Starting /dee2/code/volunteer_pipeline.sh SRR6940284 current disk space = 1551880925184 free memory = 1599153460 SRR6940284 SRAfilesize 5127d6db82a3ef839f4126bcd4d5377d SRR6940284.sra SRR6940284.sra file validated SRR6940284 is paired end SRR6940284 is conventional basespace SRR6940284 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940284_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.27325 34.0 31.0 34.0 26.0 34.0 2 31.85425 34.0 33.0 34.0 26.0 34.0 3 32.959 34.0 34.0 34.0 28.0 34.0 4 36.51125 37.0 37.0 37.0 35.0 37.0 5 36.533 37.0 37.0 37.0 35.0 37.0 6 36.596 37.0 37.0 37.0 35.0 37.0 7 36.61225 37.0 37.0 37.0 35.0 37.0 8 36.58975 37.0 37.0 37.0 35.0 37.0 9 38.44125 39.0 39.0 39.0 37.0 39.0 10-14 38.800149999999995 39.4 39.2 39.4 37.2 39.4 15-19 40.0649 41.0 40.0 41.0 38.0 41.0 20-24 39.908950000000004 41.0 40.0 41.0 38.0 41.0 25-29 39.5525 41.0 40.0 41.0 36.4 41.0 30-34 39.16145 41.0 39.0 41.0 35.2 41.0 35-39 38.642900000000004 40.2 37.8 41.0 35.0 41.0 40-44 38.10075 40.0 36.2 41.0 34.4 41.0 45-49 37.459250000000004 39.4 35.0 41.0 33.0 41.0 50-54 37.003 39.0 35.0 41.0 33.0 41.0 55-59 36.682 37.4 35.0 41.0 33.0 41.0 60-64 36.00595 35.6 35.0 39.8 33.0 41.0 65-69 35.3009 35.0 35.0 38.8 32.4 41.0 70-74 34.5691 35.0 35.0 36.8 31.4 39.4 75-79 33.460950000000004 34.8 33.6 35.2 29.6 37.4 80-84 33.44715 35.0 34.0 35.0 31.0 36.6 85-89 33.02120000000001 35.0 34.0 35.0 30.0 36.0 90-94 32.65975 35.0 34.0 35.0 29.2 35.0 95-99 32.3399 35.0 33.2 35.0 27.8 35.0 100-104 31.993899999999996 35.0 33.0 35.0 27.0 35.0 105-109 31.6884 35.0 33.0 35.0 26.2 35.0 110-114 31.386200000000002 35.0 33.0 35.0 24.0 35.0 115-119 30.843 34.8 32.0 35.0 20.8 35.0 120-124 30.413300000000003 34.0 31.2 35.0 19.0 35.0 125-129 30.004399999999997 34.0 30.8 35.0 15.4 35.0 130-134 29.5197 34.0 30.0 35.0 6.2 35.0 135-139 28.90595 34.0 29.2 35.0 2.0 35.0 140-144 27.827800000000003 33.0 27.4 35.0 2.0 35.0 145-149 26.783950000000004 33.0 25.6 35.0 2.0 35.0 150 23.08175 29.0 15.0 33.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 3.0 7 6.0 8 4.0 9 7.0 10 6.0 11 12.0 12 8.0 13 8.0 14 4.0 15 10.0 16 14.0 17 18.0 18 17.0 19 17.0 20 17.0 21 20.0 22 33.0 23 18.0 24 32.0 25 33.0 26 37.0 27 41.0 28 70.0 29 55.0 30 83.0 31 94.0 32 145.0 33 224.0 34 426.0 35 650.0 36 1059.0 37 824.0 38 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.18001104362231 10.767531750414136 11.01601325234677 44.03644395361679 2 28.675 12.174999999999999 23.525 35.625 3 27.875 13.025 17.525 41.575 4 32.95 17.275 15.625 34.150000000000006 5 33.800000000000004 22.975 18.575 24.65 6 32.875 23.974999999999998 18.35 24.8 7 22.725 28.449999999999996 28.475 20.349999999999998 8 25.05 22.900000000000002 25.825 26.224999999999998 9 25.2 20.325 28.125 26.35 10-14 25.735000000000003 24.505 23.31 26.450000000000003 15-19 26.150000000000002 23.16 23.125 27.565 20-24 26.465 22.74 23.235 27.560000000000002 25-29 26.43 22.615 22.91 28.044999999999998 30-34 26.625 22.805 22.375 28.194999999999997 35-39 26.775 22.86 22.900000000000002 27.465 40-44 27.145000000000003 22.835 22.384999999999998 27.634999999999998 45-49 27.01 22.155 23.345 27.49 50-54 26.58 22.56 22.695 28.165000000000003 55-59 27.32 21.985 22.82 27.875 60-64 26.68 22.45 22.66 28.21 65-69 26.729999999999997 23.244999999999997 22.335 27.689999999999998 70-74 27.060000000000002 22.63 22.075 28.235 75-79 