Starting /dee2/code/volunteer_pipeline.sh SRR6892995 current disk space = 1550652887040 free memory = 1598367216 SRR6892995 SRAfilesize 9d40de49d7a94d29d516e7a79bfd0bee SRR6892995.sra SRR6892995.sra file validated SRR6892995 is single end SRR6892995 is conventional basespace SRR6892995 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7215 31.0 31.0 34.0 30.0 34.0 2 31.8415 31.0 31.0 34.0 30.0 34.0 3 31.87375 31.0 31.0 34.0 30.0 34.0 4 35.51575 37.0 35.0 37.0 33.0 37.0 5 35.3035 37.0 35.0 37.0 33.0 37.0 6 35.2275 37.0 35.0 37.0 32.0 37.0 7 35.164 37.0 35.0 37.0 32.0 37.0 8 35.0415 37.0 35.0 37.0 32.0 37.0 9 36.0435 38.0 35.0 39.0 30.0 39.0 10 36.37975 38.0 35.0 39.0 32.0 39.0 11 36.507 39.0 35.0 39.0 32.0 39.0 12 36.67175 39.0 35.0 39.0 32.0 39.0 13 36.53675 38.0 35.0 39.0 32.0 39.0 14 37.72125 39.0 36.0 41.0 32.0 41.0 15 37.84375 39.0 37.0 41.0 32.0 41.0 16 37.36325 39.0 36.0 41.0 31.0 41.0 17 37.593 39.0 36.0 41.0 32.0 41.0 18 37.5315 39.0 36.0 41.0 32.0 41.0 19 37.68875 39.0 37.0 41.0 32.0 41.0 20 37.41075 39.0 36.0 41.0 32.0 41.0 21 37.3535 39.0 36.0 41.0 31.0 41.0 22 37.09825 39.0 36.0 40.0 31.0 41.0 23 37.13375 39.0 36.0 40.0 31.0 41.0 24 37.016 39.0 36.0 40.0 31.0 41.0 25 36.89175 39.0 36.0 40.0 30.0 41.0 26 36.94875 39.0 36.0 40.0 30.0 41.0 27 36.772 39.0 36.0 40.0 30.0 41.0 28 36.5065 39.0 35.0 40.0 30.0 41.0 29 36.55525 39.0 35.0 40.0 30.0 41.0 30 36.3215 38.0 35.0 40.0 30.0 41.0 31 36.336 38.0 35.0 40.0 30.0 41.0 32 36.37375 38.0 35.0 40.0 30.0 41.0 33 36.0715 38.0 34.0 40.0 29.0 41.0 34 36.1125 38.0 35.0 40.0 29.0 41.0 35 35.87375 38.0 34.0 40.0 27.0 41.0 36 35.92425 38.0 34.0 40.0 28.0 41.0 37 36.0715 38.0 35.0 40.0 29.0 41.0 38 35.913 38.0 34.0 40.0 28.0 41.0 39 36.03475 38.0 35.0 40.0 29.0 41.0 40 36.089 38.0 35.0 40.0 28.0 41.0 41 35.88075 38.0 34.0 40.0 27.0 41.0 42 34.77875 38.0 33.0 40.0 24.0 41.0 43 34.601 38.0 33.0 40.0 24.0 41.0 44 33.14525 37.0 32.0 40.0 16.0 41.0 45 33.4425 37.0 32.0 40.0 18.0 41.0 46 33.4355 37.0 32.0 40.0 20.0 41.0 47 32.7345 37.0 32.0 40.0 14.0 41.0 48 32.60625 37.0 31.0 40.0 13.0 41.0 49 31.86475 37.0 30.0 40.0 7.0 41.0 50 32.067 36.0 30.0 40.0 12.0 41.0 51 32.59775 36.0 30.0 40.0 15.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 1.0 20 3.0 21 10.0 22 14.0 23 23.0 24 20.0 25 37.0 26 45.0 27 61.0 28 84.0 29 103.0 30 134.0 31 180.0 32 201.0 33 232.0 34 272.0 35 316.0 36 409.0 37 421.0 38 613.0 39 816.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.03128911138924 11.989987484355444 10.237797246558197 52.74092615769712 2 20.95 19.375 35.75 23.925 3 23.925 22.675 22.35 31.05 4 26.924999999999997 27.025 18.099999999999998 27.950000000000003 5 27.403120281831907 31.429290387518872 20.709612481127326 20.45797684952189 6 20.849999999999998 33.650000000000006 21.8 23.7 7 21.875 16.8 36.65 24.675 8 22.55 21.2 28.1 28.15 9 22.075 20.4 30.65 26.875 10 23.425 33.300000000000004 21.55 21.725 11 28.999999999999996 24.825 17.075000000000003 29.099999999999998 12 24.075 21.725 23.65 30.55 13 22.875 24.7 26.650000000000002 25.775 14 25.4 24.625 25.3 24.675 15 25.275 23.75 23.775 27.200000000000003 16 26.674999999999997 23.05 23.875 26.400000000000002 17 26.474999999999998 26.700000000000003 22.85 23.974999999999998 18 25.35 24.7 23.875 26.075 19 26.700000000000003 23.825 23.05 26.424999999999997 20 25.6 24.6 