Starting /dee2/code/volunteer_pipeline.sh SRR6940283 current disk space = 1551860346880 free memory = 1301576640 SRR6940283 SRAfilesize 07fd7399d63bd06e7ae904b1f3838111 SRR6940283.sra SRR6940283.sra file validated SRR6940283 is paired end SRR6940283 is conventional basespace SRR6940283 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940283_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.10625 34.0 31.0 34.0 23.0 34.0 2 31.7265 34.0 33.0 34.0 25.0 34.0 3 32.835 34.0 33.0 34.0 28.0 34.0 4 36.47525 37.0 37.0 37.0 35.0 37.0 5 36.484 37.0 37.0 37.0 35.0 37.0 6 36.54375 37.0 37.0 37.0 35.0 37.0 7 36.5515 37.0 37.0 37.0 35.0 37.0 8 36.52825 37.0 37.0 37.0 35.0 37.0 9 38.35575 39.0 39.0 39.0 37.0 39.0 10-14 38.73175 39.4 39.2 39.4 37.2 39.4 15-19 40.010000000000005 41.0 40.0 41.0 38.0 41.0 20-24 39.79944999999999 41.0 40.0 41.0 37.4 41.0 25-29 39.464800000000004 41.0 39.8 41.0 36.0 41.0 30-34 38.989999999999995 41.0 38.8 41.0 35.0 41.0 35-39 38.48135 40.2 37.6 41.0 35.0 41.0 40-44 37.80385 40.0 35.4 41.0 33.4 41.0 45-49 37.08485 39.0 35.0 41.0 33.0 41.0 50-54 36.58895 37.6 35.0 41.0 33.0 41.0 55-59 36.15935 36.4 35.0 40.6 33.0 41.0 60-64 35.41275 35.0 35.0 39.4 31.8 41.0 65-69 34.65475 35.0 35.0 38.0 31.0 40.8 70-74 33.9236 35.0 34.2 36.4 30.0 39.0 75-79 32.9516 34.8 33.2 35.2 28.8 37.2 80-84 33.01604999999999 35.0 34.0 35.0 29.6 36.2 85-89 32.617000000000004 35.0 33.8 35.0 29.0 35.4 90-94 32.26665 35.0 33.0 35.0 27.0 35.0 95-99 32.013999999999996 35.0 33.0 35.0 27.0 35.0 100-104 31.735500000000002 35.0 33.0 35.0 25.4 35.0 105-109 31.4972 35.0 33.0 35.0 24.4 35.0 110-114 31.083050000000004 35.0 32.2 35.0 23.2 35.0 115-119 30.3524 34.2 31.2 35.0 18.8 35.0 120-124 29.950149999999997 34.0 30.8 35.0 15.6 35.0 125-129 29.5319 34.0 30.4 35.0 9.0 35.0 130-134 28.91515 34.0 29.0 35.0 2.0 35.0 135-139 28.180400000000002 33.4 28.2 35.0 2.0 35.0 140-144 27.153950000000002 33.0 26.2 35.0 2.0 35.0 145-149 25.821499999999997 33.0 22.0 35.0 2.0 35.0 150 22.235 29.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 3.0 7 4.0 8 12.0 9 10.0 10 8.0 11 4.0 12 16.0 13 11.0 14 12.0 15 10.0 16 17.0 17 15.0 18 21.0 19 22.0 20 16.0 21 24.0 22 23.0 23 20.0 24 44.0 25 46.0 26 48.0 27 45.0 28 53.0 29 74.0 30 89.0 31 109.0 32 197.0 33 242.0 34 391.0 35 693.0 36 1024.0 37 694.0 38 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.2350984197394 10.479622955364569 11.17271971167175 42.112558913224284 2 29.625 12.325 22.2 35.85 3 28.725 13.15 16.025 42.1 4 33.95 17.424999999999997 14.975 33.650000000000006 5 34.525 21.875 19.15 24.45 6 34.0 23.3 18.625 24.075 7 24.5 26.525 27.625 21.349999999999998 8 25.3 23.5 25.5 25.7 9 26.650000000000002 19.225 27.725 26.400000000000002 10-14 26.58 24.025 21.765 27.63 15-19 26.985 22.470000000000002 22.555 27.99 20-24 27.46 22.785 21.845 27.91 25-29 27.51 22.085 21.95 28.455000000000002 30-34 27.089999999999996 22.0 22.28 28.63 35-39 28.075 22.275 21.575 28.075 40-44 27.245 22.009999999999998 22.08 28.665000000000003 45-49 27.310000000000002 22.165000000000003 22.314999999999998 28.21 50-54 27.68 21.6 21.529999999999998 29.189999999999998 55-59 27.63 21.365000000000002 22.009999999999998 28.994999999999997 60-64 28.265 21.64 21.404999999999998 28.689999999999998 65-69 28.645 21.665 21.215 28.475 70-74 28.12 22.115000000000002 21.41 28.355000000000004 75-79 28.58 21.48 21.404999999999998 28.535 80-84 28.549999999999997 21.335 21.145 28.970000000000002 85-89 27.93 21.584999999999997 21.560000000000002 28.925 90-94 28.815 21.060000000000002 21.64 28.485 95-99 27.93 21.224999999999998 21.46 29.385 100-104 