Starting /dee2/code/volunteer_pipeline.sh SRR6892994 current disk space = 1550651420672 free memory = 1376394272 SRR6892994 SRAfilesize 4f6966f11089a764c1c8c96a69ce5282 SRR6892994.sra SRR6892994.sra file validated SRR6892994 is single end SRR6892994 is conventional basespace SRR6892994 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.553 31.0 31.0 34.0 30.0 34.0 2 31.62825 31.0 31.0 34.0 30.0 34.0 3 31.62875 31.0 31.0 34.0 30.0 34.0 4 35.3325 37.0 35.0 37.0 33.0 37.0 5 34.9935 37.0 35.0 37.0 32.0 37.0 6 34.774 36.0 35.0 37.0 30.0 37.0 7 34.872 36.0 35.0 37.0 32.0 37.0 8 34.796 36.0 35.0 37.0 31.0 37.0 9 36.40625 38.0 35.0 39.0 32.0 39.0 10 35.76975 37.0 35.0 39.0 30.0 39.0 11 36.24275 38.0 35.0 39.0 32.0 39.0 12 36.032 38.0 35.0 39.0 30.0 39.0 13 36.117 38.0 35.0 39.0 30.0 39.0 14 37.28625 39.0 36.0 40.0 32.0 41.0 15 37.14725 39.0 36.0 40.0 31.0 41.0 16 37.18575 39.0 36.0 40.0 31.0 41.0 17 37.145 39.0 36.0 41.0 31.0 41.0 18 37.09325 39.0 36.0 40.0 31.0 41.0 19 37.11 39.0 36.0 40.0 31.0 41.0 20 37.03025 39.0 36.0 40.0 31.0 41.0 21 36.928 39.0 36.0 40.0 31.0 41.0 22 36.92325 39.0 36.0 40.0 31.0 41.0 23 37.0275 39.0 36.0 40.0 31.0 41.0 24 36.7545 39.0 36.0 40.0 30.0 41.0 25 36.6185 38.0 35.0 40.0 30.0 41.0 26 36.7495 38.0 35.0 40.0 30.0 41.0 27 36.54 38.0 35.0 40.0 30.0 41.0 28 36.36425 38.0 35.0 40.0 30.0 41.0 29 36.10825 38.0 35.0 40.0 29.0 41.0 30 36.02125 38.0 34.0 40.0 29.0 41.0 31 35.8445 38.0 34.0 40.0 29.0 41.0 32 35.40275 38.0 34.0 40.0 26.0 41.0 33 35.3925 38.0 33.0 40.0 27.0 41.0 34 35.29825 38.0 33.0 40.0 26.0 41.0 35 35.17225 38.0 33.0 40.0 26.0 41.0 36 35.0905 38.0 33.0 40.0 26.0 41.0 37 35.253 38.0 33.0 40.0 26.0 41.0 38 35.45375 38.0 33.0 40.0 27.0 41.0 39 35.38525 38.0 33.0 40.0 26.0 41.0 40 35.372 38.0 33.0 40.0 27.0 41.0 41 35.32025 38.0 33.0 40.0 26.0 41.0 42 34.78975 38.0 33.0 40.0 25.0 41.0 43 34.1255 37.0 33.0 40.0 23.0 41.0 44 33.84175 37.0 32.0 40.0 22.0 41.0 45 33.594 37.0 32.0 40.0 22.0 41.0 46 33.10325 37.0 31.0 40.0 19.0 41.0 47 32.01125 36.0 30.0 40.0 12.0 41.0 48 32.01925 36.0 30.0 40.0 13.0 41.0 49 31.944 36.0 30.0 40.0 13.0 41.0 50 31.91225 35.0 30.0 39.0 14.0 41.0 51 32.1005 35.0 29.0 39.0 15.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 3.0 20 5.0 21 9.0 22 14.0 23 18.0 24 35.0 25 51.0 26 54.0 27 87.0 28 83.0 29 139.0 30 171.0 31 173.0 32 197.0 33 229.0 34 278.0 35 316.0 36 400.0 37 478.0 38 589.0 39 669.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.008760951188986 11.48936170212766 10.588235294117647 50.91364205256571 2 23.925 17.849999999999998 34.9 23.325000000000003 3 23.225 22.05 22.975 31.75 4 26.474999999999998 28.1 18.35 27.075 5 27.861825516893596 30.786686838124055 20.953101361573374 20.398386283408975 6 21.675 32.875 21.4 24.05 7 22.125 16.950000000000003 35.949999999999996 24.975 8 22.3 20.65 27.875 29.175 9 22.725 20.175 29.625 27.474999999999998 10 25.025 31.275 22.5 21.2 11 27.975 23.625 18.9 29.5 12 24.85 20.75 25.05 29.349999999999998 13 24.625 24.3 25.55 25.525 14 25.424999999999997 24.3 23.7 26.575 15 25.275 24.15 23.525 27.05 16 25.775 23.775 23.75 26.700000000000003 17 27.275 23.474999999999998 23.875 25.374999999999996 18 24.75 24.875 24.025 26.35 19 27.325 21.975 23.325000000000003 27.375 20 27.450000000000003 24.2 22.45 