Starting /dee2/code/volunteer_pipeline.sh SRR6892992 current disk space = 1550648877056 free memory = 1601636288 SRR6892992 SRAfilesize a1e32a1743d99fb090e2a91600bbc31f SRR6892992.sra SRR6892992.sra file validated SRR6892992 is single end SRR6892992 is conventional basespace SRR6892992 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.687 31.0 31.0 34.0 30.0 34.0 2 31.67325 31.0 31.0 34.0 30.0 34.0 3 31.75425 31.0 31.0 34.0 30.0 34.0 4 35.4695 37.0 35.0 37.0 33.0 37.0 5 34.934 37.0 35.0 37.0 32.0 37.0 6 34.80675 37.0 35.0 37.0 32.0 37.0 7 34.95225 36.0 35.0 37.0 32.0 37.0 8 34.90525 36.0 35.0 37.0 32.0 37.0 9 36.465 38.0 35.0 39.0 32.0 39.0 10 35.8995 38.0 35.0 39.0 30.0 39.0 11 36.2285 38.0 35.0 39.0 31.0 39.0 12 36.25125 38.0 35.0 39.0 32.0 39.0 13 36.33925 38.0 35.0 39.0 32.0 39.0 14 37.47725 39.0 36.0 41.0 32.0 41.0 15 37.43475 39.0 36.0 41.0 32.0 41.0 16 37.456 39.0 36.0 41.0 32.0 41.0 17 37.48025 39.0 36.0 41.0 32.0 41.0 18 37.33625 39.0 36.0 41.0 32.0 41.0 19 37.3435 39.0 36.0 40.0 31.0 41.0 20 37.16675 39.0 36.0 40.0 31.0 41.0 21 37.0855 39.0 36.0 40.0 31.0 41.0 22 37.128 39.0 36.0 40.0 31.0 41.0 23 37.046 39.0 36.0 40.0 31.0 41.0 24 36.78975 39.0 36.0 40.0 30.0 41.0 25 36.62975 39.0 35.0 40.0 30.0 41.0 26 36.68775 39.0 35.0 40.0 30.0 41.0 27 36.621 39.0 35.0 40.0 30.0 41.0 28 36.415 38.0 35.0 40.0 30.0 41.0 29 36.29075 38.0 35.0 40.0 30.0 41.0 30 36.06775 38.0 34.0 40.0 29.0 41.0 31 35.854 38.0 34.0 40.0 28.0 41.0 32 35.55475 38.0 34.0 40.0 27.0 41.0 33 35.4635 38.0 34.0 40.0 27.0 41.0 34 35.37875 38.0 33.0 40.0 26.0 41.0 35 35.2585 38.0 33.0 40.0 26.0 41.0 36 35.1915 38.0 33.0 40.0 26.0 41.0 37 35.4135 38.0 33.0 40.0 27.0 41.0 38 35.507 38.0 33.0 40.0 27.0 41.0 39 35.349 38.0 33.0 40.0 26.0 41.0 40 35.4155 38.0 33.0 40.0 27.0 41.0 41 35.417 38.0 33.0 40.0 26.0 41.0 42 34.79225 38.0 33.0 40.0 25.0 41.0 43 34.2435 38.0 33.0 40.0 23.0 41.0 44 33.8275 37.0 32.0 40.0 22.0 41.0 45 33.436 37.0 32.0 40.0 20.0 41.0 46 33.014 37.0 31.0 40.0 18.0 41.0 47 31.9235 36.0 30.0 40.0 9.0 41.0 48 31.78375 36.0 30.0 40.0 11.0 41.0 49 31.67 35.0 29.0 40.0 11.0 41.0 50 31.65675 35.0 29.0 39.0 13.0 41.0 51 32.1245 35.0 29.0 39.0 15.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 3.0 19 0.0 20 4.0 21 15.0 22 10.0 23 18.0 24 34.0 25 32.0 26 70.0 27 81.0 28 104.0 29 118.0 30 143.0 31 186.0 32 187.0 33 233.0 34 257.0 35 353.0 36 401.0 37 469.0 38 602.0 39 679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.013006503251624 10.730365182591296 9.67983991995998 53.576788394197095 2 23.45 18.55 33.975 24.025 3 24.05 22.650000000000002 21.025 32.275 4 29.7 26.825 16.225 27.250000000000004 5 28.708617639625977 29.466767753348496 19.81298963861511 22.011624968410413 6 22.925 32.300000000000004 21.775 23.0 7 22.475 15.925 35.775 25.825 8 21.375 20.875 26.924999999999997 30.825000000000003 9 23.474999999999998 20.525 28.225 27.775 10 25.2 31.724999999999998 21.349999999999998 21.725 11 29.025000000000002 23.7 18.175 29.099999999999998 12 25.900000000000002 20.599999999999998 24.55 28.95 13 23.925 22.375 25.724999999999998 27.975 14 24.625 23.974999999999998 24.7 26.700000000000003 15 24.9 23.375 23.799999999999997 27.925 16 27.224999999999998 23.05 21.75 27.975 17 26.025 23.05 23.925 27.0 18 25.5 23.65 22.225 28.625 19 27.975 23.375 21.7 26.950000000000003 