Starting /dee2/code/volunteer_pipeline.sh SRR6892965 current disk space = 1550692057088 free memory = 1601805672 SRR6892965 SRAfilesize 659ee9a816db305b0ae55583d72e7904 SRR6892965.sra SRR6892965.sra file validated SRR6892965 is single end SRR6892965 is conventional basespace SRR6892965 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892965_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37825 34.0 31.0 34.0 31.0 34.0 2 32.56 34.0 31.0 34.0 31.0 34.0 3 32.65625 34.0 31.0 34.0 31.0 34.0 4 36.0045 37.0 35.0 37.0 35.0 37.0 5 36.0485 37.0 35.0 37.0 35.0 37.0 6 36.08175 37.0 35.0 37.0 35.0 37.0 7 36.10125 37.0 35.0 37.0 35.0 37.0 8 36.08775 37.0 35.0 37.0 35.0 37.0 9 37.89575 39.0 38.0 39.0 35.0 39.0 10 37.6765 39.0 38.0 39.0 35.0 39.0 11 37.766 39.0 38.0 39.0 35.0 39.0 12 37.4875 39.0 37.0 39.0 34.0 39.0 13 37.61825 39.0 37.0 39.0 35.0 39.0 14 39.06775 41.0 38.0 41.0 36.0 41.0 15 39.12325 41.0 39.0 41.0 36.0 41.0 16 39.11975 41.0 38.0 41.0 36.0 41.0 17 38.99575 40.0 38.0 41.0 36.0 41.0 18 38.9545 40.0 38.0 41.0 35.0 41.0 19 38.9455 40.0 38.0 41.0 35.0 41.0 20 38.97775 40.0 38.0 41.0 35.0 41.0 21 38.95825 40.0 39.0 41.0 36.0 41.0 22 38.913 40.0 38.0 41.0 35.0 41.0 23 39.82575 41.0 39.0 41.0 38.0 41.0 24 39.35575 41.0 39.0 41.0 36.0 41.0 25 40.1235 41.0 40.0 41.0 39.0 41.0 26 39.83125 41.0 40.0 41.0 38.0 41.0 27 40.39325 41.0 40.0 41.0 39.0 41.0 28 39.64825 41.0 40.0 41.0 37.0 41.0 29 38.7975 40.0 38.0 41.0 35.0 41.0 30 38.64925 40.0 38.0 41.0 34.0 41.0 31 38.945 41.0 39.0 41.0 35.0 41.0 32 40.10975 41.0 40.0 41.0 38.0 41.0 33 40.382 41.0 40.0 41.0 40.0 41.0 34 35.407 37.0 34.0 41.0 25.0 41.0 35 34.36875 37.0 33.0 38.0 25.0 39.0 36 36.97375 39.0 37.0 40.0 31.0 40.0 37 39.01525 40.0 39.0 41.0 37.0 41.0 38 38.85575 40.0 39.0 41.0 35.0 41.0 39 39.63 41.0 40.0 41.0 38.0 41.0 40 39.2155 41.0 40.0 41.0 36.0 41.0 41 39.96575 41.0 40.0 41.0 38.0 41.0 42 38.651 40.0 38.0 41.0 35.0 41.0 43 39.24475 40.0 39.0 41.0 37.0 41.0 44 39.089 40.0 39.0 41.0 36.0 41.0 45 39.1985 41.0 40.0 41.0 36.0 41.0 46 39.26225 41.0 40.0 41.0 36.0 41.0 47 39.63475 41.0 40.0 41.0 37.0 41.0 48 38.64825 41.0 39.0 41.0 35.0 41.0 49 38.35875 40.0 38.0 41.0 34.0 41.0 50 37.0355 39.0 37.0 41.0 33.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 3.0 20 0.0 21 2.0 22 3.0 23 5.0 24 7.0 25 4.0 26 5.0 27 14.0 28 14.0 29 12.0 30 23.0 31 45.0 32 40.0 33 72.0 34 105.0 35 168.0 36 238.0 37 425.0 38 622.0 39 2189.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.475 27.325 25.35 28.849999999999998 2 19.325 18.224999999999998 27.975 34.475 3 26.1 24.675 25.3 23.925 4 26.0 24.325 23.925 25.75 5 22.425 27.224999999999998 25.4 24.95 6 27.775 23.075000000000003 26.525 22.625 7 23.225 27.1 29.25 20.424999999999997 8 24.95 23.849999999999998 29.849999999999998 21.349999999999998 9 28.575 23.65 26.450000000000003 21.325 10 25.974999999999998 26.075 26.6 21.349999999999998 11 28.175 23.025000000000002 23.925 24.875 12 29.375 24.125 24.099999999999998 22.400000000000002 13 25.7 27.400000000000002 25.724999999999998 21.175 14 24.825 26.400000000000002 24.625 24.15 15 23.325000000000003 28.65 28.449999999999996 19.575 16 28.749999999999996 26.200000000000003 25.474999999999998 19.575 17 23.474999999999998 28.025 29.375 19.125 18 30.525000000000002 25.4 23.674999999999997 20.4 19 25.5 32.45 21.175 20.875 20 22.925 33.050000000000004 20.7 23.325000000000003 21 10.274999999999999 13.8 62.975 12.950000000000001 22 52.425 0.475 46.925 0.17500000000000002 23 98.8229401452542 