Starting /dee2/code/volunteer_pipeline.sh SRR6892989 current disk space = 1550686629888 free memory = 1600686500 SRR6892989 SRAfilesize d90e0480d6650390d6d6d8bc7b908955 SRR6892989.sra SRR6892989.sra file validated SRR6892989 is single end SRR6892989 is conventional basespace SRR6892989 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892989_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6285 31.0 31.0 34.0 30.0 34.0 2 31.639 31.0 31.0 34.0 30.0 34.0 3 31.74775 31.0 31.0 34.0 30.0 34.0 4 35.42325 37.0 35.0 37.0 33.0 37.0 5 34.932 37.0 35.0 37.0 32.0 37.0 6 34.77575 36.0 35.0 37.0 31.0 37.0 7 35.037 37.0 35.0 37.0 32.0 37.0 8 34.9865 36.0 35.0 37.0 32.0 37.0 9 36.46 38.0 35.0 39.0 32.0 39.0 10 35.87325 38.0 35.0 39.0 30.0 39.0 11 36.333 38.0 35.0 39.0 32.0 39.0 12 36.26525 38.0 35.0 39.0 32.0 39.0 13 36.37725 38.0 35.0 39.0 32.0 39.0 14 37.5025 39.0 36.0 41.0 32.0 41.0 15 37.39725 39.0 36.0 41.0 32.0 41.0 16 37.42625 39.0 36.0 41.0 32.0 41.0 17 37.51425 39.0 36.0 41.0 32.0 41.0 18 37.28575 39.0 36.0 40.0 32.0 41.0 19 37.31 39.0 36.0 40.0 31.0 41.0 20 37.22625 39.0 36.0 40.0 31.0 41.0 21 37.12775 39.0 36.0 40.0 31.0 41.0 22 37.0795 39.0 36.0 40.0 31.0 41.0 23 37.08275 39.0 36.0 40.0 31.0 41.0 24 36.8665 39.0 36.0 40.0 30.0 41.0 25 36.81025 38.0 36.0 40.0 30.0 41.0 26 36.863 39.0 36.0 40.0 30.0 41.0 27 36.64275 39.0 36.0 40.0 30.0 41.0 28 36.52425 38.0 35.0 40.0 30.0 41.0 29 36.381 38.0 35.0 40.0 30.0 41.0 30 36.3505 38.0 35.0 40.0 30.0 41.0 31 36.10825 38.0 35.0 40.0 29.0 41.0 32 35.6455 38.0 34.0 40.0 27.0 41.0 33 35.716 38.0 34.0 40.0 27.0 41.0 34 35.55125 38.0 34.0 40.0 27.0 41.0 35 35.31425 38.0 34.0 40.0 27.0 41.0 36 35.311 38.0 33.0 40.0 27.0 41.0 37 35.476 38.0 34.0 40.0 27.0 41.0 38 35.71675 38.0 34.0 40.0 27.0 41.0 39 35.5915 38.0 34.0 40.0 27.0 41.0 40 35.65125 38.0 34.0 40.0 27.0 41.0 41 35.68725 38.0 34.0 40.0 27.0 41.0 42 35.0825 38.0 33.0 40.0 26.0 41.0 43 34.5305 38.0 33.0 40.0 24.0 41.0 44 34.1475 37.0 33.0 40.0 23.0 41.0 45 33.89725 37.0 32.0 40.0 23.0 41.0 46 33.46375 37.0 32.0 40.0 21.0 41.0 47 32.57375 37.0 31.0 40.0 14.0 41.0 48 32.57225 36.0 31.0 40.0 15.0 41.0 49 32.533 36.0 31.0 40.0 15.0 41.0 50 32.493 36.0 31.0 39.0 15.0 41.0 51 32.633 36.0 30.0 39.0 16.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 5.0 21 7.0 22 8.0 23 30.0 24 48.0 25 25.0 26 56.0 27 64.0 28 81.0 29 123.0 30 126.0 31 170.0 32 215.0 33 215.0 34 254.0 35 353.0 36 392.0 37 474.0 38 620.0 39 731.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.2012012012012 11.586586586586586 9.784784784784785 52.42742742742743 2 22.75 17.724999999999998 34.4 25.124999999999996 3 22.25 21.425 23.05 33.275 4 28.775000000000002 24.95 18.125 28.15 5 28.24331145885916 29.530540131246845 20.82281675921252 21.403331650681473 6 22.275 31.525 22.075 24.125 7 21.975 17.424999999999997 37.275000000000006 23.325000000000003 8 22.85 20.325 27.925 28.9 9 21.625 20.45 30.45 27.474999999999998 10 22.900000000000002 32.725 23.325000000000003 21.05 11 29.2 23.325000000000003 18.875 28.599999999999998 12 25.7 20.925 24.025 29.349999999999998 13 23.1 25.724999999999998 25.3 25.874999999999996 14 25.3 24.6 23.7 26.400000000000002 15 24.875 25.3 23.1 26.724999999999998 16 27.575 23.775 21.925 26.724999999999998 17 26.474999999999998 24.5 23.825 25.2 18 25.674999999999997 23.95 