27.944999999999997 21.425 21.58 29.049999999999997 105-109 28.625 21.135 21.55 28.689999999999998 110-114 29.13 20.865000000000002 21.015 28.99 115-119 29.158502888721426 20.612911328811855 21.351419241396634 28.877166541070082 120-124 28.6600310108538 21.2874506077127 21.077377081978693 28.97514129945481 125-129 28.799999999999997 21.195 21.355 28.65 130-134 28.875 21.905 20.044999999999998 29.175 135-139 29.32 21.57 20.51 28.599999999999998 140-144 29.811490574528726 21.91609580479024 19.76598829941497 28.506425321266065 145-149 29.2 22.15 19.595000000000002 29.054999999999996 150 30.5 22.05 17.95 29.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 2.5 27 2.5 28 2.0 29 1.5 30 4.0 31 4.5 32 4.5 33 12.0 34 16.0 35 19.5 36 26.5 37 32.5 38 40.0 39 60.5 40 78.5 41 80.0 42 91.5 43 100.5 44 101.5 45 112.0 46 119.0 47 117.5 48 109.0 49 113.0 50 115.5 51 105.5 52 111.0 53 105.5 54 90.0 55 86.5 56 91.0 57 90.0 58 90.5 59 102.5 60 98.5 61 91.5 62 95.5 63 97.0 64 105.0 65 112.0 66 102.0 67 103.5 68 108.0 69 100.5 70 101.5 71 94.0 72 86.0 73 78.5 74 66.0 75 61.0 76 53.5 77 41.5 78 35.0 79 28.0 80 22.5 81 20.5 82 13.5 83 11.5 84 9.5 85 4.5 86 3.5 87 3.5 88 2.5 89 2.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.825000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.475 120-124 0.034999999999999996 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03135355595208 97.125 2 0.9176650522559266 1.7999999999999998 3 0.0 0.0 4 0.025490695895997964 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025490695895997964 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 39 0.975 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.925 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.9875 0.0 0.0 0.0 0.0 138 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCA 35 0.0034363356 61.569645 7 AGAGCAC 35 0.0034363356 61.569645 8 GAGCACA 45 0.009291459 47.8875 9 AAAAAAA 55 5.204525E-6 20.896364 65-69 >>END_MODULE SRR6940283 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940283_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69125 34.0 33.0 34.0 31.0 34.0 2 32.8695 34.0 34.0 34.0 31.0 34.0 3 32.8875 34.0 34.0 34.0 31.0 34.0 4 36.1885 37.0 37.0 37.0 35.0 37.0 5 36.1275 37.0 37.0 37.0 35.0 37.0 6 36.11775 37.0 37.0 37.0 35.0 37.0 7 36.047 37.0 37.0 37.0 35.0 37.0 8 36.0215 37.0 37.0 37.0 35.0 37.0 9 37.7715 39.0 39.0 39.0 37.0 39.0 10-14 37.979 39.4 39.2 39.4 37.2 39.4 15-19 39.024950000000004 41.0 40.0 41.0 37.2 41.0 20-24 38.697050000000004 41.0 40.0 41.0 36.2 41.0 25-29 38.35095 41.0 39.4 41.0 35.0 41.0 30-34 37.81455 40.2 38.0 41.0 33.8 41.0 35-39 37.2028 40.0 36.6 41.0 32.8 41.0 40-44 36.4128 39.4 35.0 41.0 31.4 41.0 45-49 35.55065 38.0 35.0 41.0 29.8 41.0 50-54 33.98485000000001 35.8 33.2 39.6 25.8 40.6 55-59 34.13855 35.0 34.0 39.8 26.0 41.0 60-64 33.8298 35.0 34.2 38.8 26.8 41.0 65-69 33.137299999999996 35.0 33.8 36.8 26.2 40.2 70-74 32.39935 35.0 33.2 35.6 25.4 38.6 75-79 31.599149999999998 35.0 33.0 35.0 23.4 36.8 80-84 30.940949999999997 35.0 32.2 35.0 19.8 35.8 85-89 30.3199 35.0 31.4 35.0 15.2 35.0 90-94 29.811199999999996 34.2 31.0 35.0 5.8 35.0 95-99 29.217899999999997 34.0 30.0 35.0 2.0 35.0 100-104 28.5476 34.0 29.0 35.0 2.0 35.0 105-109 27.889249999999997 33.6 27.0 35.0 2.0 35.0 110-114 27.147200000000005 33.0 25.8 35.0 2.0 35.0 115-119 26.38595 33.0 23.8 35.0 2.0 35.0 120-124 25.44605 32.0 20.4 34.4 2.0 35.0 125-129 24.535400000000003 31.2 17.0 34.0 2.0 35.0 130-134 23.38355 30.6 5.2 34.0 2.0 35.0 135-139 22.33345 29.6 2.0 34.0 2.0 35.0 140-144 20.905250000000002 28.6 2.0 34.0 2.0 35.0 145-149 19.09815 26.0 2.0 33.0 2.0 35.0 150 16.379 18.