41.0 40.0 41.0 37.0 41.0 29 39.01325 41.0 39.0 41.0 35.0 41.0 30 39.07325 41.0 39.0 41.0 36.0 41.0 31 39.0645 41.0 39.0 41.0 36.0 41.0 32 40.038 41.0 40.0 41.0 39.0 41.0 33 40.15425 41.0 40.0 41.0 40.0 41.0 34 35.1535 37.0 33.0 40.0 28.0 41.0 35 35.12175 37.0 34.0 39.0 30.0 39.0 36 37.15675 39.0 37.0 40.0 32.0 40.0 37 39.0375 40.0 39.0 41.0 37.0 41.0 38 38.7895 40.0 39.0 41.0 35.0 41.0 39 39.37875 40.0 39.0 41.0 37.0 41.0 40 39.212 41.0 40.0 41.0 36.0 41.0 41 39.74575 41.0 40.0 41.0 38.0 41.0 42 38.23325 40.0 38.0 41.0 34.0 41.0 43 38.779 40.0 38.0 41.0 36.0 41.0 44 39.0355 40.0 39.0 41.0 36.0 41.0 45 39.21825 41.0 40.0 41.0 36.0 41.0 46 39.3665 41.0 40.0 41.0 37.0 41.0 47 39.631 41.0 40.0 41.0 37.0 41.0 48 38.50575 41.0 38.0 41.0 35.0 41.0 49 37.281 40.0 37.0 41.0 33.0 41.0 50 36.407 39.0 36.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 2.0 16 0.0 17 1.0 18 2.0 19 2.0 20 4.0 21 2.0 22 3.0 23 1.0 24 6.0 25 8.0 26 10.0 27 13.0 28 16.0 29 15.0 30 19.0 31 28.0 32 33.0 33 49.0 34 78.0 35 140.0 36 230.0 37 368.0 38 665.0 39 2301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.603678508440414 23.507180650037792 26.35424540186445 33.53489543965734 2 18.625 27.750000000000004 26.474999999999998 27.150000000000002 3 23.674999999999997 20.05 23.175 33.1 4 29.975 21.55 23.549999999999997 24.925 5 24.675 30.4 24.025 20.9 6 25.874999999999996 20.125 24.6 29.4 7 23.799999999999997 21.175 34.925 20.1 8 21.525 21.0 28.749999999999996 28.725 9 23.95 19.400000000000002 34.875 21.775 10 24.3 19.55 26.174999999999997 29.975 11 31.025000000000002 21.15 25.624999999999996 22.2 12 34.175 20.674999999999997 25.324999999999996 19.825 13 24.85 21.675 24.65 28.825 14 26.174999999999997 30.175 23.175 20.474999999999998 15 26.724999999999998 30.349999999999998 23.575 19.35 16 23.549999999999997 26.375 22.975 27.1 17 30.475 24.5 23.225 21.8 18 34.975 22.425 19.925 22.675 19 25.624999999999996 36.8 19.400000000000002 18.175 20 23.75 25.95 29.4 20.9 21 8.3 9.175 70.875 11.65 22 61.3 0.75 37.9 0.05 23 98.15 1.375 0.42500000000000004 0.05 24 37.8 61.25000000000001 0.8500000000000001 0.1 25 0.05 98.125 1.4500000000000002 0.375 26 0.075 37.85 61.550000000000004 0.525 27 0.15 0.0 98.6 1.25 28 0.44999999999999996 0.025 38.9 60.62499999999999 29 0.8750000000000001 0.0 60.3 38.824999999999996 30 1.825 0.0 37.925 60.25 31 61.7 0.05 0.375 37.875 32 99.3 0.05 0.44999999999999996 0.2 33 98.3 0.17500000000000002 1.0999999999999999 0.42500000000000004 34 40.175 0.2 58.8 0.8250000000000001 35 61.050000000000004 0.42500000000000004 36.875 1.6500000000000001 36 37.775 0.8250000000000001 0.075 61.324999999999996 37 0.475 1.8499999999999999 0.075 97.6 38 0.8250000000000001 61.35 0.0 37.824999999999996 39 2.0 97.82499999999999 0.05 0.125 40 61.175000000000004 38.525 0.15 0.15 41 97.175 2.15 0.15 0.525 42 37.574999999999996 61.175000000000004 0.5499999999999999 0.7000000000000001 43 0.15 96.975 0.7000000000000001 2.175 44 0.075 37.5 1.775 60.650000000000006 45 0.125 0.5 59.599999999999994 39.775 46 0.44999999999999996 0.7250000000000001 37.375 61.45 47 0.625 1.825 0.5499999999999999 97.0 48 1.775 59.4 0.8500000000000001 37.974999999999994 49 59.361648655441066 37.748177934154306 1.9351595878361396 0.9550138225684845 50 37.425000000000004 1.0 58.975 2.