25.900000000000002 21 26.200000000000003 23.175 24.775 25.85 22 26.3 23.974999999999998 23.974999999999998 25.75 23 25.55 25.074999999999996 22.225 27.150000000000002 24 25.25 24.224999999999998 24.175 26.35 25 27.250000000000004 24.2 21.525 27.025 26 26.25 24.15 22.575 27.025 27 26.825 23.0 24.7 25.474999999999998 28 26.575 22.900000000000002 22.45 28.075 29 25.025 25.05 23.575 26.35 30 25.525 24.25 22.55 27.675 31 25.900000000000002 22.6 23.925 27.575 32 26.174999999999997 23.474999999999998 23.474999999999998 26.875 33 26.375 24.575 23.075000000000003 25.974999999999998 34 27.125 23.150000000000002 22.35 27.375 35 28.625 23.849999999999998 21.5 26.025 36 25.95 24.25 23.175 26.625 37 28.002005515166704 22.612183504637752 21.860115317122087 27.525695663073453 38 26.575 24.025 23.375 26.025 39 24.099999999999998 25.275 24.0 26.625 40 26.025 23.65 23.400000000000002 26.924999999999997 41 26.450000000000003 23.65 23.125 26.775 42 25.816249050873196 23.943305492280437 23.43710453049861 26.803340926347758 43 26.349449987209006 24.430800716295728 22.384241493988235 26.835507802507035 44 26.788471435923828 23.95779722079259 21.82192485846629 27.431806484817294 45 26.55483870967742 24.774193548387096 23.35483870967742 25.31612903225807 46 27.267987486965588 22.601668404588114 21.32429614181439 28.80604796663191 47 25.45748116254037 23.331539289558663 23.546824542518838 27.664155005382128 48 25.19830777366473 23.373876255949234 24.907456372289793 26.520359598096242 49 26.72712723392905 22.485996265670845 22.992798079487862 27.794078420912243 50 26.172583570873282 23.71080590826639 23.270277273905158 26.84633324695517 51 26.061678463094033 22.320525783619818 23.91304347826087 27.704752275025278 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 5.0 26 10.5 27 14.0 28 19.5 29 25.0 30 40.0 31 55.0 32 54.5 33 54.0 34 71.5 35 89.0 36 124.5 37 160.0 38 169.0 39 178.0 40 212.5 41 247.0 42 247.5 43 248.0 44 260.5 45 273.0 46 260.5 47 248.0 48 256.5 49 265.0 50 249.0 51 233.0 52 235.0 53 237.0 54 202.5 55 168.0 56 186.0 57 204.0 58 188.5 59 173.0 60 168.0 61 163.0 62 155.5 63 148.0 64 145.0 65 142.0 66 152.5 67 163.0 68 145.0 69 127.0 70 110.0 71 93.0 72 87.5 73 82.0 74 73.5 75 59.0 76 53.0 77 45.0 78 37.0 79 29.5 80 22.0 81 15.0 82 8.0 83 8.0 84 8.0 85 5.5 86 3.0 87 3.0 88 3.0 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.8500000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.27499999999999997 38 0.0 39 0.0 40 0.0 41 0.0 42 1.225 43 2.275 44 2.85 45 3.125 46 4.1000000000000005 47 7.1 48 5.45 49 6.275 50 3.5249999999999995 51 1.0999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782536 spots for SRR6892994.sra Written 782536 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra Read 782522 spots for SRR6892994.sra Written 782522 spots for SRR6892994.sra SRR ids: ['SRR6892994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dzy9dkc0 SRR6892994.sra spots: 15650454 blocks: [[1, 782522], [782523, 1565044], [1565045, 2347566], [2347567, 3130088], [3130089, 3912610], [3912611, 4695132], [4695133, 5477654], [5477655, 6260176], [6260177, 7042698], [7042699, 7825220], [7825221, 8607742], [8607743, 9390264], [9390265, 10172786], [10172787, 10955308], [10955309, 11737830], [11737831, 12520352], [12520353, 