27.37 22.34 22.255 28.035 80-84 27.125 22.145 22.040000000000003 28.689999999999998 85-89 27.279999999999998 22.545 21.705 28.470000000000002 90-94 27.334999999999997 22.245 22.02 28.4 95-99 27.735 21.78 22.155 28.33 100-104 26.665 22.29 22.220000000000002 28.825 105-109 27.575 21.884999999999998 21.97 28.57 110-114 27.58 22.03 21.86 28.53 115-119 27.591218925421014 22.293504410585406 21.70709703287891 28.408179631114677 120-124 27.385477095419088 21.819363872774556 22.249449889977996 28.545709141828368 125-129 27.54 21.77 21.790000000000003 28.9 130-134 27.944999999999997 21.89 21.615000000000002 28.549999999999997 135-139 28.384999999999998 21.815 20.935000000000002 28.865000000000002 140-144 28.261413070653536 22.671133556677834 20.911045552277614 28.15640782039102 145-149 28.83 22.27 21.154999999999998 27.744999999999997 150 28.15 21.675 20.5 29.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.5 27 5.0 28 5.5 29 3.0 30 2.5 31 6.5 32 11.5 33 13.5 34 19.0 35 25.5 36 33.0 37 46.0 38 58.0 39 67.0 40 78.0 41 95.0 42 114.0 43 124.0 44 125.5 45 131.5 46 135.5 47 138.5 48 125.5 49 108.5 50 104.0 51 102.5 52 108.5 53 106.5 54 109.0 55 106.0 56 84.5 57 84.0 58 86.0 59 81.0 60 87.5 61 84.0 62 79.5 63 84.5 64 92.0 65 88.5 66 85.0 67 92.5 68 89.5 69 94.5 70 97.0 71 82.0 72 74.5 73 73.0 74 61.5 75 48.0 76 49.0 77 47.0 78 36.0 79 25.0 80 20.0 81 16.5 82 11.5 83 8.5 84 5.5 85 4.0 86 3.5 87 1.5 88 1.0 89 1.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.24 120-124 0.02 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64753272910373 98.95 2 0.3021148036253776 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025176233635448138 0.2 9 0.0 0.0 >10 0.025176233635448138 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 10 0.25 TruSeq Adapter, Index 4 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 8 0.2 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7749999999999999 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.4874999999999998 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.9 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGATC 10 0.0069827023 143.9375 3 CATCGAT 10 0.0069827023 143.9375 2 CCCCCCC 40 0.007986708 17.992188 135-139 >>END_MODULE SRR6940284 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940284_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.914 34.0 33.0 34.0 31.0 34.0 2 33.0585 34.0 33.0 34.0 31.0 34.0 3 33.119 34.0 34.0 34.0 31.0 34.0 4 36.4275 37.0 37.0 37.0 35.0 37.0 5 36.37625 37.0 37.0 37.0 35.0 37.0 6 36.32175 37.0 37.0 37.0 35.0 37.0 7 36.2725 37.0 37.0 37.0 35.0 37.0 8 36.228 37.0 37.0 37.0 35.0 37.0 9 38.038 39.0 39.0 39.0 37.0 39.0 10-14 38.2878 39.4 39.2 39.4 37.2 39.4 15-19 39.48465 41.0 40.0 41.0 38.0 41.0 20-24 39.167199999999994 41.0 40.0 41.0 36.8 41.0 25-29 38.783550000000005 41.0 39.4 41.0 35.4 41.0 30-34 38.201350000000005 40.4 38.2 41.0 34.4 41.0 35-39 37.6367 40.0 37.0 41.0 33.6 41.0 40-44 36.88675 39.8 35.2 41.0 32.4 41.0 45-49 36.04875 38.8 35.0 41.0 30.8 41.0 50-54 34.65535 36.8 33.8 39.6 27.6 40.6 55-59 34.8297 35.6 34.6 40.0 29.0 41.0 60-64 34.49380000000001 35.0 34.8 39.2 29.2 41.0 65-69 33.771249999999995 35.0 34.2 37.8 28.0 40.4 70-74 32.9401 35.0 33.4 36.4 26.2 39.0 75-79 32.085750000000004 35.0 33.0 35.0 24.2 37.0 80-84 31.4851 35.0 33.0 35.0 23.8 36.0 85-89 30.956650000000003 35.0 32.0 35.0 21.0 35.2 