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 2.0 34 4.0 35 5.0 36 6.0 37 13.0 38 20.0 39 35.0 40 50.0 41 80.5 42 111.0 43 153.5 44 196.0 45 264.5 46 333.0 47 373.0 48 413.0 49 437.0 50 461.0 51 454.0 52 447.0 53 461.0 54 475.0 55 576.5 56 678.0 57 497.0 58 316.0 59 278.5 60 241.0 61 183.5 62 126.0 63 93.0 64 60.0 65 47.5 66 35.0 67 28.0 68 21.0 69 13.5 70 6.0 71 3.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.525 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.37805956944854 83.39999999999999 2 0.7962253022707166 1.35 3 0.29489826010026543 0.75 4 0.0 0.0 5 0.08846947803007962 0.375 6 0.029489826010026542 0.15 7 0.058979652020053085 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.32438808611029196 6.175 >50 0.0 0.0 >100 0.029489826010026542 7.449999999999999 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source CACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 298 7.449999999999999 RNA PCR Primer, Index 1 (100% over 30bp) TACCTGGTTGATCCTGCCAGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 50 1.25 RNA PCR Primer, Index 1 (100% over 30bp) CGACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAG 36 0.8999999999999999 RNA PCR Primer, Index 1 (100% over 29bp) TCCCGCGCGCTGTGGACCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT 25 0.625 RNA PCR Primer, Index 1 (100% over 30bp) GACACGACTCTCGGCAACGGATGGAATTCTCGGGTGCCAAGGAACTCCAG 25 0.625 RNA PCR Primer, Index 1 (100% over 29bp) ACACGACTCTCGGCAACGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT 24 0.6 RNA PCR Primer, Index 1 (100% over 30bp) GACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 18 0.44999999999999996 RNA PCR Primer, Index 1 (100% over 30bp) TCCCGCGCGCTGTGGACCTTCTGGAATTCTCGGGTGCCAAGGAACTCCAG 17 0.42500000000000004 RNA PCR Primer, Index 1 (100% over 29bp) TACCTGGTTGATCCTGCCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG 15 0.375 RNA PCR Primer, Index 1 (100% over 29bp) ACGACTCTCGGCAACGGATATTGGAATTCTCGGGTGCCAAGGAACTCCAG 15 0.375 RNA PCR Primer, Index 1 (100% over 29bp) CACGACTCTCGGCAACGGATTGGAATTCTCGGGGGCCAAGGAACTCCAGT 11 0.27499999999999997 RNA PCR Primer, Index 1 (96% over 30bp) ACACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAG 11 0.27499999999999997 RNA PCR Primer, Index 1 (100% over 29bp) TAAGTGGGAGCCTTTACGGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG 7 0.17500000000000002 RNA PCR Primer, Index 1 (100% over 29bp) CGACACGACTCTCGGCAACGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 7 0.17500000000000002 RNA PCR Primer, Index 1 (100% over 30bp) TTCACACAATTGGTCATCGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 6 0.15 RNA PCR Primer, Index 1 (100% over 30bp) TTACGGTGCCCAACTGCGCGCTGGAATTCTCGGGTGCCAAGGAACTCCAG 5 0.125 RNA PCR Primer, Index 1 (100% over 29bp) NACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) ACCGTGCCGCGATAGTAATTCTGGAATTCTCGGGTGCCAAGGAACTCCAG 5 0.125 RNA PCR Primer, Index 1 (100% over 29bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.05 0.0 0.0 0.0 17 0.0 0.125 0.0 0.0 0.0 18 0.0 0.4 0.0 0.0 0.0 19 0.0 0.8 0.0 0.0 0.0 20 0.0 1.7 0.0 0.0 0.0 21 0.0 61.475 0.0 0.0 0.0 22 0.0 98.9 0.0 0.0 0.0 23 0.0 98.9 0.0 0.0 0.0 24 0.0 98.9 0.0 0.0 0.0 25 0.0 98.9 0.0 0.0 0.0 26 0.0 98.9 0.0 0.0 0.0 27 0.0 98.9 0.0 0.0 0.0 28 0.0 98.9 