Starting /dee2/code/volunteer_pipeline.sh SRR6892966 current disk space = 1516053540864 free memory = 1597160824 SRR6892966 SRAfilesize 9e61d9a28f99590cb066fedda415fd4a SRR6892966.sra SRR6892966.sra file validated SRR6892966 is single end SRR6892966 is conventional basespace SRR6892966 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892966_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33275 33.0 31.0 34.0 31.0 34.0 2 32.47525 34.0 31.0 34.0 31.0 34.0 3 32.5695 34.0 31.0 34.0 31.0 34.0 4 35.99525 37.0 35.0 37.0 35.0 37.0 5 36.00675 37.0 35.0 37.0 35.0 37.0 6 35.99475 37.0 35.0 37.0 35.0 37.0 7 36.026 37.0 35.0 37.0 35.0 37.0 8 36.04525 37.0 35.0 37.0 35.0 37.0 9 37.722 39.0 37.0 39.0 35.0 39.0 10 37.6505 39.0 37.0 39.0 35.0 39.0 11 37.65025 39.0 37.0 39.0 35.0 39.0 12 37.434 39.0 37.0 39.0 34.0 39.0 13 37.59 39.0 37.0 39.0 35.0 39.0 14 39.08875 40.0 38.0 41.0 36.0 41.0 15 39.02375 40.0 38.0 41.0 36.0 41.0 16 39.00375 40.0 38.0 41.0 35.0 41.0 17 38.9055 40.0 38.0 41.0 35.0 41.0 18 38.823 40.0 38.0 41.0 35.0 41.0 19 38.81275 40.0 38.0 41.0 34.0 41.0 20 38.9305 40.0 38.0 41.0 35.0 41.0 21 38.8865 40.0 39.0 41.0 35.0 41.0 22 38.54375 40.0 38.0 41.0 34.0 41.0 23 39.554 41.0 39.0 41.0 37.0 41.0 24 38.853 40.0 38.0 41.0 35.0 41.0 25 39.7 40.0 40.0 41.0 38.0 41.0 26 39.53575 41.0 40.0 41.0 36.0 41.0 27 40.17275 41.0 40.0 41.0 39.0 41.0 28 39.2405 41.0 40.0 41.0 36.0 41.0 29 38.44075 40.0 38.0 41.0 34.0 41.0 30 38.3305 40.0 38.0 41.0 33.0 41.0 31 38.5685 40.0 38.0 41.0 34.0 41.0 32 39.68125 41.0 40.0 41.0 38.0 41.0 33 40.08475 41.0 40.0 41.0 39.0 41.0 34 34.70375 37.0 31.0 41.0 25.0 41.0 35 33.35575 35.0 30.0 38.0 25.0 39.0 36 36.3465 38.0 36.0 39.0 30.0 40.0 37 38.439 39.0 38.0 40.0 35.0 41.0 38 38.563 40.0 38.0 41.0 35.0 41.0 39 39.18175 40.0 39.0 41.0 36.0 41.0 40 38.82425 40.0 38.0 41.0 35.0 41.0 41 39.5575 41.0 40.0 41.0 37.0 41.0 42 38.5145 40.0 38.0 41.0 34.0 41.0 43 39.06325 40.0 39.0 41.0 36.0 41.0 44 38.8035 40.0 39.0 41.0 35.0 41.0 45 38.85125 41.0 39.0 41.0 35.0 41.0 46 38.8225 41.0 39.0 41.0 35.0 41.0 47 39.1915 41.0 39.0 41.0 36.0 41.0 48 38.244 40.0 38.0 41.0 34.0 41.0 49 37.938 40.0 38.0 41.0 34.0 41.0 50 36.126 38.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 1.0 18 1.0 19 1.0 20 3.0 21 2.0 22 2.0 23 7.0 24 5.0 25 9.0 26 15.0 27 9.0 28 16.0 29 23.0 30 39.0 31 45.0 32 53.0 33 69.0 34 114.0 35 184.0 36 266.0 37 454.0 38 784.0 39 1892.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.900000000000002 25.174999999999997 24.5 30.425 2 21.425 17.65 27.450000000000003 33.475 3 27.725 21.05 24.3 26.924999999999997 4 26.8 25.275 22.475 25.45 5 25.45 25.650000000000002 22.6 26.3 6 26.900000000000002 22.6 25.724999999999998 24.775 7 26.224999999999998 22.3 28.075 23.400000000000002 8 26.724999999999998 22.175 26.275 24.825 9 28.449999999999996 22.925 25.8 22.825 10 30.049999999999997 22.175 24.2 23.575 11 27.85 23.875 23.45 24.825 12 28.199999999999996 24.65 22.875 24.275 13 25.75 23.825 24.875 25.55 14 26.674999999999997 24.7 24.5 24.125 15 28.225 26.825 24.3 20.65 16 27.55 26.55 24.349999999999998 21.55 17 24.825 26.474999999999998 26.224999999999998 22.475 18 29.275000000000002 24.65 22.900000000000002 23.175 19 26.775 28.975 20.4 23.849999999999998 20 25.324999999999996 29.475 19.400000000000002 25.8 21 10.5 12.55 60.62499999999999 16.325 22 