Starting /dee2/code/volunteer_pipeline.sh SRR6892996 current disk space = 1550658928640 free memory = 1601644136 SRR6892996 SRAfilesize 619e29a578b82ee4f420766e1f6147a3 SRR6892996.sra SRR6892996.sra file validated SRR6892996 is single end SRR6892996 is conventional basespace SRR6892996 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.834 31.0 31.0 34.0 30.0 34.0 2 31.92425 31.0 31.0 34.0 30.0 34.0 3 31.914 31.0 31.0 34.0 30.0 34.0 4 35.53675 37.0 35.0 37.0 33.0 37.0 5 35.26525 37.0 35.0 37.0 33.0 37.0 6 35.14625 37.0 35.0 37.0 32.0 37.0 7 35.29125 37.0 35.0 37.0 32.0 37.0 8 35.08975 37.0 35.0 37.0 32.0 37.0 9 36.08125 38.0 35.0 39.0 30.0 39.0 10 36.39175 39.0 35.0 39.0 32.0 39.0 11 36.58075 39.0 35.0 39.0 32.0 39.0 12 36.6995 39.0 35.0 39.0 32.0 39.0 13 36.68875 39.0 35.0 39.0 32.0 39.0 14 37.696 40.0 37.0 41.0 32.0 41.0 15 37.808 40.0 37.0 41.0 32.0 41.0 16 37.418 39.0 36.0 41.0 32.0 41.0 17 37.62225 39.0 37.0 41.0 32.0 41.0 18 37.58775 39.0 37.0 41.0 32.0 41.0 19 37.6725 40.0 37.0 41.0 32.0 41.0 20 37.54975 39.0 36.0 41.0 32.0 41.0 21 37.4285 39.0 36.0 41.0 31.0 41.0 22 37.23025 39.0 36.0 40.0 31.0 41.0 23 37.038 39.0 36.0 40.0 31.0 41.0 24 37.0485 39.0 36.0 40.0 31.0 41.0 25 37.00925 39.0 36.0 40.0 31.0 41.0 26 36.90025 39.0 36.0 40.0 31.0 41.0 27 36.7565 39.0 36.0 40.0 30.0 41.0 28 36.4455 38.0 35.0 40.0 30.0 41.0 29 36.55525 39.0 35.0 40.0 30.0 41.0 30 36.383 38.0 35.0 40.0 30.0 41.0 31 36.26875 38.0 35.0 40.0 30.0 41.0 32 36.30725 38.0 35.0 40.0 30.0 41.0 33 35.80525 38.0 34.0 40.0 28.0 41.0 34 35.85975 38.0 34.0 40.0 28.0 41.0 35 35.825 38.0 34.0 40.0 28.0 41.0 36 35.87775 38.0 34.0 40.0 28.0 41.0 37 35.848 38.0 35.0 40.0 28.0 41.0 38 35.8325 38.0 34.0 40.0 28.0 41.0 39 35.931 38.0 34.0 40.0 27.0 41.0 40 35.76375 38.0 34.0 40.0 27.0 41.0 41 35.674 38.0 34.0 40.0 26.0 41.0 42 34.65125 38.0 33.0 40.0 25.0 41.0 43 34.35975 38.0 33.0 40.0 23.0 41.0 44 32.9045 38.0 31.0 40.0 14.0 41.0 45 33.1105 37.0 31.0 40.0 15.0 41.0 46 33.128 37.0 31.0 40.0 18.0 41.0 47 32.3875 37.0 31.0 40.0 12.0 41.0 48 32.3235 37.0 31.0 40.0 11.0 41.0 49 31.20025 36.0 29.0 40.0 2.0 41.0 50 31.46975 35.0 29.0 40.0 12.0 41.0 51 32.16875 36.0 29.0 40.0 13.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 3.0 19 1.0 20 2.0 21 11.0 22 8.0 23 15.0 24 28.0 25 35.0 26 55.0 27 94.0 28 91.0 29 106.0 30 119.0 31 150.0 32 244.0 33 244.0 34 257.0 35 319.0 36 369.0 37 422.0 38 605.0 39 819.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.63781890945473 11.85592796398199 10.305152576288144 52.201100550275136 2 22.95 17.875 34.150000000000006 25.025 3 22.125 22.475 24.075 31.324999999999996 4 26.174999999999997 28.65 17.575 27.6 5 29.488793754721733 29.312515739108534 20.17124150088139 21.02744900528834 6 21.9 32.65 20.95 24.5 7 21.625 16.1 37.574999999999996 24.7 8 23.625 20.75 26.625 28.999999999999996 9 21.55 20.4 30.825000000000003 27.224999999999998 10 24.474999999999998 32.375 22.1 21.05 11 29.575000000000003 22.275 18.2 29.95 12 24.3 20.75 25.85 29.099999999999998 13 24.7 22.525000000000002 26.85 25.924999999999997 14 24.675 24.15 24.05 27.125 15 25.324999999999996 23.674999999999997 24.4 26.6 16 26.3 22.5 24.25 26.950000000000003 17 24.975 24.15 23.525 27.35 18 25.7 23.200000000000003 24.224999999999998 26.875 19 25.724999999999998 24.625 22.400000000000002 27.250000000000004 20 26.674999999999997 24.775 23.575 24.975 