Starting /dee2/code/volunteer_pipeline.sh SRR6892993 current disk space = 1550648877056 free memory = 1600904484 SRR6892993 SRAfilesize 4baa5844d0ef98f295708b57ce23318e SRR6892993.sra SRR6892993.sra file validated SRR6892993 is single end SRR6892993 is conventional basespace SRR6892993 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7475 31.0 31.0 34.0 30.0 34.0 2 31.79 31.0 31.0 34.0 30.0 34.0 3 31.778 31.0 31.0 34.0 30.0 34.0 4 35.46975 37.0 35.0 37.0 33.0 37.0 5 35.02925 37.0 35.0 37.0 32.0 37.0 6 34.9285 37.0 35.0 37.0 32.0 37.0 7 34.99775 36.0 35.0 37.0 32.0 37.0 8 34.89 35.0 35.0 37.0 32.0 37.0 9 36.60325 38.0 35.0 39.0 32.0 39.0 10 35.91725 38.0 35.0 39.0 30.0 39.0 11 36.43475 38.0 35.0 39.0 32.0 39.0 12 36.3735 38.0 35.0 39.0 32.0 39.0 13 36.408 38.0 35.0 39.0 32.0 39.0 14 37.56175 39.0 36.0 41.0 32.0 41.0 15 37.489 39.0 36.0 40.0 32.0 41.0 16 37.431 39.0 36.0 41.0 32.0 41.0 17 37.5645 39.0 36.0 41.0 32.0 41.0 18 37.30575 39.0 36.0 41.0 32.0 41.0 19 37.3205 39.0 36.0 41.0 31.0 41.0 20 37.334 39.0 36.0 40.0 32.0 41.0 21 37.2935 39.0 36.0 40.0 31.0 41.0 22 37.17 39.0 36.0 40.0 31.0 41.0 23 37.24975 39.0 36.0 40.0 31.0 41.0 24 36.92725 39.0 36.0 40.0 31.0 41.0 25 36.8375 38.0 36.0 40.0 30.0 41.0 26 36.84975 39.0 36.0 40.0 31.0 41.0 27 36.8575 39.0 36.0 40.0 31.0 41.0 28 36.8065 39.0 36.0 40.0 30.0 41.0 29 36.35425 38.0 35.0 40.0 30.0 41.0 30 36.314 38.0 35.0 40.0 30.0 41.0 31 36.0515 38.0 34.0 40.0 29.0 41.0 32 35.80775 38.0 34.0 40.0 28.0 41.0 33 35.74475 38.0 34.0 40.0 28.0 41.0 34 35.80125 38.0 34.0 40.0 28.0 41.0 35 35.51175 38.0 34.0 40.0 27.0 41.0 36 35.38475 38.0 34.0 40.0 27.0 41.0 37 35.499 38.0 34.0 40.0 27.0 41.0 38 35.6795 38.0 34.0 40.0 27.0 41.0 39 35.74125 38.0 34.0 40.0 28.0 41.0 40 35.716 38.0 34.0 40.0 27.0 41.0 41 35.534 38.0 34.0 40.0 26.0 41.0 42 35.031 38.0 33.0 40.0 26.0 41.0 43 34.45425 38.0 33.0 40.0 24.0 41.0 44 34.17525 38.0 33.0 40.0 23.0 41.0 45 33.96775 37.0 32.0 40.0 23.0 41.0 46 33.46575 37.0 32.0 40.0 20.0 41.0 47 32.34925 37.0 31.0 40.0 13.0 41.0 48 32.52225 37.0 31.0 40.0 15.0 41.0 49 32.23925 36.0 30.0 40.0 12.0 41.0 50 32.091 36.0 30.0 40.0 14.0 41.0 51 32.4745 36.0 30.0 40.0 15.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 2.0 19 2.0 20 0.0 21 8.0 22 11.0 23 20.0 24 29.0 25 28.0 26 45.0 27 79.0 28 86.0 29 132.0 30 125.0 31 168.0 32 188.0 33 240.0 34 265.0 35 339.0 36 422.0 37 514.0 38 578.0 39 715.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.887943971985994 12.056028014007003 10.080040020010005 51.975987993996995 2 22.225 18.125 34.9 24.75 3 23.0 22.225 23.325000000000003 31.45 4 28.975 27.6 17.775 25.650000000000002 5 28.102097548647965 29.79529946929492 21.02602982057114 21.076573161485975 6 22.650000000000002 32.2 21.85 23.3 7 21.3 15.725 37.9 25.074999999999996 8 23.1 19.975 27.400000000000002 29.525000000000002 9 22.275 20.9 29.65 27.175 10 24.375 32.675 20.7 22.25 11 28.775000000000002 22.85 18.575 29.799999999999997 12 24.525 21.025 25.074999999999996 29.375 13 24.775 23.325000000000003 25.874999999999996 26.025 14 24.775 24.425 25.474999999999998 25.324999999999996 15 23.45 25.025 25.074999999999996 26.450000000000003 16 26.025 23.425 22.8 27.750000000000004 17 26.974999999999998 23.925 23.35 25.75 18 25.074999999999996 23.9 23.549999999999997 27.474999999999998 19 25.974999999999998 23.150000000000002 24.4 26.474999999999998 20 26.950000000000003 24.15 23.7 25.2 21 25.974999999999998 24.575 23.35 26.1 22 25.85 24.625 23.35 26.174999999999997 23 25.374999999999996 25.074999999999996 22.875 26.674999999999997 24 26.200000000000003 24.349999999999998 24.375 25.074999999999996 25 25.224999999999998 23.5 