Starting /dee2/code/volunteer_pipeline.sh SRR6892990 current disk space = 1550666739712 free memory = 1598984544 SRR6892990 SRAfilesize 0dbc6345ec8c202892c1ce148dd1068e SRR6892990.sra SRR6892990.sra file validated SRR6892990 is single end SRR6892990 is conventional basespace SRR6892990 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892990_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69825 31.0 31.0 34.0 30.0 34.0 2 31.63525 31.0 31.0 34.0 30.0 34.0 3 31.75425 31.0 31.0 34.0 30.0 34.0 4 35.45525 37.0 35.0 37.0 33.0 37.0 5 34.9575 37.0 35.0 37.0 32.0 37.0 6 34.7655 37.0 35.0 37.0 30.0 37.0 7 34.82025 36.0 35.0 37.0 31.0 37.0 8 34.82325 35.0 35.0 37.0 32.0 37.0 9 36.39925 38.0 35.0 39.0 32.0 39.0 10 35.802 37.0 35.0 39.0 30.0 39.0 11 36.295 38.0 35.0 39.0 32.0 39.0 12 36.146 38.0 35.0 39.0 31.0 39.0 13 36.26925 38.0 35.0 39.0 32.0 39.0 14 37.45625 39.0 36.0 41.0 32.0 41.0 15 37.34375 39.0 36.0 41.0 32.0 41.0 16 37.42525 39.0 36.0 41.0 32.0 41.0 17 37.3355 39.0 36.0 41.0 32.0 41.0 18 37.2565 39.0 36.0 41.0 31.0 41.0 19 37.25875 39.0 36.0 40.0 31.0 41.0 20 37.24875 39.0 36.0 40.0 31.0 41.0 21 37.0655 39.0 36.0 40.0 31.0 41.0 22 37.1055 39.0 36.0 40.0 31.0 41.0 23 37.10975 39.0 36.0 40.0 31.0 41.0 24 36.84 39.0 36.0 40.0 30.0 41.0 25 36.617 38.0 35.0 40.0 30.0 41.0 26 36.733 39.0 36.0 40.0 30.0 41.0 27 36.58775 39.0 35.0 40.0 30.0 41.0 28 36.4325 38.0 35.0 40.0 30.0 41.0 29 36.29975 38.0 35.0 40.0 30.0 41.0 30 36.16425 38.0 35.0 40.0 29.0 41.0 31 35.9415 38.0 34.0 40.0 29.0 41.0 32 35.60975 38.0 34.0 40.0 27.0 41.0 33 35.51475 38.0 34.0 40.0 27.0 41.0 34 35.398 38.0 33.0 40.0 27.0 41.0 35 35.31475 38.0 33.0 40.0 26.0 41.0 36 35.13875 38.0 33.0 40.0 26.0 41.0 37 35.3915 38.0 34.0 40.0 27.0 41.0 38 35.4525 38.0 34.0 40.0 26.0 41.0 39 35.4875 38.0 34.0 40.0 27.0 41.0 40 35.3885 38.0 33.0 40.0 26.0 41.0 41 35.326 38.0 33.0 40.0 26.0 41.0 42 34.868 38.0 33.0 40.0 25.0 41.0 43 34.2805 38.0 33.0 40.0 23.0 41.0 44 33.925 37.0 32.0 40.0 23.0 41.0 45 33.68875 37.0 32.0 40.0 23.0 41.0 46 33.36775 37.0 32.0 40.0 20.0 41.0 47 32.116 36.0 30.0 40.0 10.0 41.0 48 32.1215 36.0 30.0 40.0 12.0 41.0 49 32.0205 36.0 31.0 40.0 12.0 41.0 50 31.8755 35.0 29.0 39.0 13.0 41.0 51 32.14375 35.0 29.0 39.0 15.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 7.0 20 6.0 21 5.0 22 15.0 23 22.0 24 47.0 25 35.0 26 57.0 27 66.0 28 74.0 29 118.0 30 151.0 31 201.0 32 202.0 33 248.0 34 265.0 35 315.0 36 406.0 37 443.0 38 597.0 39 718.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.189094547273637 10.755377688844423 9.854927463731865 51.20060030015008 2 23.25 17.125 33.575 26.05 3 23.35 21.65 22.225 32.775 4 29.075 24.9 17.825 28.199999999999996 5 28.806272129489123 28.7556904400607 20.232675771370765 22.205361659079415 6 23.45 32.5 20.125 23.925 7 22.7 16.650000000000002 37.0 23.65 8 23.125 21.125 27.425 28.325 9 20.875 20.349999999999998 30.825000000000003 27.950000000000003 10 24.7 31.924999999999997 23.325000000000003 20.05 11 29.225 23.075000000000003 18.475 29.225 12 24.625 20.4 25.900000000000002 29.075 13 25.3 24.05 25.424999999999997 25.224999999999998 14 24.875 23.925 25.525 25.674999999999997 15 24.224999999999998 25.124999999999996 23.7 26.950000000000003 16 25.75 24.2 22.6 27.450000000000003 17 27.875 24.2 22.475 25.45 18 25.874999999999996 23.575 23.674999999999997 26.875 19 26.825 23.625 23.575 25.974999999999998 20 