21 25.95 23.825 22.85 27.375 22 26.224999999999998 22.425 25.25 26.1 23 25.525 23.025000000000002 24.55 26.900000000000002 24 26.525 23.9 22.375 27.200000000000003 25 25.724999999999998 23.65 22.95 27.675 26 27.1 24.875 23.45 24.575 27 26.650000000000002 23.925 24.025 25.4 28 25.650000000000002 23.65 22.95 27.750000000000004 29 26.174999999999997 24.05 22.6 27.175 30 24.975 23.674999999999997 23.474999999999998 27.875 31 24.875 22.3 25.074999999999996 27.750000000000004 32 25.256314078519633 23.20580145036259 23.43085771442861 28.107026756689173 33 26.125 23.525 24.125 26.224999999999998 34 26.150000000000002 24.2 22.575 27.075 35 25.900000000000002 23.45 23.875 26.775 36 25.374999999999996 23.425 24.725 26.474999999999998 37 26.102292768959433 21.99546485260771 23.507180650037792 28.39506172839506 38 26.638319159579787 23.336668334167083 23.386693346673336 26.638319159579787 39 25.7 24.3 23.5 26.5 40 26.174999999999997 23.549999999999997 23.1 27.175 41 27.625 23.425 23.125 25.825 42 25.389129880071447 24.06226078081143 24.521561622862976 26.02704771625415 43 26.594371288406922 23.10870126516912 22.592305706170926 27.70462174025303 44 27.214170692431562 21.175523349436393 24.530327428878156 27.07997852925389 45 25.05879278808466 23.961327410504314 23.673896002090412 27.305983799320614 46 25.47418335089568 24.552160168598526 23.182297154899896 26.791359325605903 47 26.38700947225981 24.519621109607577 23.464140730717187 25.629228687415427 48 25.659666128163707 23.801830910070006 22.886375875067312 27.652127086698975 49 25.71667130531589 23.879766212079044 23.267464514333426 27.13609796827164 50 25.990034093889324 24.468922108575924 23.000262260687123 26.540781536847625 51 24.62082912032356 23.407482305358947 24.443882709807887 27.52780586450961 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 5.5 26 11.0 27 14.0 28 24.0 29 34.0 30 40.0 31 46.0 32 57.5 33 69.0 34 85.0 35 101.0 36 117.0 37 133.0 38 160.5 39 188.0 40 213.5 41 239.0 42 252.0 43 265.0 44 254.0 45 243.0 46 259.0 47 275.0 48 257.5 49 240.0 50 249.5 51 259.0 52 240.5 53 222.0 54 215.0 55 208.0 56 202.5 57 197.0 58 188.5 59 180.0 60 178.5 61 177.0 62 166.5 63 156.0 64 159.5 65 163.0 66 152.5 67 142.0 68 122.5 69 103.0 70 99.0 71 95.0 72 85.5 73 76.0 74 61.5 75 43.0 76 39.0 77 34.5 78 30.0 79 28.0 80 26.0 81 18.0 82 10.0 83 6.5 84 3.0 85 2.5 86 2.0 87 1.5 88 1.0 89 2.0 90 3.0 91 2.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.7250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.025 33 0.0 34 0.0 35 0.0 36 0.0 37 0.775 38 0.05 39 0.0 40 0.0 41 0.0 42 2.025 43 3.175 44 6.8500000000000005 45 4.324999999999999 46 5.1 47 7.625 48 7.1499999999999995 49 10.174999999999999 50 4.675 51 1.0999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033134 spots for SRR6892996.sra Written 1033134 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra Read 1033124 spots for SRR6892996.sra Written 1033124 spots for SRR6892996.sra SRR ids: ['SRR6892996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rjfn_xsl SRR6892996.sra spots: 20662490 blocks: [[1, 1033124], [1033125, 2066248], [2066249, 3099372], [3099373, 4132496], [4132497, 5165620], [5165621, 6198744], [6198745, 7231868], [7231869, 8264992], [8264993, 9298116], [9298117, 10331240], [10331241, 11364364], [11364365, 12397488], [12397489, 13430612], [13430613, 14463736], [14463737, 