20 26.150000000000002 23.724999999999998 23.575 26.55 21 26.075 23.200000000000003 23.400000000000002 27.325 22 25.0 23.275000000000002 22.925 28.799999999999997 23 26.125 23.875 23.35 26.650000000000002 24 25.775 24.099999999999998 23.05 27.075 25 26.5 22.325 23.25 27.925 26 26.55 24.8 23.425 25.224999999999998 27 25.924999999999997 23.05 23.575 27.450000000000003 28 26.875 23.05 21.3 28.775000000000002 29 26.35 22.875 24.65 26.125 30 25.924999999999997 23.65 23.275000000000002 27.150000000000002 31 26.05 22.175 23.549999999999997 28.225 32 26.0 22.900000000000002 24.075 27.025 33 27.0 23.1 23.325000000000003 26.575 34 25.174999999999997 22.8 23.400000000000002 28.625 35 27.675 21.8 24.3 26.224999999999998 36 25.474999999999998 23.05 23.3 28.175 37 26.761976423375973 23.6518685728618 22.02157010283421 27.56458490092802 38 26.724999999999998 24.575 23.025000000000002 25.674999999999997 39 26.075 23.075000000000003 23.45 27.400000000000002 40 26.125 22.725 23.5 27.650000000000002 41 26.125 23.1 23.35 27.425 42 27.61156186612576 22.718052738336713 22.641987829614603 27.028397565922923 43 26.61888917327873 23.573073969797797 22.139749168159714 27.66828768876376 44 26.541140056744904 23.884446737167913 22.311065256641733 27.26334794944545 45 26.003626003626003 23.983423983423982 23.128723128723127 26.884226884226887 46 26.39288516871567 23.43709128956317 21.658383468480253 28.511640073240912 47 27.816711590296496 23.369272237196764 22.560646900269543 26.253369272237197 48 26.67020148462354 23.966065747614 23.435843054082714 25.927889713679747 49 27.969041900186813 21.430477715505738 22.36455831331732 28.235922070990128 50 26.657997399219767 22.73081924577373 23.094928478543565 27.516254876462938 51 26.481012658227847 23.06329113924051 23.696202531645568 26.759493670886076 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 6.0 26 8.0 27 7.0 28 16.0 29 25.0 30 35.0 31 45.0 32 54.0 33 63.0 34 76.0 35 89.0 36 108.5 37 128.0 38 139.0 39 150.0 40 179.0 41 208.0 42 222.5 43 237.0 44 238.0 45 239.0 46 261.5 47 284.0 48 277.0 49 270.0 50 260.5 51 251.0 52 226.5 53 202.0 54 205.5 55 209.0 56 203.0 57 197.0 58 195.0 59 193.0 60 186.0 61 179.0 62 174.5 63 170.0 64 157.5 65 145.0 66 144.0 67 143.0 68 140.5 69 138.0 70 130.5 71 123.0 72 105.5 73 88.0 74 78.5 75 57.5 76 46.0 77 44.0 78 42.0 79 31.0 80 20.0 81 15.0 82 10.0 83 9.5 84 9.0 85 5.5 86 2.0 87 3.5 88 5.0 89 2.5 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 1.075 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.325 38 0.0 39 0.0 40 0.0 41 0.0 42 1.4000000000000001 43 2.325 44 3.075 45 3.4750000000000005 46 4.425 47 7.249999999999999 48 5.7 49 6.325 50 3.875 51 1.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754853 spots for SRR6892992.sra Written 754853 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra Read 754834 spots for SRR6892992.sra Written 754834 spots for SRR6892992.sra SRR ids: ['SRR6892992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ni5tznc SRR6892992.sra spots: 15096699 blocks: [[1, 754834], [754835, 1509668], [1509669, 2264502], [2264503, 3019336], [3019337, 3774170], [3774171, 4529004], [4529005, 5283838], [5283839, 6038672], [6038673, 6793506], [6793507, 7548340], [7548341, 8303174], [8303175, 9058008], [9058009, 9812842], [9812843, 10567676], [10567677, 