Starting /dee2/code/volunteer_pipeline.sh SRR6892987 current disk space = 1550718259200 free memory = 1601775156 SRR6892987 SRAfilesize b8daf2ae32d3cee7144f83b948c49c8c SRR6892987.sra SRR6892987.sra file validated SRR6892987 is single end SRR6892987 is conventional basespace SRR6892987 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892987_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6555 31.0 31.0 34.0 30.0 34.0 2 31.68775 31.0 31.0 34.0 30.0 34.0 3 31.7255 31.0 31.0 34.0 30.0 34.0 4 35.46025 37.0 35.0 37.0 33.0 37.0 5 35.088 37.0 35.0 37.0 32.0 37.0 6 34.9455 37.0 35.0 37.0 32.0 37.0 7 35.00725 37.0 35.0 37.0 32.0 37.0 8 34.86625 36.0 35.0 37.0 31.0 37.0 9 36.52975 38.0 35.0 39.0 32.0 39.0 10 35.969 38.0 35.0 39.0 30.0 39.0 11 36.299 38.0 35.0 39.0 32.0 39.0 12 36.26025 38.0 35.0 39.0 31.0 39.0 13 36.364 38.0 35.0 39.0 32.0 39.0 14 37.53475 39.0 36.0 41.0 32.0 41.0 15 37.42825 39.0 36.0 40.0 32.0 41.0 16 37.3685 39.0 36.0 40.0 32.0 41.0 17 37.37925 39.0 36.0 40.0 32.0 41.0 18 37.23025 39.0 36.0 40.0 31.0 41.0 19 37.2835 39.0 36.0 40.0 31.0 41.0 20 37.09825 39.0 36.0 40.0 31.0 41.0 21 37.187 39.0 36.0 40.0 31.0 41.0 22 37.1425 39.0 36.0 40.0 31.0 41.0 23 37.13225 39.0 36.0 40.0 31.0 41.0 24 36.8615 39.0 36.0 40.0 31.0 41.0 25 36.69575 39.0 35.0 40.0 30.0 41.0 26 36.68975 39.0 35.0 40.0 30.0 41.0 27 36.68175 39.0 35.0 40.0 30.0 41.0 28 36.50675 38.0 35.0 40.0 30.0 41.0 29 36.35625 38.0 35.0 40.0 30.0 41.0 30 36.285 38.0 35.0 40.0 30.0 41.0 31 36.17525 38.0 35.0 40.0 29.0 41.0 32 35.80375 38.0 34.0 40.0 27.0 41.0 33 35.6535 38.0 34.0 40.0 27.0 41.0 34 35.55525 38.0 34.0 40.0 27.0 41.0 35 35.303 38.0 34.0 40.0 26.0 41.0 36 35.4115 38.0 34.0 40.0 27.0 41.0 37 35.625 38.0 34.0 40.0 27.0 41.0 38 35.7995 38.0 34.0 40.0 28.0 41.0 39 35.66275 38.0 34.0 40.0 27.0 41.0 40 35.713 38.0 34.0 40.0 27.0 41.0 41 35.70175 38.0 34.0 40.0 28.0 41.0 42 35.255 38.0 33.0 40.0 26.0 41.0 43 34.89175 38.0 33.0 40.0 25.0 41.0 44 34.45525 38.0 33.0 40.0 24.0 41.0 45 34.34975 38.0 33.0 40.0 23.0 41.0 46 34.065 37.0 33.0 40.0 23.0 41.0 47 33.19925 37.0 31.0 40.0 20.0 41.0 48 33.282 37.0 31.0 40.0 20.0 41.0 49 33.12525 36.0 31.0 40.0 20.0 41.0 50 32.8845 36.0 31.0 40.0 18.0 41.0 51 32.949 36.0 31.0 40.0 18.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 2.0 20 3.0 21 6.0 22 17.0 23 23.0 24 35.0 25 27.0 26 44.0 27 70.0 28 89.0 29 99.0 30 138.0 31 156.0 32 193.0 33 209.0 34 272.0 35 353.0 36 406.0 37 502.0 38 629.0 39 723.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.50612653163291 11.377844461115279 8.902225556389096 55.21380345086272 2 20.5 17.65 36.025 25.825 3 22.85 21.45 22.75 32.95 4 26.5 27.05 17.45 28.999999999999996 5 28.319919517102615 29.225352112676056 20.92555331991952 21.52917505030181 6 22.725 31.275 21.575 24.425 7 21.525 16.525000000000002 37.025000000000006 24.925 8 21.0 21.4 28.175 29.425 9 21.8 19.825 30.65 27.725 10 24.15 32.65 21.95 21.25 11 28.199999999999996 24.375 18.9 28.525 12 24.0 21.05 25.924999999999997 29.025000000000002 13 23.525 24.175 25.75 26.55 14 25.0 24.7 25.2 25.1 15 24.325 24.7 24.05 26.924999999999997 16 24.725 25.424999999999997 22.375 27.474999999999998 17 25.525 24.725 23.225 26.525 18 24.125 25.074999999999996 24.05 26.75 19 25.624999999999996 25.0 21.9 27.474999999999998 20 26.75 24.125 22.95 26.174999999999997 21 