15496860], [15496861, 16529984], [16529985, 17563108], [17563109, 18596232], [18596233, 19629356], [19629357, 20662490]] SRR6892996 file size 3610732 SRR6892996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892996 SRR6892996_1.fastq Input file: SRR6892996_1.fastq trimmed: SRR6892996-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:10:00 2024 >> started Fri Dec 6 14:10:12 2024 >> done (11.624s) 20662490 reads processed; of these: 3525 ( 0.02%) short reads filtered out after trimming by size control 1854 ( 0.01%) empty reads filtered out after trimming by size control 20657111 (99.97%) reads available; of these: 563491 ( 2.73%) trimmed reads available after processing 20093620 (97.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 158 0.00% 19 115 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 4 0.00% 25 17 0.00% 26 10 0.00% 27 16 0.00% 28 18 0.00% 29 21 0.00% 30 36 0.00% 31 38 0.00% 32 66 0.00% 33 108 0.00% 34 709 0.00% 35 201 0.00% 36 165 0.00% 37 206 0.00% 38 574 0.00% 39 1221 0.01% 40 862 0.00% 41 2784 0.01% 42 2007 0.01% 43 2612 0.01% 44 3004 0.01% 45 4847 0.02% 46 8880 0.04% 47 15158 0.07% 48 33077 0.16% 49 106889 0.52% 50 379681 1.84% 51 20093620 97.27% 20657111 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=19 prefix-density=0.15 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=141.26 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=19.5 sequence=CCGCCGCCGCCA Started job on | Dec 06 14:10:25 Started mapping on | Dec 06 14:10:26 Finished on | Dec 06 14:10:51 Mapping speed, Million of reads per hour | 2974.62 Number of input reads | 20657111 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 18994291 Uniquely mapped reads % | 91.95% Average mapped length | 50.81 Number of splices: Total | 2953252 Number of splices: Annotated (sjdb) | 2836965 Number of splices: GT/AG | 2914574 Number of splices: GC/AG | 35282 Number of splices: AT/AC | 1599 Number of splices: Non-canonical | 1797 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 620116 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 870374 % of reads mapped to too many loci | 4.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1042704 1042704 1042704 N_multimapping 620116 620116 620116 N_noFeature 731836 9727558 9748185 N_ambiguous 282687 19222 14957 UnstrandedReadsAssigned:17979768 PositiveStrandReadsAssigned:9247511 NegativeStrandReadsAssigned:9231149 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR6892996 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6892996-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,657,111 reads, 17,917,631 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,312 rounds 52973 SRR6892996.ke.tsv 35125 SRR6892996.se.tsv 88098 total ==> SRR6892996.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 53.8606 5.58532 PNS24247 1044 945 23.0407 2.11625 PNS24249 1928 1829 197.046 9.35098 PNS24246 1044 945 23.0407 2.11625 PNS24248 1044 945 23.0407 2.11625 PNS24244 1471 1372 15.9708 1.01036 PNS24243 293 194 3 1.34221 KQK14069 1603 1504 1211.28 69.9035 KQK14071 474 375 420.398 97.3043 ==> SRR6892996.se.tsv <== BRADI_1g14170v3 1843 BRADI_1g53295v3 232 BRADI_1g59795v3 315 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 1548 BRADI_1g74790v3 210 BRADI_1g09890v3 7 BRADI_1g77505v3 163 BRADI_1g48960v3 1 SRR6892996 completed mapping pipeline successfully