Starting /dee2/code/volunteer_pipeline.sh SRR6892991 current disk space = 1550654066688 free memory = 1602946956 SRR6892991 SRAfilesize 6a4ea159be916f99f83a3f7ce19a4a7e SRR6892991.sra SRR6892991.sra file validated SRR6892991 is single end SRR6892991 is conventional basespace SRR6892991 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.59275 31.0 31.0 34.0 30.0 34.0 2 31.7015 31.0 31.0 34.0 30.0 34.0 3 31.78625 31.0 31.0 34.0 30.0 34.0 4 35.401 37.0 35.0 37.0 33.0 37.0 5 34.98575 37.0 35.0 37.0 32.0 37.0 6 34.93425 37.0 35.0 37.0 32.0 37.0 7 34.9325 36.0 35.0 37.0 32.0 37.0 8 34.8875 36.0 35.0 37.0 31.0 37.0 9 36.52325 38.0 35.0 39.0 32.0 39.0 10 35.88025 38.0 35.0 39.0 30.0 39.0 11 36.343 38.0 35.0 39.0 32.0 39.0 12 36.07275 38.0 35.0 39.0 30.0 39.0 13 36.2315 38.0 35.0 39.0 31.0 39.0 14 37.3995 39.0 36.0 41.0 32.0 41.0 15 37.32 39.0 36.0 41.0 31.0 41.0 16 37.3 39.0 36.0 41.0 31.0 41.0 17 37.40175 39.0 36.0 41.0 32.0 41.0 18 37.25425 39.0 36.0 41.0 32.0 41.0 19 37.21725 39.0 36.0 40.0 31.0 41.0 20 37.19875 39.0 36.0 40.0 31.0 41.0 21 37.03375 39.0 36.0 40.0 31.0 41.0 22 37.1685 39.0 36.0 40.0 31.0 41.0 23 37.134 39.0 36.0 40.0 31.0 41.0 24 36.7825 39.0 36.0 40.0 30.0 41.0 25 36.73675 39.0 35.0 40.0 30.0 41.0 26 36.77775 39.0 36.0 40.0 31.0 41.0 27 36.657 39.0 35.0 40.0 30.0 41.0 28 36.5075 38.0 35.0 40.0 30.0 41.0 29 36.2755 38.0 35.0 40.0 29.0 41.0 30 36.1105 38.0 34.0 40.0 29.0 41.0 31 35.998 38.0 34.0 40.0 29.0 41.0 32 35.4915 38.0 34.0 40.0 27.0 41.0 33 35.321 38.0 33.0 40.0 26.0 41.0 34 35.2 38.0 33.0 40.0 26.0 41.0 35 35.09 38.0 33.0 40.0 26.0 41.0 36 35.1355 38.0 33.0 40.0 26.0 41.0 37 35.3615 38.0 33.0 40.0 27.0 41.0 38 35.70425 38.0 34.0 40.0 27.0 41.0 39 35.5295 38.0 33.0 40.0 27.0 41.0 40 35.51475 38.0 34.0 40.0 27.0 41.0 41 35.54325 38.0 34.0 40.0 27.0 41.0 42 34.98275 38.0 33.0 40.0 26.0 41.0 43 34.30875 38.0 33.0 40.0 23.0 41.0 44 33.997 37.0 32.0 40.0 23.0 41.0 45 33.52175 37.0 32.0 40.0 21.0 41.0 46 33.06975 37.0 31.0 40.0 19.0 41.0 47 32.24375 36.0 31.0 40.0 13.0 41.0 48 32.178 36.0 30.0 40.0 12.0 41.0 49 32.13275 36.0 30.0 40.0 13.0 41.0 50 31.85175 35.0 29.0 40.0 14.0 41.0 51 32.17725 35.0 29.0 39.0 15.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 2.0 19 1.0 20 8.0 21 6.0 22 16.0 23 23.0 24 24.0 25 34.0 26 59.0 27 70.0 28 104.0 29 117.0 30 177.0 31 190.0 32 175.0 33 233.0 34 278.0 35 320.0 36 397.0 37 454.0 38 586.0 39 724.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.912956478239117 10.78039019509755 9.579789894947474 53.726863431715856 2 22.175 17.525 33.800000000000004 26.5 3 24.05 21.375 23.025000000000002 31.55 4 29.275000000000002 26.125 16.5 28.1 5 27.417318858874022 29.99242615501136 20.373643019439534 22.21661196667508 6 23.799999999999997 31.95 21.275 22.975 7 21.025 15.975 36.475 26.525 8 21.975 20.8 26.25 30.975 9 23.175 20.75 27.625 28.449999999999996 10 23.849999999999998 33.25 21.425 21.475 11 28.749999999999996 22.7 19.15 29.4 12 25.2 21.175 23.799999999999997 29.825000000000003 13 24.325 22.575 25.95 27.150000000000002 14 24.675 24.2 24.925 26.200000000000003 15 24.775 22.425 25.1 27.700000000000003 16 26.775 22.025 22.5 28.7 17 27.675 23.150000000000002 22.475 26.700000000000003 18 24.775 23.025000000000002 23.625 28.575 19 26.5 21.65 22.95 28.9 20 