Starting /dee2/code/volunteer_pipeline.sh SRR6892988 current disk space = 1550707642368 free memory = 1600746456 SRR6892988 SRAfilesize d23aca0eefcca48403b9c021aa262179 SRR6892988.sra SRR6892988.sra file validated SRR6892988 is single end SRR6892988 is conventional basespace SRR6892988 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892988_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65975 31.0 31.0 34.0 30.0 34.0 2 31.68575 31.0 31.0 34.0 30.0 34.0 3 31.751 31.0 31.0 34.0 30.0 34.0 4 35.42425 37.0 35.0 37.0 33.0 37.0 5 34.991 37.0 35.0 37.0 32.0 37.0 6 34.728 36.0 35.0 37.0 30.0 37.0 7 34.889 36.0 35.0 37.0 32.0 37.0 8 34.796 35.0 35.0 37.0 31.0 37.0 9 36.44575 38.0 35.0 39.0 32.0 39.0 10 35.829 37.0 35.0 39.0 30.0 39.0 11 36.264 38.0 35.0 39.0 32.0 39.0 12 36.1365 38.0 35.0 39.0 30.0 39.0 13 36.339 38.0 35.0 39.0 32.0 39.0 14 37.44275 39.0 36.0 41.0 32.0 41.0 15 37.419 39.0 36.0 41.0 32.0 41.0 16 37.3895 39.0 36.0 40.0 32.0 41.0 17 37.5265 39.0 36.0 41.0 32.0 41.0 18 37.28525 39.0 36.0 41.0 31.0 41.0 19 37.28175 39.0 36.0 41.0 31.0 41.0 20 37.27125 39.0 36.0 40.0 31.0 41.0 21 37.00725 39.0 36.0 40.0 31.0 41.0 22 37.02975 39.0 36.0 40.0 31.0 41.0 23 36.93675 39.0 36.0 40.0 31.0 41.0 24 36.802 39.0 36.0 40.0 30.0 41.0 25 36.7255 39.0 35.0 40.0 30.0 41.0 26 36.61675 39.0 35.0 40.0 30.0 41.0 27 36.60875 38.0 35.0 40.0 30.0 41.0 28 36.5205 38.0 35.0 40.0 30.0 41.0 29 36.25225 38.0 35.0 40.0 30.0 41.0 30 36.14725 38.0 35.0 40.0 29.0 41.0 31 35.9765 38.0 34.0 40.0 29.0 41.0 32 35.58375 38.0 34.0 40.0 27.0 41.0 33 35.463 38.0 34.0 40.0 27.0 41.0 34 35.34725 38.0 34.0 40.0 26.0 41.0 35 35.269 38.0 33.0 40.0 26.0 41.0 36 35.165 38.0 33.0 40.0 26.0 41.0 37 35.39275 38.0 33.0 40.0 27.0 41.0 38 35.6115 38.0 34.0 40.0 27.0 41.0 39 35.50025 38.0 34.0 40.0 27.0 41.0 40 35.623 38.0 34.0 40.0 28.0 41.0 41 35.4635 38.0 33.0 40.0 27.0 41.0 42 34.87 38.0 33.0 40.0 25.0 41.0 43 34.41575 38.0 33.0 40.0 24.0 41.0 44 34.053 37.0 33.0 40.0 23.0 41.0 45 33.729 37.0 32.0 40.0 22.0 41.0 46 33.42375 37.0 32.0 40.0 20.0 41.0 47 32.3465 37.0 30.0 40.0 14.0 41.0 48 32.312 36.0 31.0 40.0 14.0 41.0 49 32.3495 36.0 30.0 40.0 17.0 41.0 50 32.23975 36.0 30.0 39.0 15.0 41.0 51 32.51575 36.0 30.0 39.0 15.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 4.0 19 3.0 20 3.0 21 9.0 22 13.0 23 21.0 24 20.0 25 40.0 26 53.0 27 70.0 28 87.0 29 129.0 30 143.0 31 170.0 32 215.0 33 247.0 34 303.0 35 318.0 36 388.0 37 428.0 38 608.0 39 726.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.573573573573572 10.285285285285285 9.234234234234235 56.906906906906904 2 21.875 18.15 33.45 26.525 3 21.0 21.2 22.825 34.975 4 28.125 26.6 16.625 28.65 5 28.43112566104256 28.128934777134223 21.354822462855704 22.085117098967512 6 24.9 31.8 20.325 22.975 7 21.725 16.975 36.225 25.074999999999996 8 21.6 20.75 28.225 29.425 9 21.45 20.150000000000002 30.225 28.175 10 22.625 33.0 22.400000000000002 21.975 11 28.65 23.599999999999998 19.325 28.425 12 22.975 22.425 25.05 29.549999999999997 13 24.7 24.075 24.349999999999998 26.875 14 24.05 23.45 24.875 27.625 15 23.400000000000002 24.9 24.175 27.525 16 25.05 23.7 23.425 27.825 17 27.275 23.150000000000002 23.150000000000002 26.424999999999997 18 24.0 24.65 24.05 27.3 19 26.875 23.674999999999997 22.95 26.5 20 27.05 24.425 22.6 