26.700000000000003 23.599999999999998 22.05 27.650000000000002 21 25.074999999999996 24.45 23.9 26.575 22 25.15 23.75 23.799999999999997 27.3 23 27.35 24.099999999999998 22.675 25.874999999999996 24 27.075 23.3 24.375 25.25 25 27.224999999999998 22.900000000000002 22.575 27.3 26 26.25 23.75 23.599999999999998 26.400000000000002 27 24.85 24.9 23.425 26.825 28 27.1 23.474999999999998 22.1 27.325 29 25.8 24.75 22.625 26.825 30 25.424999999999997 24.3 24.025 26.25 31 26.450000000000003 22.400000000000002 22.875 28.275 32 27.775 23.150000000000002 22.525000000000002 26.55 33 27.450000000000003 22.275 23.599999999999998 26.674999999999997 34 27.975 24.85 21.55 25.624999999999996 35 26.35 24.075 23.075000000000003 26.5 36 25.95 23.7 23.599999999999998 26.75 37 26.877668927405175 23.561919115800052 23.08465209746295 26.475759859331827 38 26.825 22.925 23.775 26.474999999999998 39 25.874999999999996 22.6 24.275 27.250000000000004 40 26.55 23.05 23.05 27.35 41 27.474999999999998 22.825 23.150000000000002 26.55 42 25.329614604462474 23.427991886409735 23.52941176470588 27.712981744421906 43 27.01664532650448 22.56081946222791 22.202304737516005 28.220230473751602 44 25.953608247422682 23.8659793814433 22.5 27.68041237113402 45 25.1744636857069 23.28767123287671 24.140604807443783 27.397260273972602 46 26.579634464751955 23.289817232375977 21.93211488250653 28.198433420365536 47 26.607239330091843 22.98757428417072 23.36574824419233 27.039438141545112 48 26.00742311770944 24.072110286320257 22.879109225874867 27.041357370095444 49 25.91798445456982 23.827392120075046 22.99651567944251 27.258107745912625 50 27.28923476005188 22.77561608300908 23.268482490272373 26.666666666666668 51 26.361104076981512 22.81590276019245 23.70220308938972 27.120790073436314 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 3.0 26 9.0 27 13.0 28 12.5 29 12.0 30 23.0 31 34.0 32 51.5 33 69.0 34 80.0 35 91.0 36 115.0 37 139.0 38 156.0 39 173.0 40 185.0 41 197.0 42 216.5 43 236.0 44 257.5 45 279.0 46 283.0 47 287.0 48 272.5 49 258.0 50 269.0 51 280.0 52 237.5 53 195.0 54 212.0 55 229.0 56 216.0 57 203.0 58 195.5 59 188.0 60 197.0 61 206.0 62 180.5 63 155.0 64 142.0 65 129.0 66 136.0 67 143.0 68 120.0 69 97.0 70 100.0 71 103.0 72 96.0 73 89.0 74 73.0 75 54.0 76 51.0 77 39.0 78 27.0 79 24.5 80 22.0 81 16.5 82 11.0 83 8.0 84 5.0 85 6.0 86 7.0 87 5.5 88 4.0 89 2.5 90 1.0 91 1.5 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 1.15 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.475 38 0.0 39 0.0 40 0.0 41 0.0 42 1.4000000000000001 43 2.375 44 3.0 45 3.2750000000000004 46 4.25 47 7.449999999999999 48 5.7 49 6.7250000000000005 50 3.6249999999999996 51 1.275 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.7054673721340388 1.4000000000000001 3 0.0 0.0 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801802 spots for SRR6892990.sra Written 801802 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra Read 801784 spots for SRR6892990.sra Written 801784 spots for SRR6892990.sra SRR ids: ['SRR6892990.