24.349999999999998 26.924999999999997 26 26.724999999999998 24.099999999999998 22.675 26.5 27 25.75 25.324999999999996 22.725 26.200000000000003 28 27.224999999999998 23.95 22.225 26.6 29 25.4 23.425 24.375 26.8 30 25.474999999999998 24.05 24.175 26.3 31 26.174999999999997 22.95 23.45 27.425 32 25.525 24.925 23.125 26.424999999999997 33 25.900000000000002 23.849999999999998 24.65 25.6 34 26.724999999999998 22.35 23.724999999999998 27.200000000000003 35 26.200000000000003 22.925 22.825 28.050000000000004 36 24.7 24.7 24.099999999999998 26.5 37 26.787057938299476 23.702031602708804 22.87434161023326 26.63656884875846 38 26.1 23.5 23.45 26.950000000000003 39 25.474999999999998 23.974999999999998 23.150000000000002 27.400000000000002 40 26.325 23.225 23.775 26.674999999999997 41 26.55 23.275000000000002 23.75 26.424999999999997 42 25.58316430020284 23.301217038539555 24.746450304259636 26.369168356997974 43 25.794057377049178 23.4375 23.770491803278688 26.997950819672127 44 27.48778606325534 24.453587040370277 22.885060426844948 25.17356646952944 45 25.045137993293782 23.755481042042817 23.394377095692544 27.80500386897085 46 26.374771957258275 22.56971592389888 23.6382590565546 27.417253062288243 47 26.797210300429185 24.490343347639485 22.0225321888412 26.68991416309013 48 26.038634559407253 24.424450912939932 23.70997618417571 25.826938343477114 49 25.806451612903224 22.927219408157825 22.207411356971473 29.058917621967474 50 25.932642487046632 24.818652849740932 23.54922279792746 25.699481865284973 51 25.53191489361702 24.924012158054712 22.69503546099291 26.84903748733536 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 4.0 24 5.0 25 8.0 26 11.5 27 12.0 28 15.5 29 19.0 30 26.0 31 33.0 32 50.5 33 68.0 34 82.0 35 96.0 36 124.0 37 152.0 38 161.0 39 170.0 40 207.0 41 244.0 42 254.5 43 265.0 44 270.0 45 275.0 46 265.5 47 256.0 48 267.5 49 279.0 50 271.0 51 263.0 52 240.0 53 217.0 54 214.0 55 211.0 56 209.0 57 207.0 58 193.5 59 180.0 60 160.5 61 141.0 62 153.0 63 165.0 64 156.5 65 148.0 66 135.5 67 123.0 68 117.5 69 112.0 70 102.0 71 92.0 72 87.5 73 83.0 74 67.5 75 46.5 76 41.0 77 37.0 78 33.0 79 26.5 80 20.0 81 14.0 82 8.0 83 9.5 84 11.0 85 6.5 86 2.0 87 1.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 1.075 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.325 38 0.0 39 0.0 40 0.0 41 0.0 42 1.4000000000000001 43 2.4 44 2.775 45 3.075 46 4.075 47 6.800000000000001 48 5.525 49 6.225 50 3.5000000000000004 51 1.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.025 10 0.025 0.0 0.0 0.0 0.025 11 0.025 0.0 0.0 0.0 0.025 12 0.025 0.0 0.0 0.0 0.025 13 0.025 0.0 0.0 0.0 0.025 14 0.025 0.0 0.0 0.0 0.025 15 0.025 0.0 0.0 0.0 0.025 16 0.025 0.0 0.0 0.0 0.025 17 0.025 0.0 0.0 0.0 0.025 18 0.025 0.0 0.0 0.0 0.025 19 0.025 0.0 0.0 0.0 0.025 20 0.025 0.0 0.0 0.0 0.025 21 0.025 0.0 0.0 0.0 0.025 22 0.025 0.0 0.0 0.0 0.025 23 0.025 0.0 0.0 0.0 0.025 24 0.025 0.0 0.0 0.0 0.025 25 0.025 0.0 0.0 0.0 0.025 26 0.025 0.0 0.0 0.0 0.025 27 0.025 0.0 0.0 0.0 0.025 28 0.025 0.0 0.0 0.0 0.025 29 0.025 0.0 0.0 0.0 0.025 30 0.025 0.0 0.0 0.0 0.025 31 0.025 0.0 0.0 0.0 0.025 32 0.025 0.0 0.0 0.0 0.025 33 0.025 0.0 0.0 0.0 0.025 34 0.025 0.0 0.0 0.0 0.025 35 0.025 0.0 0.0 0.0 0.025 36 0.025 0.0 0.0 0.0 0.025 37 0.025 0.0 0.0 0.0 0.025 38 0.025 0.0 0.0 0.0 0.025 39 0.025 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra Read 720595 spots for SRR6892993.sra Written 720595 spots for SRR6892993.sra Read 720581 spots for SRR6892993.sra Written 720581 spots for SRR6892993.sra SRR ids: ['SRR6892993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bwrnqfd5 SRR6892993.sra spots: 14411634 