49.175000000000004 2.375 47.55 0.8999999999999999 23 94.80160723254646 1.8583626318432949 2.235057759919638 1.1049723756906076 24 47.01025769326995 48.711533650237676 3.0272704528396295 1.2509382036527394 25 1.25 94.25 2.7 1.7999999999999998 26 1.7000000000000002 46.275 50.025 2.0 27 1.975 0.22499999999999998 95.75 2.0500000000000003 28 2.875 0.42500000000000004 47.3 49.4 29 3.4750000000000005 0.475 48.949999999999996 47.099999999999994 30 3.55 0.8250000000000001 46.7 48.925000000000004 31 50.74999999999999 0.8750000000000001 1.25 47.125 32 96.175 1.0999999999999999 1.225 1.5 33 95.475 1.425 1.125 1.975 34 50.24999999999999 1.7000000000000002 45.45 2.6 35 51.025 2.1999999999999997 44.474999999999994 2.3 36 47.225 2.7 0.6 49.475 37 2.275 3.125 0.3 94.3 38 2.6 50.24999999999999 0.44999999999999996 46.7 39 2.725 95.025 0.65 1.6 40 49.6 47.85 1.0999999999999999 1.4500000000000002 41 93.72500000000001 2.825 1.0250000000000001 2.4250000000000003 42 45.9 49.8 1.325 2.9749999999999996 43 0.8 94.075 1.525 3.5999999999999996 44 0.775 46.775 1.7500000000000002 50.7 45 0.9249999999999999 2.125 48.475 48.475 46 1.6500000000000001 1.8499999999999999 45.725 50.775000000000006 47 1.575 2.65 1.35 94.425 48 1.725 49.175000000000004 1.4500000000000002 47.65 49 48.3 47.05 1.825 2.825 50 45.800000000000004 2.375 47.9 3.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.5 34 1.0 35 1.0 36 1.0 37 3.0 38 5.0 39 11.5 40 18.0 41 39.0 42 60.0 43 97.5 44 135.0 45 209.5 46 284.0 47 356.0 48 428.0 49 469.0 50 510.0 51 544.0 52 578.0 53 564.0 54 550.0 55 498.5 56 447.0 57 396.5 58 346.0 59 307.5 60 269.0 61 237.0 62 205.0 63 150.0 64 95.0 65 69.0 66 43.0 67 30.5 68 18.0 69 11.5 70 5.0 71 3.5 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.44999999999999996 24 0.075 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.74744376278119 96.575 2 0.843558282208589 1.6500000000000001 3 0.17893660531697342 0.525 4 0.10224948875255625 0.4 5 0.025562372188139063 0.125 6 0.025562372188139063 0.15 7 0.051124744376278126 0.35000000000000003 8 0.0 0.0 9 0.025562372188139063 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACACCGATGACGACTGTGAATGGAATTCTCGGGTGCCAAGGAACTCCAGT 9 0.22499999999999998 RNA PCR Primer, Index 1 (100% over 30bp) CATCGAGTAGACCTTGTTATTGGAATTCTCGGGTGCCAAGGAACTCCAGT 7 0.17500000000000002 RNA PCR Primer, Index 1 (100% over 30bp) CCGTCTGCACGTACGTACGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT 7 0.17500000000000002 RNA PCR Primer, Index 1 (100% over 30bp) TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGC 6 0.15 RNA PCR Primer, Index 7 (100% over 50bp) CCATATGTTCCTTGCCAACCTGGAATTCTCGGGTGCCAAGGAACTCCAGT 5 0.125 RNA PCR Primer, Index 1 (100% over 30bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.15 0.0 0.0 0.0 2 0.0 0.15 0.0 0.0 0.0 3 0.0 0.15 0.0 0.0 0.0 4 0.0 0.15 0.0 0.0 0.0 5 0.0 0.15 0.0 0.0 0.0 6 0.0 0.15 0.0 0.0 0.0 7 0.0 0.15 0.0 0.0 0.0 8 0.0 0.15 0.0 0.0 0.0 9 0.0 0.15 0.0 0.0 0.0 10 0.0 0.15 0.0 0.0 0.0 11 0.0 0.2 0.0 0.0 0.0 12 0.0 0.325 0.0 0.0 0.0 13 0.0 0.375 0.0 0.0 0.0 14 0.0 0.575 0.0 0.0 0.0 15 0.0 0.875 0.0 0.0 0.0 16 0.0 1.35 0.0 0.0 0.0 17 0.0 1.85 0.0 0.0 0.0 18 0.0 2.8 0.0 0.0 0.0 19 0.0 3.825 0.0 0.0 0.0 20 0.0 4.375 0.0 0.0 0.0 21 0.0 51.625 0.0 0.0 0.0 22 0.0 96.775 0.0 0.0 0.0 23 0.0 96.9 0.0 0.0 0.0 24 0.0 96.975 0.0 0.0 0.0 25 0.0 97.0 0.0 