0.7012271475081392 0.3756574004507889 0.10017530678687703 24 46.93520140105078 52.41431073304979 0.475356517388041 0.17513134851138354 25 0.17500000000000002 98.8 0.8 0.22499999999999998 26 0.17500000000000002 46.9 52.575 0.35000000000000003 27 0.25 0.125 99.02499999999999 0.6 28 0.35000000000000003 0.17500000000000002 47.349999999999994 52.125 29 0.5499999999999999 0.1 52.15 47.199999999999996 30 0.8999999999999999 0.075 46.975 52.05 31 52.725 0.0 0.375 46.9 32 99.2 0.1 0.375 0.325 33 98.85000000000001 0.1 0.625 0.42500000000000004 34 49.325 0.17500000000000002 49.9 0.6 35 52.87500000000001 0.3 45.800000000000004 1.0250000000000001 36 46.800000000000004 0.475 0.2 52.525 37 0.625 1.0999999999999999 0.05 98.225 38 0.625 52.7 0.125 46.550000000000004 39 1.225 98.375 0.1 0.3 40 52.625 47.0 0.075 0.3 41 97.95 1.4000000000000001 0.25 0.4 42 46.425 52.800000000000004 0.27499999999999997 0.5 43 0.3 97.975 0.35000000000000003 1.375 44 0.15 46.45 1.175 52.225 45 0.325 0.44999999999999996 51.55 47.675 46 0.27499999999999997 0.4 46.25 53.075 47 0.27499999999999997 1.325 0.525 97.875 48 1.175 51.525 0.44999999999999996 46.85 49 51.575 46.325 1.3 0.8 50 46.35 0.6 51.300000000000004 1.7500000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.5 34 1.0 35 4.0 36 7.0 37 14.5 38 22.0 39 34.5 40 47.0 41 73.0 42 99.0 43 163.0 44 227.0 45 299.5 46 372.0 47 423.0 48 474.0 49 502.0 50 530.0 51 551.5 52 573.0 53 566.5 54 560.0 55 491.5 56 423.0 57 340.5 58 258.0 59 227.0 60 196.0 61 150.5 62 105.0 63 88.5 64 72.0 65 49.0 66 26.0 67 15.5 68 5.0 69 3.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.17500000000000002 24 0.075 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12934259754142 91.8 2 1.2827365045430252 2.4 3 0.2137894174238375 0.6 4 0.08017103153393908 0.3 5 0.10689470871191875 0.5 6 0.026723677177979688 0.15 7 0.026723677177979688 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.08017103153393908 0.775 >50 0.053447354355959376 3.3000000000000003 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ACACCGATGACGACTGTGAATGGAATTCTCGGGTGCCAAGGAACTCCAGT 81 2.025 RNA PCR Primer, Index 1 (100% over 30bp) ACACCGATGACGACTGTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCAG 51 1.275 RNA PCR Primer, Index 1 (100% over 29bp) CACGACTCTCGGCAACGGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 11 0.27499999999999997 RNA PCR Primer, Index 1 (100% over 30bp) GCAGTGCATCAGCTTCATCGCTGGAATTCTCGGGTGCCAAGGAACTCCAG 10 0.25 RNA PCR Primer, Index 1 (100% over 29bp) TAACTTGATATGTAAGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 10 0.25 RNA PCR Primer, Index 1 (100% over 30bp) CAGTGCATCAGCTTCATCGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 7 0.17500000000000002 RNA PCR Primer, Index 1 (100% over 30bp) TTCAACCAATAGACACCGATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 6 0.15 RNA PCR Primer, Index 1 (100% over 30bp) CATCGAGTAGACCTTGTTATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) CTTCAAGCCTCCAGGCTGCGATGGAATTCTCGGGTGCCAAGGAACTCCAG 5 0.125 RNA PCR Primer, Index 1 (100% over 29bp) TTCAAGCCTCCAGGCTGCGATGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) GACACGACTCTCGGCAACGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.05 0.0 0.0 0.0 2 0.0 0.05 0.0 0.0 0.0 3 0.0 0.05 0.0 0.0 0.0 4 0.0 0.05 0.0 0.0 0.0 5 0.0 0.05 0.0 0.0 0.0 6 0.0 0.05 0.0 0.0 0.0 7 0.0 0.05 0.0 0.0 0.0 8 0.0 0.05 0.0 0.0 0.0 9 0.0 0.05 0.0 0.0 0.0 10 0.0 0.05 0.0 0.0 0.0 11 0.0 0.05 0.0 0.0 0.0 12 0.0 0.05 0.0 0.0 0.0 