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 20.0 4 14.0 5 15.0 6 16.0 7 21.0 8 14.0 9 10.0 10 8.0 11 19.0 12 11.0 13 18.0 14 20.0 15 19.0 16 24.0 17 35.0 18 36.0 19 31.0 20 48.0 21 36.0 22 43.0 23 51.0 24 66.0 25 73.0 26 90.0 27 88.0 28 117.0 29 125.0 30 149.0 31 177.0 32 227.0 33 292.0 34 418.0 35 546.0 36 730.0 37 345.0 38 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.475 13.575000000000001 10.299999999999999 43.65 2 32.6 17.95 18.45 31.0 3 28.9 20.549999999999997 17.875 32.675 4 33.825 19.575 17.025000000000002 29.575000000000003 5 34.75 23.325000000000003 18.175 23.75 6 28.8144072036018 28.68934467233617 16.708354177088545 25.78789394697349 7 27.463731865932967 16.833416708354175 28.639319659829916 27.063531765882942 8 28.02802802802803 19.51951951951952 21.446446446446448 31.006006006006004 9 26.608260325406757 21.32665832290363 23.028785982478098 29.036295369211512 10-14 29.122034237661428 22.9202122334568 19.92691961157273 28.03083391730904 15-19 28.75250501002004 21.52304609218437 20.941883767535067 28.782565130260522 20-24 29.27623340846481 21.692962684698223 20.315552216378663 28.715251690458306 25-29 28.894786919725572 21.903951124242578 20.70208823676699 28.49917371926486 30-34 28.542804187747333 22.020738365977056 20.888643991384058 28.547813454891553 35-39 28.56426709444556 21.55604571886906 21.109885702827352 28.769801483858032 40-44 29.713340683572216 21.21880324746918 20.53222411546557 28.535631953493034 45-49 29.07314629258517 21.037074148296593 20.67635270541082 29.213426853707414 50-54 29.547391108215127 20.95133076036289 20.495213272517667 29.006064858904317 55-59 29.29247408742677 20.57984076911522 21.090581342947274 29.03710380051074 60-64 28.582156803845 21.79833783919095 20.751977570842094 28.86752778612196 65-69 28.205256570713395 21.95744680851064 20.84105131414268 28.996245306633288 70-74 29.12140175219024 21.85732165206508 20.320400500625784 28.7008760951189 75-79 28.747371583057973 21.698207669970962 20.817062180835087 28.737358566135978 80-84 29.19835868694956 21.887510008006405 20.16613290632506 28.747998398718977 85-89 29.044044044044043 21.166166166166168 20.61061061061061 29.179179179179176 90-94 28.78029240937312 21.234728620068093 20.568796314840775 29.416182655718004 95-99 29.394957140708804 21.47977342222668 20.43711464233796 28.68815479472655 100-104 29.31267859828546 21.256329272572316 20.694841329523236 28.736150799618994 105-109 29.225916282795914 20.89425195273383 20.473663128379734 29.40616863609053 110-114 29.73744864214851 21.49012927147009 19.886762200621305 28.885659885760095 115-119 29.70858203340523 21.041280032101117 20.690174048251993 28.55996388624166 120-124 30.218568277521555 20.558451975135352 20.222578704632042 29.00040104271105 125-129 30.105589751288598 21.218035330030528 20.347295200920783 28.3290797177601 130-134 30.192740926157697 21.27659574468085 20.020025031289112 28.510638297872344 135-139 30.521987664844808 20.70400641829213 19.871634157348442 28.902371759514615 140-144 31.221492657009676 21.758307854242894 19.537867776051325 27.482331712696105 145-149 32.04364582811953 21.943040192201813 18.714650382902047 27.298663596776617 150 31.715857928964482 22.736368184092047 17.358679339669834 28.189094547273637 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 0.5 29 1.0 30 2.5 31 3.0 32 3.5 33 5.5 34 7.0 35 11.0 36 20.5 37 27.0 38 37.5 39 47.5 40 52.5 41 62.5 42 80.5 43 101.0 44 111.5 45 112.0 46 108.0 47 106.5 48 98.0 49 98.0 50 101.0 51 90.0 52 97.0 53 102.0 54 94.0 55 83.5 56 82.0 57 94.5 