0.0 0.0 26 0.0 97.125 0.0 0.0 0.0 27 0.0 97.4 0.0 0.0 0.0 28 0.0 97.45 0.0 0.0 0.0 29 0.0 97.45 0.0 0.0 0.0 30 0.0 97.45 0.0 0.0 0.0 31 0.0 97.45 0.0 0.0 0.0 32 0.0 97.45 0.0 0.0 0.0 33 0.0 97.45 0.0 0.0 0.0 34 0.0 97.45 0.0 0.0 0.0 35 0.0 97.45 0.0 0.0 0.0 36 0.0 97.475 0.0 0.0 0.0 37 0.0 97.475 0.0 0.0 0.0 38 0.0 97.475 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGAA 25 3.6958358E-5 44.0 19 CTCCAGT 215 0.0 39.906975 44 AATGGAA 55 8.843199E-8 32.0 19 TCTGGAA 35 2.6843656E-4 31.428572 20 CCTGGAA 35 2.6843656E-4 31.428572 20 TTGGAAT 90 2.2919266E-10 26.888891 20 GCTGGAA 50 6.483462E-5 26.4 19 ATGGAAT 100 2.3646862E-11 26.4 20 CTGGAAT 145 0.0 25.793104 21 AGTGGAA 55 1.240733E-4 24.0 19 GTGGAAT 75 1.3407134E-6 23.466667 21 GGAACTC 385 0.0 22.285715 40 AATTCTC 400 0.0 22.0 24 AGGAACT 390 0.0 22.0 39 ACTCCAG 390 0.0 22.0 43 AACTCCA 390 0.0 22.0 42 TCTCGGG 400 0.0 22.0 27 TTCTCGG 400 0.0 22.0 26 GAACTCC 390 0.0 22.0 41 GAATTCT 400 0.0 22.0 23 >>END_MODULE Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806248 spots for SRR6892966.sra Written 3806248 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra Read 3806232 spots for SRR6892966.sra Written 3806232 spots for SRR6892966.sra SRR ids: ['SRR6892966.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cm632bvv SRR6892966.sra spots: 76124656 blocks: [[1, 3806232], [3806233, 7612464], [7612465, 11418696], [11418697, 15224928], [15224929, 19031160], [19031161, 22837392], [22837393, 26643624], [26643625, 30449856], [30449857, 34256088], [34256089, 38062320], [38062321, 41868552], [41868553, 45674784], [45674785, 49481016], [49481017, 53287248], [53287249, 57093480], [57093481, 60899712], [60899713, 64705944], [64705945, 68512176], [68512177, 72318408], [72318409, 76124656]] SRR6892966 file size 13183668 SRR6892966 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892966 SRR6892966_1.fastq Input file: SRR6892966_1.fastq trimmed: SRR6892966-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Dec 12 02:17:20 2024 >> started Thu Dec 12 02:20:48 2024 >> done (208.347s) 76124656 reads processed; of these: 10742 ( 0.01%) short reads filtered out after trimming by size control 21 ( 0.00%) empty reads filtered out after trimming by size control 76113893 (99.99%) reads available; of these: 2916079 ( 3.83%) trimmed reads available after processing 73197814 (96.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4710 0.01% 19 7392 0.01% 20 9017 0.01% 21 4650 0.01% 22 2673 0.00% 23 11885 0.02% 24 6067 0.01% 25 7180 0.01% 26 8754 0.01% 27 53144 0.07% 28 7077 0.01% 29 1698 0.00% 30 2415 0.00% 31 5250 0.01% 32 8080 0.01% 33 52720 0.07% 34 92638 0.12% 35 32635 0.04% 36 19390 0.03% 37 34245 0.04% 38 21239 0.03% 39 32671 0.04% 40 14839 0.02% 41 147549 0.19% 42 36497 0.05% 43 268300 0.35% 44 76726 0.10% 45 34261 0.05% 46 71068 0.09% 47 843156 1.11% 48 301653 0.40% 49 696500 0.92% 50 73197814 96.17% 76113893 reads passed initial QC criterion=sequence-density sequence-density=97.58 sequence-density-rank=1 fanout-score=48.17 fanout-score-rank=2 prefix-density=97.93 prefix-fanout=48.0 sequence=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGC criterion=fanout-score sequence-density=4.26 sequence-density-rank=2 fanout-score=88.63 fanout-score-rank=1 prefix-density=98.09 prefix-fanout=3.8 