0.0 0.0 0.0 29 0.0 98.9 0.0 0.0 0.0 30 0.0 98.9 0.0 0.0 0.0 31 0.0 98.9 0.0 0.0 0.0 32 0.0 98.9 0.0 0.0 0.0 33 0.0 98.9 0.0 0.0 0.0 34 0.0 98.9 0.0 0.0 0.0 35 0.0 98.9 0.0 0.0 0.0 36 0.0 98.9 0.0 0.0 0.0 37 0.0 98.9 0.0 0.0 0.0 38 0.0 98.9 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTGG 40 5.315087E-9 44.000004 17 CGGATTG 40 5.315087E-9 44.000004 16 GATTGGA 40 5.315087E-9 44.000004 18 ACGGATT 45 1.506669E-8 39.111115 15 CTCCAGT 260 0.0 38.92308 44 ATTGGAA 55 1.9645086E-9 36.0 19 CACGACT 50 3.81915E-8 35.2 1 GACTGGA 25 0.002084305 35.2 18 ACTGGAA 50 3.81915E-8 35.2 19 GGCAACG 55 8.843199E-8 32.0 11 TCGGCAA 55 8.843199E-8 32.0 9 CTCTCGG 55 8.843199E-8 32.0 6 ACTCTCG 55 8.843199E-8 32.0 5 GCAACGG 55 8.843199E-8 32.0 12 TCTCGGC 55 8.843199E-8 32.0 7 CTGGAAT 110 0.0 32.0 20 CTCGGCA 55 8.843199E-8 32.0 8 CGGCAAC 55 8.843199E-8 32.0 10 AACGGAT 55 8.843199E-8 32.0 14 GACTCTC 55 8.843199E-8 32.0 4 >>END_MODULE Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550537 spots for SRR6892964.sra Written 1550537 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra Read 1550530 spots for SRR6892964.sra Written 1550530 spots for SRR6892964.sra SRR ids: ['SRR6892964.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o27qvhrp SRR6892964.sra spots: 31010607 blocks: [[1, 1550530], [1550531, 3101060], [3101061, 4651590], [4651591, 6202120], [6202121, 7752650], [7752651, 9303180], [9303181, 10853710], [10853711, 12404240], [12404241, 13954770], [13954771, 15505300], [15505301, 17055830], [17055831, 18606360], [18606361, 20156890], [20156891, 21707420], [21707421, 23257950], [23257951, 24808480], [24808481, 26359010], [26359011, 27909540], [27909541, 29460070], [29460071, 31010607]] SRR6892964 file size 5364019 SRR6892964 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892964 SRR6892964_1.fastq Input file: SRR6892964_1.fastq trimmed: SRR6892964-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:54:42 2024 >> started Fri Dec 6 13:55:03 2024 >> done (20.393s) 31010607 reads processed; of these: 12959 ( 0.04%) short reads filtered out after trimming by size control 14 ( 0.00%) empty reads filtered out after trimming by size control 30997634 (99.96%) reads available; of these: 1275316 ( 4.11%) trimmed reads available after processing 29722318 (95.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10430 0.03% 19 12313 0.04% 20 10244 0.03% 21 3383 0.01% 22 1877 0.01% 23 6073 0.02% 24 4099 0.01% 25 5183 0.02% 26 7101 0.02% 27 29626 0.10% 28 4330 0.01% 29 1798 0.01% 30 2226 0.01% 31 3243 0.01% 32 9848 0.03% 33 50786 0.16% 34 23327 0.08% 35 26358 0.09% 36 19130 0.06% 37 28433 0.09% 38 16389 0.05% 39 15089 0.05% 40 10152 0.03% 41 39342 0.13% 42 16873 0.05% 43 77249 0.25% 44 28068 0.09% 45 13751 0.04% 46 36451 0.12% 47 409520 1.32% 48 231789 0.75% 49 120835 0.39% 50 29722318 95.89% 30997634 reads passed initial QC criterion=sequence-density sequence-density=98.59 sequence-density-rank=1 fanout-score=31.97 fanout-score-rank=4 prefix-density=98.89 prefix-fanout=31.9 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC criterion=fanout-score sequence-density=1.91 sequence-density-rank=4 fanout-score=195.99 fanout-score-rank=1 prefix-density=98.84 prefix-fanout=3.8 sequence=GAATTCTCGGGGGCCAAGGAACT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC -o SRR6892964 - Input file: STDIN trimmed: SRR6892964-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:55:43 2024 >> started Fri Dec 6 13:56:20 2024 >> done (37.156s) 30371419 reads processed; of these: 143965 ( 0.47%) short reads filtered out after trimming by size control 2765 ( 0.01%) empty reads filtered out after trimming by size control 30224689 (99.52%) reads available; of these: 30029767 (99.36%) trimmed reads available after processing 194922 ( 0.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 144001 0.48% 19 234000 0.77% 20 17968964 59.45% 21 11661140 38.58% 22 38664 0.13% 23 9462 0.03% 24 2366 0.01% 25 2058 0.01% 26 1359 0.00% 27 3092 0.01% 28 620 0.00% 29 820 0.00% 30 792 0.00% 31 373 0.00% 32 618 0.00% 33 1011 0.00% 34 2955 0.01% 35 11802 0.04% 36 10746 0.04% 37 4410 0.01% 38 1637 0.01% 39 1411 0.00% 40 676 0.00% 41 5946 0.02% 42 4214 0.01% 43 1585 0.01% 44 1342 0.00% 45 1117 0.00% 46 1451 0.00% 47 1352 0.00% 48 1472 0.00% 49 1358 0.00% 50 101875 0.34% criterion=sequence-density sequence-density=1.72 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=11 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=6 fanout-score=79.54 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=24.2 sequence=TGGAATTCTCGTATGCCGTCTTCTGCTTGAA Started job on | Dec 06 13:56:40 Started mapping on | Dec 06 13:56:40 Finished on | Dec 06 13:57:48 Mapping speed, Million of reads per hour | 1633.28 Number of input reads | 30850904 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 22073719 Uniquely mapped reads % | 71.55% Average mapped length | 20.32 Number of splices: Total | 465905 Number of splices: Annotated (sjdb) | 440423 Number of splices: GT/AG | 460729 Number of splices: GC/AG | 4950 Number of splices: AT/AC | 161 Number of splices: Non-canonical | 65 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.08 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2330276 % of reads mapped to multiple loci | 7.55% Number of reads mapped to too many loci | 5616606 % of reads mapped to too many loci | 18.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6446909 6446909 6446909 N_multimapping 2330276 2330276 2330276 N_noFeature 1191997 1441787 21315444 N_ambiguous 529094 20551 2366 UnstrandedReadsAssigned:20352628 PositiveStrandReadsAssigned:20611381 NegativeStrandReadsAssigned:755909 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892964 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892964-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,850,904 reads, 19,935,811 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR6892964.ke.tsv 35125 SRR6892964.se.tsv 88098 total ==> SRR6892964.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 1.23612 0.0927664 PNS24249 1928 1829 52.0473 2.01811 PNS24246 1044 945 1.23612 0.0927664 PNS24248 1044 945 1.23612 0.0927664 PNS24244 1471 1372 658.368 34.031 PNS24243 293 194 3 1.09668 KQK14069 1603 1504 5669.74 267.348 KQK14071 474 375 23.7118 4.48429 ==> SRR6892964.se.tsv <== BRADI_1g14170v3 5602 BRADI_1g53295v3 18 BRADI_1g59795v3 43 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 287 BRADI_1g74790v3 522 BRADI_1g09890v3 11 BRADI_1g77505v3 132 BRADI_1g48960v3 1 SRR6892964 completed mapping pipeline successfully