13 0.0 0.05 0.0 0.0 0.0 14 0.0 0.05 0.0 0.0 0.0 15 0.0 0.05 0.0 0.0 0.0 16 0.0 0.1 0.0 0.0 0.0 17 0.0 0.2 0.0 0.0 0.0 18 0.0 0.375 0.0 0.0 0.0 19 0.0 0.575 0.0 0.0 0.0 20 0.0 0.925 0.0 0.0 0.0 21 0.0 52.35 0.0 0.0 0.0 22 0.0 98.65 0.0 0.0 0.0 23 0.0 98.7 0.0 0.0 0.0 24 0.0 98.75 0.0 0.0 0.0 25 0.0 98.825 0.0 0.0 0.0 26 0.0 98.85 0.0 0.0 0.0 27 0.0 98.85 0.0 0.0 0.0 28 0.0 98.85 0.0 0.0 0.0 29 0.0 98.85 0.0 0.0 0.0 30 0.0 98.85 0.0 0.0 0.0 31 0.0 98.85 0.0 0.0 0.0 32 0.0 98.85 0.0 0.0 0.0 33 0.0 98.85 0.0 0.0 0.0 34 0.0 98.85 0.0 0.0 0.0 35 0.0 98.85 0.0 0.0 0.0 36 0.0 98.85 0.0 0.0 0.0 37 0.0 98.85 0.0 0.0 0.0 38 0.0 98.85 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTGA 20 6.952051E-4 44.000004 13 ATGACGA 20 6.952051E-4 44.000004 7 CACCGAT 20 6.952051E-4 44.000004 2 ACACCGA 20 6.952051E-4 44.000004 1 ACCGATG 20 6.952051E-4 44.000004 3 GATGACG 20 6.952051E-4 44.000004 6 CTGTGAA 20 6.952051E-4 44.000004 14 GACTGTG 20 6.952051E-4 44.000004 12 GACGACT 20 6.952051E-4 44.000004 9 ACGACTG 20 6.952051E-4 44.000004 10 CGATGAC 20 6.952051E-4 44.000004 5 CCGATGA 20 6.952051E-4 44.000004 4 CGACTGT 20 6.952051E-4 44.000004 11 TGACGAC 20 6.952051E-4 44.000004 8 CTCCAGT 185 0.0 42.81081 44 GATTGGA 25 0.002084305 35.2 18 AAGTGGA 25 0.002084305 35.2 19 ACTGGAA 30 0.005095276 29.333332 19 GTGGAAT 100 0.0 28.599998 21 ATTGGAA 45 0.0011696975 24.444447 19 >>END_MODULE Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333619 spots for SRR6892965.sra Written 1333619 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra Read 1333613 spots for SRR6892965.sra Written 1333613 spots for SRR6892965.sra SRR ids: ['SRR6892965.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8rasn7ry SRR6892965.sra spots: 26672266 blocks: [[1, 1333613], [1333614, 2667226], [2667227, 4000839], [4000840, 5334452], [5334453, 6668065], [6668066, 8001678], [8001679, 9335291], [9335292, 10668904], [10668905, 12002517], [12002518, 13336130], [13336131, 14669743], [14669744, 16003356], [16003357, 17336969], [17336970, 18670582], [18670583, 20004195], [20004196, 21337808], [21337809, 22671421], [22671422, 24005034], [24005035, 25338647], [25338648, 26672266]] SRR6892965 file size 4612195 SRR6892965 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892965 SRR6892965_1.fastq Input file: SRR6892965_1.fastq trimmed: SRR6892965-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:56:41 2024 >> started Fri Dec 6 13:56:56 2024 >> done (15.294s) 26672266 reads processed; of these: 6129 ( 0.02%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 26666136 (99.98%) reads available; of these: 919558 ( 3.45%) trimmed reads available after processing 25746578 (96.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3668 0.01% 19 5134 0.02% 20 4757 0.02% 21 1552 0.01% 22 857 0.00% 23 3077 0.01% 24 1677 0.01% 25 2424 0.01% 26 3561 0.01% 27 17455 0.07% 28 1812 0.01% 29 426 0.00% 30 626 0.00% 31 1808 0.01% 32 3944 0.01% 33 25858 0.10% 34 28549 0.11% 35 10124 0.04% 36 5442 0.02% 37 12085 0.05% 38 8456 0.03% 39 10673 0.04% 40 4663 0.02% 41 47623 0.18% 42 11790 0.04% 43 89941 0.34% 44 22699 0.09% 45 7627 0.03% 46 20527 0.08% 47 291052 1.09% 48 107142 0.40% 49 162529 0.61% 50 25746578 96.55% 26666136 reads passed initial QC criterion=sequence-density sequence-density=98.36 sequence-density-rank=1 fanout-score=46.39 fanout-score-rank=2 prefix-density=98.61 prefix-fanout=46.3 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTGTAATCTCGTATGC criterion=fanout-score