22.475 27.325 21 24.625 25.124999999999996 24.099999999999998 26.150000000000002 22 25.05 24.55 22.875 27.525 23 25.525 23.75 23.65 27.075 24 24.975 25.4 24.45 25.174999999999997 25 25.650000000000002 24.65 22.6 27.1 26 26.25 25.45 23.35 24.95 27 25.7 25.074999999999996 23.849999999999998 25.374999999999996 28 25.95 24.325 22.8 26.924999999999997 29 26.125 24.224999999999998 23.125 26.525 30 25.4 23.825 24.45 26.325 31 25.4 24.4 23.325000000000003 26.875 32 27.056764191047762 24.90622655663916 22.930732683170792 25.10627656914228 33 25.05 24.625 24.55 25.775 34 26.724999999999998 23.7 23.200000000000003 26.375 35 26.424999999999997 25.074999999999996 23.425 25.074999999999996 36 24.875 24.625 24.725 25.775 37 26.250942921800352 23.91249685692733 24.013075182298216 25.823485038974102 38 26.3631815907954 23.51175587793897 24.012006003001503 26.113056528264135 39 25.0 23.275000000000002 23.95 27.775 40 25.324999999999996 23.7 23.525 27.450000000000003 41 25.575 24.775 22.8 26.85 42 24.47106806015804 24.16517970940607 24.547540147846036 26.816212082589853 43 25.69587628865979 23.505154639175256 24.072164948453608 26.72680412371134 44 27.377136752136757 24.358974358974358 23.397435897435898 24.86645299145299 45 24.87019730010384 25.31152647975078 22.71547248182762 27.102803738317753 46 25.006546216286985 25.032731081434928 23.33071484681854 26.630007855459542 47 25.10088781275222 24.07855797686306 24.347592144202313 26.472962066182404 48 25.241157556270092 25.562700964630224 23.070739549839228 26.12540192926045 49 25.576923076923073 25.10989010989011 23.406593406593405 25.90659340659341 50 25.997392438070406 24.928292046936114 22.894393741851367 26.179921773142112 51 25.113579000504792 23.801110550227158 23.674911660777383 27.41039878849066 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 2.0 22 4.0 23 2.5 24 1.0 25 3.5 26 8.5 27 11.0 28 20.5 29 30.0 30 43.0 31 56.0 32 66.0 33 76.0 34 95.5 35 115.0 36 132.0 37 149.0 38 173.0 39 197.0 40 216.0 41 235.0 42 255.0 43 275.0 44 283.5 45 292.0 46 289.5 47 287.0 48 262.0 49 237.0 50 251.5 51 266.0 52 238.5 53 211.0 54 220.5 55 230.0 56 207.5 57 185.0 58 179.5 59 174.0 60 165.0 61 156.0 62 152.5 63 149.0 64 137.0 65 125.0 66 120.5 67 116.0 68 114.0 69 112.0 70 100.0 71 88.0 72 76.0 73 64.0 74 58.5 75 48.0 76 43.0 77 36.0 78 29.0 79 21.5 80 14.0 81 9.0 82 4.0 83 5.0 84 6.0 85 4.5 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.65 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.025 33 0.0 34 0.0 35 0.0 36 0.0 37 0.575 38 0.05 39 0.0 40 0.0 41 0.0 42 1.925 43 3.0 44 6.4 45 3.6999999999999997 46 4.5249999999999995 47 7.074999999999999 48 6.7 49 9.0 50 4.125 51 0.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822304 spots for SRR6892995.sra Written 822304 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra Read 822299 spots for SRR6892995.sra Written 822299 spots for SRR6892995.sra SRR ids: ['SRR6892995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ndqlqs2d SRR6892995.sra spots: 16445985 blocks: [[1, 822299], [822300, 1644598], [1644599, 2466897], [2466898, 3289196], [3289197, 4111495], [4111496, 4933794], [4933795, 5756093], [5756094, 6578392], [6578393, 7400691], [7400692, 8222990], [8222991, 9045289], [9045290, 9867588], [9867589, 10689887], [10689888, 11512186], [11512187, 12334485], [12334486, 