24.375 26.0 19 27.775 22.575 22.1 27.55 20 25.624999999999996 24.95 22.5 26.924999999999997 21 26.724999999999998 25.374999999999996 22.625 25.275 22 27.150000000000002 24.3 22.475 26.075 23 24.975 23.575 23.974999999999998 27.474999999999998 24 26.025 23.3 22.45 28.225 25 25.75 23.724999999999998 23.3 27.224999999999998 26 27.075 23.525 24.224999999999998 25.174999999999997 27 25.074999999999996 24.3 23.75 26.875 28 27.150000000000002 22.55 23.775 26.525 29 26.75 23.150000000000002 22.75 27.35 30 25.974999999999998 23.925 23.425 26.674999999999997 31 26.200000000000003 23.425 23.025000000000002 27.35 32 26.150000000000002 24.425 23.075000000000003 26.35 33 24.625 24.975 24.625 25.775 34 26.75 22.475 23.375 27.400000000000002 35 25.174999999999997 23.375 24.325 27.125 36 26.0 22.8 23.799999999999997 27.400000000000002 37 26.39097744360902 23.533834586466167 22.932330827067666 27.142857142857142 38 27.224999999999998 23.275000000000002 23.775 25.724999999999998 39 26.224999999999998 23.400000000000002 22.75 27.625 40 25.85 23.65 22.85 27.650000000000002 41 27.3 23.5 22.575 26.625 42 25.808897876643073 23.58442871587462 23.660262891809907 26.946410515672397 43 25.133962745598364 22.81194182189334 24.368461342179128 27.685634090329163 44 27.41273100616016 22.741273100616016 24.229979466119097 25.61601642710472 45 24.94214451015685 24.29930573412188 23.862175366418104 26.896374389303162 46 26.278888600363544 23.240716696961826 22.825240197351338 27.655154505323292 47 27.013333333333335 23.36 23.466666666666665 26.16 48 24.68487394957983 23.81827731092437 24.65861344537815 26.838235294117645 49 24.814814814814813 23.43915343915344 24.17989417989418 27.566137566137566 50 26.31714876033058 23.34710743801653 22.83057851239669 27.5051652892562 51 26.3317344105024 23.630396364554407 23.52941176470588 26.50845746023731 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 2.0 25 4.0 26 7.0 27 8.0 28 17.0 29 26.0 30 32.0 31 38.0 32 42.0 33 46.0 34 71.0 35 96.0 36 119.5 37 143.0 38 163.5 39 184.0 40 200.5 41 217.0 42 238.0 43 259.0 44 279.5 45 300.0 46 277.5 47 255.0 48 259.5 49 264.0 50 251.5 51 239.0 52 238.5 53 238.0 54 223.0 55 208.0 56 204.0 57 200.0 58 195.0 59 190.0 60 181.5 61 173.0 62 160.5 63 148.0 64 162.5 65 177.0 66 154.0 67 131.0 68 117.5 69 104.0 70 97.5 71 91.0 72 87.5 73 84.0 74 68.5 75 46.5 76 40.0 77 33.0 78 26.0 79 23.0 80 20.0 81 16.5 82 13.0 83 12.0 84 11.0 85 7.5 86 4.0 87 2.5 88 1.0 89 1.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.95 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.25 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0999999999999999 43 2.025 44 2.6 45 2.775 46 3.7249999999999996 47 6.25 48 4.8 49 5.5 50 3.2 51 0.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686523 spots for SRR6892989.sra Written 686523 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra Read 686510 spots for SRR6892989.sra Written 686510 spots for SRR6892989.sra SRR ids: ['SRR6892989.