25.825 22.25 24.975 26.950000000000003 22 24.95 23.925 23.775 27.35 23 26.974999999999998 23.575 23.375 26.075 24 25.624999999999996 23.849999999999998 24.725 25.8 25 26.1 23.674999999999997 23.375 26.85 26 25.45 24.0 24.125 26.424999999999997 27 25.525 23.025000000000002 25.5 25.95 28 25.374999999999996 23.200000000000003 23.525 27.900000000000002 29 25.874999999999996 23.625 23.775 26.724999999999998 30 25.95 23.175 24.099999999999998 26.775 31 26.075 23.425 22.825 27.675 32 26.025 24.175 22.95 26.85 33 25.7 24.875 22.85 26.575 34 24.75 24.425 22.650000000000002 28.175 35 26.525 25.474999999999998 21.925 26.075 36 25.324999999999996 25.05 24.275 25.35 37 25.957446808510635 23.554443053817273 23.27909887359199 27.2090112640801 38 24.375 25.124999999999996 23.425 27.075 39 24.6 25.025 23.45 26.924999999999997 40 25.6 24.3 23.075000000000003 27.025 41 25.7 23.95 23.799999999999997 26.55 42 24.665825977301388 25.37200504413619 23.455233291298867 26.506935687263557 43 25.950329447541815 23.745565129244806 23.13735428281804 27.166751140395334 44 26.101349630761394 24.9554367201426 23.376623376623375 25.566590272472627 45 24.840601887273657 23.820453965825045 24.024483550114766 27.31446059678653 46 24.544287548138637 25.10911424903723 22.51604621309371 27.830551989730424 47 26.238532110091743 24.587155963302752 23.564875491480997 25.60943643512451 48 25.78974624546867 23.355774210253756 23.82185396167789 27.03262558259969 49 25.976054138469546 23.008849557522122 23.841749089016137 27.173347214992194 50 26.031258006661545 23.7253394824494 23.750960799385087 26.49244171150397 51 25.84467977811397 24.91174987392839 23.09631870902673 26.147251638930914 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 7.0 26 7.0 27 3.0 28 8.5 29 14.0 30 23.0 31 32.0 32 47.0 33 62.0 34 76.0 35 90.0 36 115.0 37 140.0 38 161.0 39 182.0 40 205.5 41 229.0 42 255.0 43 281.0 44 295.0 45 309.0 46 307.0 47 305.0 48 282.5 49 260.0 50 255.5 51 251.0 52 243.5 53 236.0 54 225.5 55 215.0 56 210.0 57 205.0 58 194.0 59 183.0 60 178.0 61 173.0 62 161.0 63 149.0 64 135.5 65 122.0 66 113.5 67 105.0 68 101.5 69 98.0 70 88.5 71 79.0 72 74.0 73 69.0 74 66.0 75 55.0 76 47.0 77 42.5 78 38.0 79 28.5 80 19.0 81 15.0 82 11.0 83 9.5 84 8.0 85 5.5 86 3.0 87 3.0 88 3.0 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.6 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.125 38 0.0 39 0.0 40 0.0 41 0.0 42 0.8750000000000001 43 1.35 44 1.825 45 1.975 46 2.625 47 4.625 48 3.45 49 3.95 50 2.4250000000000003 51 0.8500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.6051437216338881 1.2 3 0.12607160867372666 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576307 spots for SRR6892987.sra Written 576307 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra Read 576289 spots for SRR6892987.sra Written 576289 spots for SRR6892987.sra SRR ids: ['SRR6892987.