25.924999999999997 21 25.924999999999997 23.875 23.474999999999998 26.724999999999998 22 26.700000000000003 22.225 23.175 27.900000000000002 23 26.35 24.325 24.175 25.15 24 25.25 24.5 23.125 27.125 25 25.15 23.65 22.75 28.449999999999996 26 25.55 23.95 24.05 26.450000000000003 27 24.925 23.724999999999998 24.725 26.625 28 25.2 23.75 23.5 27.55 29 24.625 23.125 24.45 27.800000000000004 30 26.625 23.05 23.775 26.55 31 25.45 24.15 22.650000000000002 27.750000000000004 32 25.900000000000002 25.424999999999997 23.0 25.674999999999997 33 25.724999999999998 24.8 23.225 26.25 34 26.05 23.45 23.05 27.450000000000003 35 27.275 23.200000000000003 23.549999999999997 25.974999999999998 36 25.35 24.525 23.775 26.35 37 25.6198347107438 23.716503881793138 22.414224893563738 28.249436513899322 38 26.325 23.95 22.575 27.150000000000002 39 25.15 24.45 23.549999999999997 26.85 40 26.25 23.45 22.575 27.725 41 26.25 23.45 23.375 26.924999999999997 42 25.958627648839556 23.662966700302725 23.183652875882945 27.194752774974774 43 26.323828920570264 22.734215885947044 23.421588594704684 27.520366598778008 44 26.536885245901637 23.89856557377049 23.335040983606557 26.229508196721312 45 25.32133676092545 25.34704370179949 23.470437017994858 25.861182519280206 46 25.038920601971977 23.09289050337312 23.482096523092892 28.386092371562015 47 26.775226908702614 23.46502936465563 23.571809930592632 26.18793379604912 48 25.27617043661231 23.961073119410838 24.487112046291426 26.275644397685426 49 25.841505433342167 23.24410283593957 23.562152133580703 27.352239597137558 50 25.95656670113754 24.04343329886246 23.190279214064116 26.809720785935887 51 25.031541761291955 25.359576078728235 22.962402220539996 26.64647993943982 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 3.0 24 5.0 25 7.0 26 8.0 27 7.0 28 15.5 29 24.0 30 29.5 31 35.0 32 49.0 33 63.0 34 69.5 35 76.0 36 107.0 37 138.0 38 147.5 39 157.0 40 185.5 41 214.0 42 236.0 43 258.0 44 281.5 45 305.0 46 292.5 47 280.0 48 281.0 49 282.0 50 271.0 51 260.0 52 247.0 53 234.0 54 233.5 55 233.0 56 215.0 57 197.0 58 187.5 59 178.0 60 172.0 61 166.0 62 162.0 63 158.0 64 146.0 65 134.0 66 137.0 67 140.0 68 125.0 69 110.0 70 103.0 71 96.0 72 74.0 73 52.0 74 54.5 75 52.5 76 48.0 77 41.5 78 35.0 79 28.5 80 22.0 81 17.0 82 12.0 83 9.5 84 7.0 85 6.0 86 5.0 87 3.5 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.7250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.17500000000000002 38 0.0 39 0.0 40 0.0 41 0.0 42 0.8999999999999999 43 1.7999999999999998 44 2.4 45 2.75 46 3.65 47 6.35 48 4.95 49 5.675 50 3.3000000000000003 51 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608094 spots for SRR6892988.sra Written 608094 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra Read 608077 spots for SRR6892988.sra Written 608077 spots for SRR6892988.sra SRR ids: ['SRR6892988.