25.7 23.724999999999998 23.325000000000003 27.250000000000004 21 24.925 24.25 23.775 27.05 22 26.450000000000003 23.549999999999997 21.825 28.175 23 26.924999999999997 25.924999999999997 22.35 24.8 24 24.55 24.6 24.7 26.150000000000002 25 25.575 23.225 23.35 27.85 26 26.525 23.175 24.349999999999998 25.95 27 24.7 24.0 24.0 27.3 28 27.1 22.875 22.650000000000002 27.375 29 26.025 24.075 22.900000000000002 27.0 30 25.55 23.275000000000002 23.625 27.55 31 26.575 22.85 22.275 28.299999999999997 32 27.556889222305575 22.20555138784696 23.93098274568642 26.30657664416104 33 26.8 23.25 23.45 26.5 34 26.75 22.8 22.45 28.000000000000004 35 26.35 25.05 22.75 25.85 36 25.624999999999996 24.125 23.525 26.724999999999998 37 27.156469408224677 23.019057171514543 22.091273821464394 27.73319959879639 38 26.974999999999998 23.05 23.35 26.625 39 26.150000000000002 23.225 24.55 26.075 40 27.150000000000002 23.775 22.1 26.974999999999998 41 27.200000000000003 24.45 23.025000000000002 25.324999999999996 42 26.16514690982776 24.41742654508612 23.302938196555218 26.1144883485309 43 27.449475569199283 23.407521105141978 21.54003581478639 27.602967510872347 44 27.178958225889634 23.28519855595668 22.537390407426507 26.99845281072718 45 25.452196382428944 24.521963824289404 22.299741602067183 27.726098191214472 46 26.449086161879897 23.18537859007833 23.028720626631856 27.33681462140992 47 27.08500938589434 23.35746849021185 22.821131670689194 26.73639045320461 48 25.22498676548438 24.854420328215987 23.213340391741664 26.707252514557965 49 27.185501066098084 23.214285714285715 21.535181236673772 28.06503198294243 50 26.68918918918919 23.804573804573806 22.14137214137214 27.364864864864863 51 25.1896813353566 23.06525037936267 23.545776428932726 28.199291856348 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 1.0 24 0.0 25 2.0 26 5.0 27 6.0 28 13.0 29 20.0 30 34.5 31 49.0 32 53.5 33 58.0 34 77.0 35 96.0 36 113.0 37 130.0 38 148.0 39 166.0 40 187.5 41 209.0 42 216.0 43 223.0 44 230.0 45 237.0 46 257.0 47 277.0 48 277.0 49 277.0 50 267.0 51 257.0 52 237.0 53 217.0 54 218.5 55 220.0 56 210.5 57 201.0 58 205.0 59 209.0 60 203.5 61 198.0 62 188.0 63 178.0 64 157.0 65 136.0 66 141.5 67 147.0 68 129.0 69 111.0 70 97.5 71 84.0 72 83.0 73 82.0 74 70.5 75 58.5 76 58.0 77 47.5 78 37.0 79 30.0 80 23.0 81 18.0 82 13.0 83 8.5 84 4.0 85 3.5 86 3.0 87 4.5 88 6.0 89 4.0 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.975 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.025 33 0.0 34 0.0 35 0.0 36 0.0 37 0.3 38 0.0 39 0.0 40 0.0 41 0.0 42 1.3 43 2.275 44 3.05 45 3.25 46 4.25 47 6.775 48 5.55 49 6.2 50 3.8 51 1.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797446 spots for SRR6892991.sra Written 797446 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra Read 797439 spots for SRR6892991.sra Written 797439 spots for SRR6892991.sra SRR ids: ['SRR6892991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ysu37si0 SRR6892991.sra spots: 15948787 blocks: [[1, 797439], [797440, 1594878], [1594879, 2392317], [2392318, 3189756], [3189757, 3987195], [3987196, 4784634], [4784635, 5582073], [5582074, 6379512], [6379513, 7176951], [7176952, 7974390], [7974391, 8771829], [8771830, 9569268], [9569269, 10366707], [10366708, 11164146], [11164147, 