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0i3lgx_5 SRR6892990.sra spots: 16035698 blocks: [[1, 801784], [801785, 1603568], [1603569, 2405352], [2405353, 3207136], [3207137, 4008920], [4008921, 4810704], [4810705, 5612488], [5612489, 6414272], [6414273, 7216056], [7216057, 8017840], [8017841, 8819624], [8819625, 9621408], [9621409, 10423192], [10423193, 11224976], [11224977, 12026760], [12026761, 12828544], [12828545, 13630328], [13630329, 14432112], [14432113, 15233896], [15233897, 16035698]] SRR6892990 file size 2799883 SRR6892990 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892990 SRR6892990_1.fastq Input file: SRR6892990_1.fastq trimmed: SRR6892990-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:01:19 2024 >> started Fri Dec 6 14:01:29 2024 >> done (9.399s) 16035698 reads processed; of these: 2347 ( 0.01%) short reads filtered out after trimming by size control 1500 ( 0.01%) empty reads filtered out after trimming by size control 16031851 (99.98%) reads available; of these: 439722 ( 2.74%) trimmed reads available after processing 15592129 (97.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 72 0.00% 19 79 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 6 0.00% 26 6 0.00% 27 14 0.00% 28 9 0.00% 29 13 0.00% 30 28 0.00% 31 44 0.00% 32 54 0.00% 33 81 0.00% 34 290 0.00% 35 606 0.00% 36 152 0.00% 37 172 0.00% 38 276 0.00% 39 758 0.00% 40 991 0.01% 41 2365 0.01% 42 1284 0.01% 43 1693 0.01% 44 2477 0.02% 45 4123 0.03% 46 7428 0.05% 47 14016 0.09% 48 29039 0.18% 49 74450 0.46% 50 299188 1.87% 51 15592129 97.26% 16031851 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=23 prefix-density=0.14 prefix-fanout=2.0 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=130.88 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=18.9 sequence=GCCGCCGCCGCC Started job on | Dec 06 14:01:42 Started mapping on | Dec 06 14:01:42 Finished on | Dec 06 14:01:58 Mapping speed, Million of reads per hour | 3607.17 Number of input reads | 16031851 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 14941728 Uniquely mapped reads % | 93.20% Average mapped length | 50.85 Number of splices: Total | 2344614 Number of splices: Annotated (sjdb) | 2257704 Number of splices: GT/AG | 2315705 Number of splices: GC/AG | 26486 Number of splices: AT/AC | 1239 Number of splices: Non-canonical | 1184 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467330 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 550414 % of reads mapped to too many loci | 3.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 622793 622793 622793 N_multimapping 467330 467330 467330 N_noFeature 474941 7550524 7680343 N_ambiguous 206957 12603 9994 UnstrandedReadsAssigned:14259830 PositiveStrandReadsAssigned:7378601 NegativeStrandReadsAssigned:7251391 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892990 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892990-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,031,851 reads, 14,256,879 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52973 SRR6892990.ke.tsv 35125 SRR6892990.se.tsv 88098 total ==> SRR6892990.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.74117 1.01351 PNS24247 1044 945 23.8667 2.76762 PNS24249 1928 1829 170.113 10.1922 PNS24246 1044 945 23.8667 2.76762 PNS24248 1044 945 23.8667 2.76762 PNS24244 1471 1372 6.54567 0.522812 PNS24243 293 194 5 2.82432 KQK14069 1603 1504 1016.51 74.0647 KQK14071 474 375 638.75 186.657 ==> SRR6892990.se.tsv <== BRADI_1g14170v3 1925 BRADI_1g53295v3 21 BRADI_1g59795v3 145 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 1472 BRADI_1g74790v3 133 BRADI_1g09890v3 3 BRADI_1g77505v3 166 BRADI_1g48960v3 0 SRR6892990 completed mapping pipeline successfully