90-94 30.430249999999994 35.0 31.2 35.0 18.2 35.0 95-99 29.891700000000004 34.2 30.8 35.0 12.0 35.0 100-104 29.102600000000002 34.0 29.4 35.0 2.6 35.0 105-109 28.4627 34.0 29.0 35.0 2.0 35.0 110-114 27.78145 33.4 27.0 35.0 2.0 35.0 115-119 26.959299999999995 33.0 25.2 35.0 2.0 35.0 120-124 26.2058 32.8 24.0 34.8 2.0 35.0 125-129 25.36685 32.0 20.4 34.2 2.0 35.0 130-134 24.3273 31.2 15.0 34.0 2.0 35.0 135-139 23.33215 30.6 3.6 34.0 2.0 35.0 140-144 22.00235 29.6 2.0 34.0 2.0 35.0 145-149 20.538249999999998 29.0 2.0 34.0 2.0 35.0 150 17.57725 23.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 10.0 4 16.0 5 5.0 6 11.0 7 8.0 8 12.0 9 14.0 10 12.0 11 20.0 12 12.0 13 13.0 14 14.0 15 19.0 16 19.0 17 28.0 18 36.0 19 36.0 20 41.0 21 38.0 22 49.0 23 63.0 24 67.0 25 69.0 26 64.0 27 91.0 28 100.0 29 101.0 30 139.0 31 154.0 32 225.0 33 273.0 34 419.0 35 554.0 36 813.0 37 423.0 38 3.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.900000000000002 14.549999999999999 10.4 43.15 2 32.300000000000004 19.575 18.9 29.225 3 28.4 21.375 18.075 32.15 4 33.225 21.425 17.625 27.725 5 32.625 24.6 18.95 23.825 6 28.982245561390346 29.40735183795949 18.554638659664917 23.055763940985248 7 28.307076769192296 16.754188547136785 29.582395598899723 25.35633908477119 8 27.38184546136534 22.58064516129032 21.580395098774694 28.457114278569644 9 26.106526631657918 20.930232558139537 23.80595148787197 29.15728932233058 10-14 28.745810195607586 23.0076542098154 21.106608634749115 27.139926959827903 15-19 28.271203402551915 22.66199649737303 21.591193395046286 27.47560670502877 20-24 28.75656742556918 22.631973980485366 21.30097573179885 27.310482862146614 25-29 28.723670385750737 22.354530444789113 21.233801971281334 27.687997198178817 30-34 28.715100570399276 22.400680476333434 21.91534073851696 26.968878214750326 35-39 28.16598258083892 22.93022324557013 21.573731104214637 27.330063069376315 40-44 28.89600640576519 21.66449804824342 21.764588129316383 27.67490741667501 45-49 28.51781425140112 21.877502001601282 22.117694155324262 27.48698959167334 50-54 28.525673105795217 22.27504754278851 21.919727754979483 27.27955159643679 55-59 28.372023213928355 22.198318991394835 21.23774264558735 28.191915149089454 60-64 28.284142071035518 22.666333166583293 21.455727863931966 27.593796898449224 65-69 28.879439719859928 22.11105552776388 21.61080540270135 27.39869934967484 70-74 29.184592296148075 22.056028014007005 21.315657828914457 27.443721860930463 75-79 28.315573565461005 22.502376306968834 21.68192505878233 27.500125068787835 80-84 28.930125543940377 22.262791977192016 21.97269044165458 26.83439203721302 85-89 28.943024360962433 21.719773898254214 21.344605072282526 27.992596668500823 90-94 28.54570013507429 22.082145179848915 21.822002101155636 27.550152583921157 95-99 28.261848756318503 22.03092938291377 21.445373104449228 28.261848756318503 100-104 28.966863549904897 22.194413855240764 21.55871458604465 27.28000800880969 105-109 28.673637864612 21.59403612348026 22.20443288137289 27.527893130534846 110-114 28.818054443554843 22.41293034427542 21.04183346677342 27.72718174539632 115-119 28.803885245080856 21.784408952085315 21.529064236719574 27.882641566114252 120-124 28.713713713713712 21.69169169169169 21.641641641641645 27.952952952952952 125-129 28.980143050067525 22.797979292752462 20.50217576151653 27.719701895663484 