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i6dgwtkl SRR6892989.sra spots: 13730213 blocks: [[1, 686510], [686511, 1373020], [1373021, 2059530], [2059531, 2746040], [2746041, 3432550], [3432551, 4119060], [4119061, 4805570], [4805571, 5492080], [5492081, 6178590], [6178591, 6865100], [6865101, 7551610], [7551611, 8238120], [8238121, 8924630], [8924631, 9611140], [9611141, 10297650], [10297651, 10984160], [10984161, 11670670], [11670671, 12357180], [12357181, 13043690], [13043691, 13730213]] SRR6892989 file size 2395776 SRR6892989 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892989 SRR6892989_1.fastq Input file: SRR6892989_1.fastq trimmed: SRR6892989-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:58:28 2024 >> started Fri Dec 6 13:58:36 2024 >> done (7.501s) 13730213 reads processed; of these: 2456 ( 0.02%) short reads filtered out after trimming by size control 4376 ( 0.03%) empty reads filtered out after trimming by size control 13723381 (99.95%) reads available; of these: 374673 ( 2.73%) trimmed reads available after processing 13348708 (97.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 95 0.00% 19 101 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 6 0.00% 26 10 0.00% 27 6 0.00% 28 17 0.00% 29 25 0.00% 30 30 0.00% 31 37 0.00% 32 45 0.00% 33 61 0.00% 34 256 0.00% 35 484 0.00% 36 111 0.00% 37 148 0.00% 38 220 0.00% 39 648 0.00% 40 841 0.01% 41 1917 0.01% 42 1080 0.01% 43 1411 0.01% 44 2229 0.02% 45 3479 0.03% 46 6382 0.05% 47 11740 0.09% 48 24400 0.18% 49 63800 0.46% 50 255090 1.86% 51 13348708 97.27% 13723381 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=7 prefix-density=0.15 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=135.57 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=19.2 sequence=GCCGCCGCCGCC Started job on | Dec 06 13:58:51 Started mapping on | Dec 06 13:58:51 Finished on | Dec 06 13:59:08 Mapping speed, Million of reads per hour | 2906.13 Number of input reads | 13723381 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 12951210 Uniquely mapped reads % | 94.37% Average mapped length | 50.85 Number of splices: Total | 2061601 Number of splices: Annotated (sjdb) | 1983971 Number of splices: GT/AG | 2035997 Number of splices: GC/AG | 23496 Number of splices: AT/AC | 1076 Number of splices: Non-canonical | 1032 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357974 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 355718 % of reads mapped to too many loci | 2.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414197 414197 414197 N_multimapping 357974 357974 357974 N_noFeature 441477 6556743 6670425 N_ambiguous 184578 11441 9110 UnstrandedReadsAssigned:12325155 PositiveStrandReadsAssigned:6383026 NegativeStrandReadsAssigned:6271675 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892989 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892989-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,723,381 reads, 12,298,874 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52973 SRR6892989.ke.tsv 35125 SRR6892989.se.tsv 88098 total ==> SRR6892989.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 14.9575 2.04526 PNS24249 1928 1829 153.98 10.8786 PNS24246 1044 945 14.9575 2.04526 PNS24248 1044 945 14.9575 2.04526 PNS24244 1471 1372 12.1474 1.14407 PNS24243 293 194 5 3.33034 KQK14069 1603 1504 1476.42 126.848 KQK14071 474 375 862.331 297.142 ==> SRR6892989.se.tsv <== BRADI_1g14170v3 2700 BRADI_1g53295v3 24 BRADI_1g59795v3 149 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 1197 BRADI_1g74790v3 138 BRADI_1g09890v3 2 BRADI_1g77505v3 175 BRADI_1g48960v3 0 SRR6892989 completed mapping pipeline successfully