13302874], [13302875, 14085396], [14085397, 14867918], [14867919, 15650454]] SRR6892994 file size 2732358 SRR6892994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892994 SRR6892994_1.fastq Input file: SRR6892994_1.fastq trimmed: SRR6892994-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:09:00 2024 >> started Fri Dec 6 14:09:11 2024 >> done (10.485s) 15650454 reads processed; of these: 2267 ( 0.01%) short reads filtered out after trimming by size control 1160 ( 0.01%) empty reads filtered out after trimming by size control 15647027 (99.98%) reads available; of these: 445735 ( 2.85%) trimmed reads available after processing 15201292 (97.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 104 0.00% 19 86 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 6 0.00% 27 10 0.00% 28 16 0.00% 29 14 0.00% 30 36 0.00% 31 37 0.00% 32 54 0.00% 33 84 0.00% 34 283 0.00% 35 537 0.00% 36 165 0.00% 37 217 0.00% 38 259 0.00% 39 778 0.00% 40 1005 0.01% 41 2295 0.01% 42 1323 0.01% 43 1706 0.01% 44 2741 0.02% 45 4188 0.03% 46 7609 0.05% 47 14253 0.09% 48 29383 0.19% 49 76102 0.49% 50 302433 1.93% 51 15201292 97.15% 15647027 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=18 prefix-density=0.08 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=251.20 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=21.1 sequence=GCCGCCGCCGCG Started job on | Dec 06 14:09:29 Started mapping on | Dec 06 14:09:29 Finished on | Dec 06 14:09:45 Mapping speed, Million of reads per hour | 3520.58 Number of input reads | 15647027 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 14739393 Uniquely mapped reads % | 94.20% Average mapped length | 50.83 Number of splices: Total | 2173651 Number of splices: Annotated (sjdb) | 2078387 Number of splices: GT/AG | 2145613 Number of splices: GC/AG | 25226 Number of splices: AT/AC | 1298 Number of splices: Non-canonical | 1514 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446454 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 351628 % of reads mapped to too many loci | 2.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 461180 461180 461180 N_multimapping 446454 446454 446454 N_noFeature 637980 7578074 7600026 N_ambiguous 222817 13115 12359 UnstrandedReadsAssigned:13878596 PositiveStrandReadsAssigned:7148204 NegativeStrandReadsAssigned:7127008 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892994 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892994-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,647,027 reads, 13,812,896 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR6892994.ke.tsv 35125 SRR6892994.se.tsv 88098 total ==> SRR6892994.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 8.94994 1.27878 PNS24247 1044 945 29.1364 3.68727 PNS24249 1928 1829 217.965 14.2519 PNS24246 1044 945 29.1364 3.68727 PNS24248 1044 945 29.1364 3.68727 PNS24244 1471 1372 27.6762 2.41242 PNS24243 293 194 22 13.5619 KQK14069 1603 1504 12356.6 982.547 KQK14071 474 375 5831.77 1859.82 ==> SRR6892994.se.tsv <== BRADI_1g14170v3 20866 BRADI_1g53295v3 43 BRADI_1g59795v3 254 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 969 BRADI_1g74790v3 118 BRADI_1g09890v3 6 BRADI_1g77505v3 266 BRADI_1g48960v3 0 SRR6892994 completed mapping pipeline successfully