sequence=GAATTCTCGGGGGCCAAGGAACT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGC -o SRR6892966 - Input file: STDIN trimmed: SRR6892966-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Thu Dec 12 02:30:47 2024 >> started Thu Dec 12 02:37:14 2024 >> done (386.628s) 74560548 reads processed; of these: 2222564 ( 2.98%) short reads filtered out after trimming by size control 53614 ( 0.07%) empty reads filtered out after trimming by size control 72284370 (96.95%) reads available; of these: 71841742 (99.39%) trimmed reads available after processing 442628 ( 0.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 752873 1.04% 19 446869 0.62% 20 34953591 48.36% 21 35218913 48.72% 22 133204 0.18% 23 85374 0.12% 24 77675 0.11% 25 70416 0.10% 26 86664 0.12% 27 49272 0.07% 28 9420 0.01% 29 2152 0.00% 30 1396 0.00% 31 1146 0.00% 32 1447 0.00% 33 2198 0.00% 34 9132 0.01% 35 16378 0.02% 36 7514 0.01% 37 8143 0.01% 38 3268 0.00% 39 5402 0.01% 40 1917 0.00% 41 6768 0.01% 42 2790 0.00% 43 6497 0.01% 44 2905 0.00% 45 2663 0.00% 46 4001 0.01% 47 4648 0.01% 48 3367 0.00% 49 2054 0.00% 50 304313 0.42% criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=20 prefix-density=0.00 prefix-fanout=1.0 sequence=CATCGAGTAGACCTTGTTATTCTCGGGTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=6 fanout-score=42.67 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=23.3 sequence=TGGAATTCTCGTATGCCGTCTTCTGCTTGA Started job on | Dec 12 02:40:51 Started mapping on | Dec 12 02:40:51 Finished on | Dec 12 03:09:08 Mapping speed, Million of reads per hour | 156.64 Number of input reads | 73837715 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 64342573 Uniquely mapped reads % | 87.14% Average mapped length | 20.45 Number of splices: Total | 2768166 Number of splices: Annotated (sjdb) | 2724253 Number of splices: GT/AG | 2739599 Number of splices: GC/AG | 26804 Number of splices: AT/AC | 1625 Number of splices: Non-canonical | 138 Mismatch rate per base, % | 0.05% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 6695551 % of reads mapped to multiple loci | 9.07% Number of reads mapped to too many loci | 735660 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2799591 2799591 2799591 N_multimapping 6695551 6695551 6695551 N_noFeature 3521853 4073399 62692910 N_ambiguous 1225019 131877 5253 UnstrandedReadsAssigned:59595701 PositiveStrandReadsAssigned:60137297 NegativeStrandReadsAssigned:1644410 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=20 echo kmer=19 SRR6892966 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892966-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 73,837,715 reads, 62,241,080 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,293 rounds 52973 SRR6892966.ke.tsv 35125 SRR6892966.se.tsv 88098 total ==> SRR6892966.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 14.9285 0.366256 PNS24249 1928 1829 91.3192 1.15758 PNS24246 1044 945 14.9285 0.366256 PNS24248 1044 945 14.9285 0.366256 PNS24244 1471 1372 1499.9 25.3459 PNS24243 293 194 1 0.119509 KQK14069 1603 1504 4803.9 74.0538 KQK14071 474 375 358.557 22.1681 ==> SRR6892966.se.tsv <== BRADI_1g14170v3 4900 BRADI_1g53295v3 390 BRADI_1g59795v3 1117 BRADI_1g07683v3 1 BRADI_1g00485v3 43 BRADI_1g20270v3 2130 BRADI_1g74790v3 449 BRADI_1g09890v3 20 BRADI_1g77505v3 1037 BRADI_1g48960v3 1 SRR6892966 completed mapping pipeline successfully