sequence-density=3.43 sequence-density-rank=2 fanout-score=112.72 fanout-score-rank=1 prefix-density=98.56 prefix-fanout=3.9 sequence=GAATTCTCGGGGGCCAAGGAACT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTGTAATCTCGTATGC -o SRR6892965 - Input file: STDIN trimmed: SRR6892965-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTGTAATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:57:37 2024 >> started Fri Dec 6 13:58:05 2024 >> done (28.163s) 26127426 reads processed; of these: 72111 ( 0.28%) short reads filtered out after trimming by size control 24990 ( 0.10%) empty reads filtered out after trimming by size control 26030325 (99.63%) reads available; of these: 25902406 (99.51%) trimmed reads available after processing 127919 ( 0.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 71296 0.27% 19 116315 0.45% 20 13677260 52.54% 21 11951986 45.92% 22 44952 0.17% 23 28146 0.11% 24 18214 0.07% 25 8410 0.03% 26 3461 0.01% 27 3138 0.01% 28 454 0.00% 29 196 0.00% 30 209 0.00% 31 232 0.00% 32 383 0.00% 33 612 0.00% 34 2408 0.01% 35 4373 0.02% 36 2095 0.01% 37 2037 0.01% 38 906 0.00% 39 1436 0.01% 40 487 0.00% 41 1259 0.00% 42 679 0.00% 43 1560 0.01% 44 774 0.00% 45 798 0.00% 46 954 0.00% 47 1166 0.00% 48 699 0.00% 49 530 0.00% 50 82900 0.32% criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=24 prefix-density=0.00 prefix-fanout=1.0 sequence=CCGTCTGCACGTACGTACGTAT criterion=fanout-score sequence-density=0.12 sequence-density-rank=4 fanout-score=43.86 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=24.4 sequence=TGGAATTCTCGTATGCCGTCTTCTGCTTGA Started job on | Dec 06 13:58:25 Started mapping on | Dec 06 13:58:25 Finished on | Dec 06 13:59:14 Mapping speed, Million of reads per hour | 1952.01 Number of input reads | 26569035 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 23471400 Uniquely mapped reads % | 88.34% Average mapped length | 20.41 Number of splices: Total | 868349 Number of splices: Annotated (sjdb) | 850430 Number of splices: GT/AG | 860990 Number of splices: GC/AG | 6878 Number of splices: AT/AC | 442 Number of splices: Non-canonical | 39 Mismatch rate per base, % | 0.04% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2222530 % of reads mapped to multiple loci | 8.37% Number of reads mapped to too many loci | 198724 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 875105 875105 875105 N_multimapping 2222530 2222530 2222530 N_noFeature 1351386 1511575 22884966 N_ambiguous 446789 22334 1504 UnstrandedReadsAssigned:21673225 PositiveStrandReadsAssigned:21937491 NegativeStrandReadsAssigned:584930 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892965 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892965-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,569,035 reads, 21,318,272 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR6892965.ke.tsv 35125 SRR6892965.se.tsv 88098 total ==> SRR6892965.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0.502849 0.0338752 PNS24249 1928 1829 19.7156 0.686233 PNS24246 1044 945 0.502849 0.0338752 PNS24248 1044 945 0.502849 0.0338752 PNS24244 1471 1372 400.776 18.5962 PNS24243 293 194 3 0.984455 KQK14069 1603 1504 12108.4 512.527 KQK14071 474 375 107.171 18.1938 ==> SRR6892965.se.tsv <== BRADI_1g14170v3 12369 BRADI_1g53295v3 13 BRADI_1g59795v3 137 BRADI_1g07683v3 1 BRADI_1g00485v3 32 BRADI_1g20270v3 643 BRADI_1g74790v3 73 BRADI_1g09890v3 2 BRADI_1g77505v3 206 BRADI_1g48960v3 1 SRR6892965 completed mapping pipeline successfully