blocks: [[1, 720581], [720582, 1441162], [1441163, 2161743], [2161744, 2882324], [2882325, 3602905], [3602906, 4323486], [4323487, 5044067], [5044068, 5764648], [5764649, 6485229], [6485230, 7205810], [7205811, 7926391], [7926392, 8646972], [8646973, 9367553], [9367554, 10088134], [10088135, 10808715], [10808716, 11529296], [11529297, 12249877], [12249878, 12970458], [12970459, 13691039], [13691040, 14411634]] SRR6892993 file size 2515223 SRR6892993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892993 SRR6892993_1.fastq Input file: SRR6892993_1.fastq trimmed: SRR6892993-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:08:53 2024 >> started Fri Dec 6 14:09:02 2024 >> done (8.160s) 14411634 reads processed; of these: 3217 ( 0.02%) short reads filtered out after trimming by size control 1975 ( 0.01%) empty reads filtered out after trimming by size control 14406442 (99.96%) reads available; of these: 379473 ( 2.63%) trimmed reads available after processing 14026969 (97.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 134 0.00% 19 107 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 5 0.00% 27 15 0.00% 28 8 0.00% 29 14 0.00% 30 30 0.00% 31 38 0.00% 32 39 0.00% 33 50 0.00% 34 266 0.00% 35 494 0.00% 36 131 0.00% 37 154 0.00% 38 236 0.00% 39 662 0.00% 40 886 0.01% 41 2084 0.01% 42 1075 0.01% 43 1369 0.01% 44 2168 0.02% 45 3483 0.02% 46 6308 0.04% 47 11922 0.08% 48 24991 0.17% 49 64443 0.45% 50 258358 1.79% 51 14026969 97.37% 14406442 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=12 prefix-density=0.13 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=170.13 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=19.0 sequence=CCGCCGCCGCCA Started job on | Dec 06 14:09:14 Started mapping on | Dec 06 14:09:14 Finished on | Dec 06 14:09:28 Mapping speed, Million of reads per hour | 3704.51 Number of input reads | 14406442 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 13081640 Uniquely mapped reads % | 90.80% Average mapped length | 50.83 Number of splices: Total | 2006227 Number of splices: Annotated (sjdb) | 1922799 Number of splices: GT/AG | 1979332 Number of splices: GC/AG | 24399 Number of splices: AT/AC | 1171 Number of splices: Non-canonical | 1325 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467454 % of reads mapped to multiple loci | 3.24% Number of reads mapped to too many loci | 769469 % of reads mapped to too many loci | 5.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 857348 857348 857348 N_multimapping 467454 467454 467454 N_noFeature 523325 6725386 6702514 N_ambiguous 198150 11805 10713 UnstrandedReadsAssigned:12360165 PositiveStrandReadsAssigned:6344449 NegativeStrandReadsAssigned:6368413 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892993 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892993-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,406,442 reads, 12,456,186 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,282 rounds 52973 SRR6892993.ke.tsv 35125 SRR6892993.se.tsv 88098 total ==> SRR6892993.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 54.9135 8.56613 PNS24247 1044 945 29.1504 4.02757 PNS24249 1928 1829 169.635 12.1097 PNS24246 1044 945 29.1504 4.02757 PNS24248 1044 945 29.1504 4.02757 PNS24244 1471 1372 0 0 PNS24243 293 194 3 2.01907 KQK14069 1603 1504 10540.8 915.074 KQK14071 474 375 3929.96 1368.32 ==> SRR6892993.se.tsv <== BRADI_1g14170v3 16986 BRADI_1g53295v3 28 BRADI_1g59795v3 159 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 986 BRADI_1g74790v3 211 BRADI_1g09890v3 3 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR6892993 completed mapping pipeline successfully