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b5xvgb9f SRR6892988.sra spots: 12161557 blocks: [[1, 608077], [608078, 1216154], [1216155, 1824231], [1824232, 2432308], [2432309, 3040385], [3040386, 3648462], [3648463, 4256539], [4256540, 4864616], [4864617, 5472693], [5472694, 6080770], [6080771, 6688847], [6688848, 7296924], [7296925, 7905001], [7905002, 8513078], [8513079, 9121155], [9121156, 9729232], [9729233, 10337309], [10337310, 10945386], [10945387, 11553463], [11553464, 12161557]] SRR6892988 file size 2120820 SRR6892988 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892988 SRR6892988_1.fastq Input file: SRR6892988_1.fastq trimmed: SRR6892988-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:57:44 2024 >> started Fri Dec 6 13:57:53 2024 >> done (9.378s) 12161557 reads processed; of these: 3238 ( 0.03%) short reads filtered out after trimming by size control 1911 ( 0.02%) empty reads filtered out after trimming by size control 12156408 (99.96%) reads available; of these: 336289 ( 2.77%) trimmed reads available after processing 11820119 (97.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 153 0.00% 19 131 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 7 0.00% 28 16 0.00% 29 12 0.00% 30 25 0.00% 31 26 0.00% 32 38 0.00% 33 60 0.00% 34 212 0.00% 35 452 0.00% 36 104 0.00% 37 162 0.00% 38 203 0.00% 39 581 0.00% 40 744 0.01% 41 1815 0.01% 42 1010 0.01% 43 1233 0.01% 44 1952 0.02% 45 3182 0.03% 46 5688 0.05% 47 10754 0.09% 48 21948 0.18% 49 57413 0.47% 50 228356 1.88% 51 11820119 97.23% 12156408 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=9.82 fanout-score-rank=11 prefix-density=0.35 prefix-fanout=3.7 sequence=GAAGAAGAAGAAACAACTCCGGCCATGGCGGGCATCATCCACAAGATCGAGGAGAAGCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=8 fanout-score=167.26 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=19.4 sequence=CCGCCGCCGCCA Started job on | Dec 06 13:58:04 Started mapping on | Dec 06 13:58:05 Finished on | Dec 06 13:58:20 Mapping speed, Million of reads per hour | 2917.54 Number of input reads | 12156408 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 11391498 Uniquely mapped reads % | 93.71% Average mapped length | 50.86 Number of splices: Total | 1717785 Number of splices: Annotated (sjdb) | 1643911 Number of splices: GT/AG | 1695397 Number of splices: GC/AG | 20659 Number of splices: AT/AC | 799 Number of splices: Non-canonical | 930 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313265 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 390276 % of reads mapped to too many loci | 3.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451645 451645 451645 N_multimapping 313265 313265 313265 N_noFeature 450684 5742790 5946795 N_ambiguous 164684 6683 6269 UnstrandedReadsAssigned:10776130 PositiveStrandReadsAssigned:5642025 NegativeStrandReadsAssigned:5438434 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892988 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892988-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,156,408 reads, 10,717,820 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52973 SRR6892988.ke.tsv 35125 SRR6892988.se.tsv 88098 total ==> SRR6892988.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 33.9003 5.64313 PNS24249 1928 1829 149.203 12.8325 PNS24246 1044 945 33.9003 5.64313 PNS24248 1044 945 33.9003 5.64313 PNS24244 1471 1372 6.09606 0.698946 PNS24243 293 194 10 8.10861 KQK14069 1603 1504 1352.15 141.424 KQK14071 474 375 513.706 215.492 ==> SRR6892988.se.tsv <== BRADI_1g14170v3 2013 BRADI_1g53295v3 15 BRADI_1g59795v3 57 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 480 BRADI_1g74790v3 372 BRADI_1g09890v3 4 BRADI_1g77505v3 52 BRADI_1g48960v3 0 SRR6892988 completed mapping pipeline successfully