58 102.5 59 110.5 60 114.5 61 108.0 62 100.5 63 94.5 64 97.5 65 108.0 66 111.0 67 112.5 68 117.0 69 119.0 70 110.0 71 108.5 72 109.0 73 91.0 74 77.0 75 69.0 76 60.0 77 53.5 78 43.0 79 32.0 80 26.0 81 16.0 82 12.0 83 13.0 84 6.5 85 4.0 86 3.5 87 5.0 88 5.0 89 1.5 90 1.0 91 1.0 92 1.5 93 1.5 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.1 9 0.125 10-14 0.11 15-19 0.2 20-24 0.17500000000000002 25-29 0.155 30-34 0.185 35-39 0.26 40-44 0.22999999999999998 45-49 0.2 50-54 0.245 55-59 0.145 60-64 0.13 65-69 0.125 70-74 0.125 75-79 0.13 80-84 0.08 85-89 0.1 90-94 0.13999999999999999 95-99 0.255 100-104 0.265 105-109 0.13999999999999999 110-114 0.21 115-119 0.315 120-124 0.26 125-129 0.08499999999999999 130-134 0.125 135-139 0.28500000000000003 140-144 0.245 145-149 0.105 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.175 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.8375 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTCC 10 0.0071353805 142.9 6 AAAAAAA 250 9.17089E-7 8.574 60-64 >>END_MODULE Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657953 spots for SRR6940283.sra Written 2657953 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra Read 2657951 spots for SRR6940283.sra Written 2657951 spots for SRR6940283.sra SRR ids: ['SRR6940283.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zcqj7mdc SRR6940283.sra spots: 53159022 blocks: [[1, 2657951], [2657952, 5315902], [5315903, 7973853], [7973854, 10631804], [10631805, 13289755], [13289756, 15947706], [15947707, 18605657], [18605658, 21263608], [21263609, 23921559], [23921560, 26579510], [26579511, 29237461], [29237462, 31895412], [31895413, 34553363], [34553364, 37211314], [37211315, 39869265], [39869266, 42527216], [42527217, 45185167], [45185168, 47843118], [47843119, 50501069], [50501070, 53159022]] SRR6940283 file size 17888321 SRR6940283 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6940283 SRR6940283_1.fastq SRR6940283_2.fastq Input file: SRR6940283_1.fastq Paired file: SRR6940283_2.fastq trimmed: SRR6940283-trimmed-pair1.fastq, SRR6940283-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:27:01 2024 >> started Fri Dec 6 10:28:51 2024 >> done (109.564s) 53159022 read pairs processed; of these: 274631 ( 0.52%) short read pairs filtered out after trimming by size control 535483 ( 1.01%) empty read pairs filtered out after trimming by size control 52348908 (98.48%) read pairs available; of these: 29542174 (56.43%) trimmed read pairs available after processing 22806734 (43.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 275 0.00% 19 1584 0.00% 20 736 0.00% 21 676 0.00% 22 1080 0.00% 23 1385 0.00% 24 1844 0.00% 25 2075 0.00% 26 2522 0.00% 27 3040 0.01% 28 3543 0.01% 29 3883 0.01% 30 4275 0.01% 31 4627 0.01% 32 5087 0.01% 33 5457 0.01% 34 5674 0.01% 35 6023 0.01% 36 6182 0.01% 37 6598 0.01% 38 6944 0.01% 39 7111 0.01% 40 7439 0.01% 41 7699 0.01% 42 8280 0.02% 43 8305 0.02% 44 8738 0.02% 45 8845 0.02% 46 9290 0.02% 47 9406 0.02% 48 9602 0.02% 49 9968 0.02% 50 10127 0.02% 51 10551 0.02% 52 10604 0.02% 53 10866 0.02% 54 11328 0.02% 55 11424 0.02% 56 11829 0.02% 57 12090 0.02% 58 12321 0.02% 59 12821 0.02% 60 12918 0.02% 61 13199 0.03% 62 13920 0.03% 63 14158 0.03% 64 14738 0.03% 65 15583 0.03% 66 16336 0.03% 67 16995 0.03% 68 17920 0.03% 69 18948 0.04% 70 19768 0.04% 71 21064 0.04% 72 21716 0.04% 73 23042 0.04% 74 24554 0.05% 75 27664 0.05% 76 28154 0.05% 77 30090 0.06% 78 30623 0.06% 79 32512 0.06% 80 34446 0.07% 81 36942 0.07% 82 39322 0.08% 83 42536 0.08% 84 53784 0.10% 85 57897 0.11% 86 60785 0.12% 87 63698 0.12% 88 66002 