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_br_5o37y SRR6892987.sra spots: 11525798 blocks: [[1, 576289], [576290, 1152578], [1152579, 1728867], [1728868, 2305156], [2305157, 2881445], [2881446, 3457734], [3457735, 4034023], [4034024, 4610312], [4610313, 5186601], [5186602, 5762890], [5762891, 6339179], [6339180, 6915468], [6915469, 7491757], [7491758, 8068046], [8068047, 8644335], [8644336, 9220624], [9220625, 9796913], [9796914, 10373202], [10373203, 10949491], [10949492, 11525798]] SRR6892987 file size 2009389 SRR6892987 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892987 SRR6892987_1.fastq Input file: SRR6892987_1.fastq trimmed: SRR6892987-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:57:16 2024 >> started Fri Dec 6 13:57:23 2024 >> done (7.577s) 11525798 reads processed; of these: 3697 ( 0.03%) short reads filtered out after trimming by size control 1483 ( 0.01%) empty reads filtered out after trimming by size control 11520618 (99.96%) reads available; of these: 319057 ( 2.77%) trimmed reads available after processing 11201561 (97.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 186 0.00% 19 159 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 8 0.00% 28 12 0.00% 29 16 0.00% 30 15 0.00% 31 26 0.00% 32 43 0.00% 33 43 0.00% 34 187 0.00% 35 395 0.00% 36 129 0.00% 37 166 0.00% 38 199 0.00% 39 539 0.00% 40 740 0.01% 41 1771 0.02% 42 991 0.01% 43 1281 0.01% 44 1980 0.02% 45 3137 0.03% 46 5365 0.05% 47 10123 0.09% 48 21318 0.19% 49 54250 0.47% 50 215961 1.87% 51 11201561 97.23% 11520618 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=10.04 fanout-score-rank=14 prefix-density=0.33 prefix-fanout=3.8 sequence=GAAGAAGAAGAAACAACTCCGGCCATGGCGGGCATCATCCACAAGATCGAGGAGAAGCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=162.52 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=18.4 sequence=CCGCCGCCGCCA Started job on | Dec 06 13:57:45 Started mapping on | Dec 06 13:57:45 Finished on | Dec 06 13:57:59 Mapping speed, Million of reads per hour | 2962.44 Number of input reads | 11520618 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 10411241 Uniquely mapped reads % | 90.37% Average mapped length | 50.85 Number of splices: Total | 1604909 Number of splices: Annotated (sjdb) | 1535476 Number of splices: GT/AG | 1583593 Number of splices: GC/AG | 19590 Number of splices: AT/AC | 822 Number of splices: Non-canonical | 904 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323361 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 709499 % of reads mapped to too many loci | 6.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 786016 786016 786016 N_multimapping 323361 323361 323361 N_noFeature 379748 5223946 5432322 N_ambiguous 145136 5678 5587 UnstrandedReadsAssigned:9886357 PositiveStrandReadsAssigned:5181617 NegativeStrandReadsAssigned:4973332 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892987 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892987-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,520,618 reads, 9,893,028 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR6892987.ke.tsv 35125 SRR6892987.se.tsv 88098 total ==> SRR6892987.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 59.0207 11.8895 PNS24247 1044 945 10.0799 1.79849 PNS24249 1928 1829 131.559 12.128 PNS24246 1044 945 10.0799 1.79849 PNS24248 1044 945 10.0799 1.79849 PNS24244 1471 1372 8.18027 1.0053 PNS24243 293 194 3 2.60737 KQK14069 1603 1504 1387.47 155.546 KQK14071 474 375 443.435 199.38 ==> SRR6892987.se.tsv <== BRADI_1g14170v3 2048 BRADI_1g53295v3 13 BRADI_1g59795v3 61 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 349 BRADI_1g74790v3 403 BRADI_1g09890v3 2 BRADI_1g77505v3 73 BRADI_1g48960v3 0 SRR6892987 completed mapping pipeline successfully