11322510], [11322511, 12077344], [12077345, 12832178], [12832179, 13587012], [13587013, 14341846], [14341847, 15096699]] SRR6892992 file size 2635298 SRR6892992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892992 SRR6892992_1.fastq Input file: SRR6892992_1.fastq trimmed: SRR6892992-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:08:51 2024 >> started Fri Dec 6 14:09:01 2024 >> done (9.743s) 15096699 reads processed; of these: 2998 ( 0.02%) short reads filtered out after trimming by size control 1071 ( 0.01%) empty reads filtered out after trimming by size control 15092630 (99.97%) reads available; of these: 415501 ( 2.75%) trimmed reads available after processing 14677129 (97.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 107 0.00% 19 96 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 9 0.00% 26 10 0.00% 27 11 0.00% 28 13 0.00% 29 27 0.00% 30 26 0.00% 31 38 0.00% 32 51 0.00% 33 71 0.00% 34 291 0.00% 35 496 0.00% 36 121 0.00% 37 156 0.00% 38 306 0.00% 39 764 0.01% 40 944 0.01% 41 2182 0.01% 42 1240 0.01% 43 1512 0.01% 44 2352 0.02% 45 3874 0.03% 46 6996 0.05% 47 13065 0.09% 48 27109 0.18% 49 70883 0.47% 50 282748 1.87% 51 14677129 97.25% 15092630 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=7 prefix-density=0.16 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=142.97 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=19.7 sequence=GCCGCCGCCGCC Started job on | Dec 06 14:09:17 Started mapping on | Dec 06 14:09:17 Finished on | Dec 06 14:09:31 Mapping speed, Million of reads per hour | 3880.96 Number of input reads | 15092630 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 14124685 Uniquely mapped reads % | 93.59% Average mapped length | 50.83 Number of splices: Total | 2084236 Number of splices: Annotated (sjdb) | 2006024 Number of splices: GT/AG | 2058462 Number of splices: GC/AG | 23429 Number of splices: AT/AC | 1025 Number of splices: Non-canonical | 1320 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414606 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 477868 % of reads mapped to too many loci | 3.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 553339 553339 553339 N_multimapping 414606 414606 414606 N_noFeature 509433 7233410 7225964 N_ambiguous 193382 11135 8788 UnstrandedReadsAssigned:13421870 PositiveStrandReadsAssigned:6880140 NegativeStrandReadsAssigned:6889933 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892992 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892992-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,092,630 reads, 13,358,970 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52973 SRR6892992.ke.tsv 35125 SRR6892992.se.tsv 88098 total ==> SRR6892992.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 22.3564 3.15342 PNS24247 1044 945 9.79519 1.22373 PNS24249 1928 1829 93.204 6.01626 PNS24246 1044 945 9.79519 1.22373 PNS24248 1044 945 9.79519 1.22373 PNS24244 1471 1372 13.054 1.1233 PNS24243 293 194 6 3.65136 KQK14069 1603 1504 1068.51 83.876 KQK14071 474 375 467.868 147.298 ==> SRR6892992.se.tsv <== BRADI_1g14170v3 1853 BRADI_1g53295v3 11 BRADI_1g59795v3 77 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 1161 BRADI_1g74790v3 75 BRADI_1g09890v3 1 BRADI_1g77505v3 125 BRADI_1g48960v3 0 SRR6892992 completed mapping pipeline successfully