0.13% 89 67779 0.13% 90 70867 0.14% 91 72203 0.14% 92 73923 0.14% 93 75292 0.14% 94 77821 0.15% 95 80240 0.15% 96 83090 0.16% 97 83956 0.16% 98 86960 0.17% 99 88810 0.17% 100 83127 0.16% 101 83744 0.16% 102 94250 0.18% 103 95514 0.18% 104 102497 0.20% 105 113827 0.22% 106 119680 0.23% 107 120546 0.23% 108 137171 0.26% 109 145694 0.28% 110 146589 0.28% 111 149558 0.29% 112 159518 0.30% 113 166533 0.32% 114 181280 0.35% 115 216514 0.41% 116 213485 0.41% 117 217939 0.42% 118 226853 0.43% 119 263694 0.50% 120 268042 0.51% 121 288974 0.55% 122 311886 0.60% 123 314434 0.60% 124 314203 0.60% 125 316839 0.61% 126 383499 0.73% 127 389729 0.74% 128 407124 0.78% 129 449825 0.86% 130 469761 0.90% 131 500792 0.96% 132 507056 0.97% 133 552729 1.06% 134 579864 1.11% 135 607981 1.16% 136 654871 1.25% 137 691184 1.32% 138 713849 1.36% 139 741017 1.42% 140 784227 1.50% 141 825570 1.58% 142 894055 1.71% 143 967339 1.85% 144 1065458 2.04% 145 1209072 2.31% 146 1444768 2.76% 147 1800225 3.44% 148 2272398 4.34% 149 3764981 7.19% 150 22806734 43.57% 52348908 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=14 prefix-density=0.95 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=16.85 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.6 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=7 prefix-density=0.82 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=68.27 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=5.5 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6940283 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:29:54 Started mapping on | Dec 06 10:29:55 Finished on | Dec 06 10:32:41 Mapping speed, Million of reads per hour | 1135.28 Number of input reads | 52348908 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 49771639 Uniquely mapped reads % | 95.08% Average mapped length | 280.05 Number of splices: Total | 38527966 Number of splices: Annotated (sjdb) | 36620561 Number of splices: GT/AG | 37984608 Number of splices: GC/AG | 460123 Number of splices: AT/AC | 11391 Number of splices: Non-canonical | 71844 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 924494 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 112620 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 1.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1777187 1777187 1777187 N_multimapping 924494 924494 924494 N_noFeature 1100614 40772753 9182100 N_ambiguous 1180418 36577 242324 UnstrandedReadsAssigned:47490607 PositiveStrandReadsAssigned:8962309 NegativeStrandReadsAssigned:40347215 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR6940283 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6940283-trimmed-pair1.fastq SRR6940283-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,348,908 reads, 49,327,352 reads pseudoaligned [quant] estimated average fragment length: 196.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6940283.ke.tsv 35125 SRR6940283.se.tsv 88098 total ==> SRR6940283.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.594 0 0 PNS24247 1044 848.438 35.4857 1.08401 PNS24249 1928 1732.44 355.545 5.3191 PNS24246 1044 848.438 35.4857 1.08401 PNS24248 1044 848.438 35.4857 1.08401 PNS24244 1471 1275.44 86.9975 1.76786 PNS24243 293 104.343 24 5.96141 KQK14069 1603 1407.44 1192.78 21.965 KQK14071 474 280.084 146.705 13.5756 ==> SRR6940283.se.tsv <== BRADI_1g14170v3 1423 BRADI_1g53295v3 90 BRADI_1g59795v3 1043 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 752 BRADI_1g74790v3 1278 BRADI_1g09890v3 3 BRADI_1g77505v3 503 BRADI_1g48960v3 0 SRR6940283 completed mapping pipeline successfully