11961585], [11961586, 12759024], [12759025, 13556463], [13556464, 14353902], [14353903, 15151341], [15151342, 15948787]] SRR6892991 file size 2784653 SRR6892991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892991 SRR6892991_1.fastq Input file: SRR6892991_1.fastq trimmed: SRR6892991-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:07:39 2024 >> started Fri Dec 6 14:07:48 2024 >> done (8.331s) 15948787 reads processed; of these: 3266 ( 0.02%) short reads filtered out after trimming by size control 1662 ( 0.01%) empty reads filtered out after trimming by size control 15943859 (99.97%) reads available; of these: 442699 ( 2.78%) trimmed reads available after processing 15501160 (97.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 134 0.00% 19 130 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 4 0.00% 27 8 0.00% 28 16 0.00% 29 22 0.00% 30 27 0.00% 31 28 0.00% 32 41 0.00% 33 59 0.00% 34 292 0.00% 35 576 0.00% 36 142 0.00% 37 179 0.00% 38 293 0.00% 39 755 0.00% 40 958 0.01% 41 2298 0.01% 42 1314 0.01% 43 1678 0.01% 44 2643 0.02% 45 4145 0.03% 46 7350 0.05% 47 14024 0.09% 48 28951 0.18% 49 75341 0.47% 50 301283 1.89% 51 15501160 97.22% 15943859 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=14 prefix-density=0.13 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=158.57 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=20.9 sequence=GCCGCCGCCGCC Started job on | Dec 06 14:07:59 Started mapping on | Dec 06 14:08:00 Finished on | Dec 06 14:08:14 Mapping speed, Million of reads per hour | 4099.85 Number of input reads | 15943859 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 14761212 Uniquely mapped reads % | 92.58% Average mapped length | 50.83 Number of splices: Total | 2136400 Number of splices: Annotated (sjdb) | 2053078 Number of splices: GT/AG | 2109939 Number of splices: GC/AG | 23995 Number of splices: AT/AC | 1067 Number of splices: Non-canonical | 1399 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450023 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 645075 % of reads mapped to too many loci | 4.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 732624 732624 732624 N_multimapping 450023 450023 450023 N_noFeature 541608 7545515 7565275 N_ambiguous 211326 11078 9480 UnstrandedReadsAssigned:14008278 PositiveStrandReadsAssigned:7204619 NegativeStrandReadsAssigned:7186457 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892991 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892991-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,943,859 reads, 13,958,696 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6892991.ke.tsv 35125 SRR6892991.se.tsv 88098 total ==> SRR6892991.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 30.027 3.59876 PNS24249 1928 1829 65.4633 4.05374 PNS24246 1044 945 30.027 3.59876 PNS24248 1044 945 30.027 3.59876 PNS24244 1471 1372 18.4557 1.52352 PNS24243 293 194 8 4.67047 KQK14069 1603 1504 3114.92 234.569 KQK14071 474 375 1382.54 417.558 ==> SRR6892991.se.tsv <== BRADI_1g14170v3 5425 BRADI_1g53295v3 7 BRADI_1g59795v3 92 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 1062 BRADI_1g74790v3 97 BRADI_1g09890v3 4 BRADI_1g77505v3 157 BRADI_1g48960v3 0 SRR6892991 completed mapping pipeline successfully