13156784], [13156785, 13979083], [13979084, 14801382], [14801383, 15623681], [15623682, 16445985]] SRR6892995 file size 2871667 SRR6892995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892995 SRR6892995_1.fastq Input file: SRR6892995_1.fastq trimmed: SRR6892995-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:09:31 2024 >> started Fri Dec 6 14:09:42 2024 >> done (11.783s) 16445985 reads processed; of these: 2322 ( 0.01%) short reads filtered out after trimming by size control 551 ( 0.00%) empty reads filtered out after trimming by size control 16443112 (99.98%) reads available; of these: 427773 ( 2.60%) trimmed reads available after processing 16015339 (97.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 95 0.00% 19 70 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 3 0.00% 24 2 0.00% 25 7 0.00% 26 10 0.00% 27 10 0.00% 28 10 0.00% 29 14 0.00% 30 23 0.00% 31 33 0.00% 32 43 0.00% 33 76 0.00% 34 558 0.00% 35 187 0.00% 36 134 0.00% 37 176 0.00% 38 500 0.00% 39 918 0.01% 40 683 0.00% 41 2315 0.01% 42 1560 0.01% 43 2068 0.01% 44 2416 0.01% 45 3838 0.02% 46 6868 0.04% 47 11664 0.07% 48 24881 0.15% 49 81307 0.49% 50 287304 1.75% 51 16015339 97.40% 16443112 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.13 prefix-fanout=2.0 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=203.07 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=18.8 sequence=GCCGCCGCCACC Started job on | Dec 06 14:09:53 Started mapping on | Dec 06 14:09:53 Finished on | Dec 06 14:10:14 Mapping speed, Million of reads per hour | 2818.82 Number of input reads | 16443112 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 15526153 Uniquely mapped reads % | 94.42% Average mapped length | 50.81 Number of splices: Total | 2415286 Number of splices: Annotated (sjdb) | 2319859 Number of splices: GT/AG | 2383690 Number of splices: GC/AG | 28741 Number of splices: AT/AC | 1412 Number of splices: Non-canonical | 1443 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438049 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 378393 % of reads mapped to too many loci | 2.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 478910 478910 478910 N_multimapping 438049 438049 438049 N_noFeature 638432 7962133 8003532 N_ambiguous 223197 14337 11446 UnstrandedReadsAssigned:14664524 PositiveStrandReadsAssigned:7549683 NegativeStrandReadsAssigned:7511175 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892995 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892995-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,443,112 reads, 14,591,155 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52973 SRR6892995.ke.tsv 35125 SRR6892995.se.tsv 88098 total ==> SRR6892995.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 45.3715 6.01647 PNS24247 1044 945 12.1564 1.42777 PNS24249 1928 1829 171.159 10.3865 PNS24246 1044 945 12.1564 1.42777 PNS24248 1044 945 12.1564 1.42777 PNS24244 1471 1372 0 0 PNS24243 293 194 6 3.43268 KQK14069 1603 1504 500.801 36.9574 KQK14071 474 375 205.752 60.8972 ==> SRR6892995.se.tsv <== BRADI_1g14170v3 809 BRADI_1g53295v3 183 BRADI_1g59795v3 292 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 1343 BRADI_1g74790v3 185 BRADI_1g09890v3 5 BRADI_1g77505v3 154 BRADI_1g48960v3 0 SRR6892995 completed mapping pipeline successfully