130-134 29.65482741370685 22.076038019009506 20.94047023511756 27.32866433216608 135-139 29.566044346563892 21.973071725311577 20.95199959957956 27.508884328544976 140-144 29.98998998998999 22.98798798798799 20.19019019019019 26.83183183183183 145-149 30.583762693211945 22.310039517783004 19.893952278525337 27.212245510479715 150 30.43260815203801 22.73068267066767 20.030007501875467 26.806701675418854 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 2.5 28 1.5 29 0.5 30 2.5 31 6.0 32 9.5 33 10.5 34 12.0 35 18.5 36 25.0 37 27.5 38 45.5 39 65.5 40 75.5 41 86.0 42 91.0 43 94.5 44 122.0 45 140.5 46 136.0 47 121.5 48 110.5 49 119.0 50 114.5 51 107.5 52 101.0 53 96.5 54 98.5 55 101.5 56 95.5 57 91.5 58 89.0 59 85.0 60 88.0 61 92.5 62 100.5 63 93.5 64 90.5 65 104.0 66 104.0 67 102.0 68 112.5 69 100.5 70 90.5 71 88.5 72 80.5 73 74.0 74 56.0 75 51.5 76 47.0 77 36.0 78 37.5 79 31.5 80 23.0 81 21.5 82 16.5 83 11.5 84 8.5 85 7.0 86 6.0 87 4.0 88 2.5 89 2.5 90 1.5 91 1.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.055 15-19 0.075 20-24 0.075 25-29 0.065 30-34 0.06999999999999999 35-39 0.11 40-44 0.09 45-49 0.08 50-54 0.09 55-59 0.06 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.055 80-84 0.034999999999999996 85-89 0.045 90-94 0.055 95-99 0.095 100-104 0.11 105-109 0.065 110-114 0.08 115-119 0.135 120-124 0.1 125-129 0.034999999999999996 130-134 0.05 135-139 0.105 140-144 0.1 145-149 0.045 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.05 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.8250000000000002 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 3.225 0.0 0.0 0.0 0.0 136-137 3.7750000000000004 0.0 0.0 0.0 0.0 138 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTCT 10 0.006973645 144.0 6 >>END_MODULE Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640367 spots for SRR6940284.sra Written 2640367 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra Read 2640356 spots for SRR6940284.sra Written 2640356 spots for SRR6940284.sra SRR ids: ['SRR6940284.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pbpzwjv6 SRR6940284.sra spots: 52807131 blocks: [[1, 2640356], [2640357, 5280712], [5280713, 7921068], [7921069, 10561424], [10561425, 13201780], [13201781, 15842136], [15842137, 18482492], [18482493, 21122848], [21122849, 23763204], [23763205, 26403560], [26403561, 29043916], [29043917, 31684272], [31684273, 34324628], [34324629, 36964984], [36964985, 39605340], [39605341, 42245696], [42245697, 44886052], [44886053, 47526408], [47526409, 50166764], [50166765, 52807131]] SRR6940284 file size 17769764 SRR6940284 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6940284 SRR6940284_1.fastq SRR6940284_2.fastq Input file: SRR6940284_1.fastq Paired file: SRR6940284_2.fastq trimmed: SRR6940284-trimmed-pair1.fastq, SRR6940284-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:28:35 2024 >> started Fri Dec 6 10:29:35 2024 >> done (60.051s) 52807131 read pairs processed; of these: 225393 ( 0.43%) short read pairs filtered out after trimming by size control 276461 ( 0.52%) empty read pairs filtered out after trimming by size control 52305277 (99.05%) read pairs available; of these: 27742898 (53.04%) trimmed read pairs available after processing 24562379 (46.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 140 0.00% 19 898 0.00% 20 356 0.00% 21 571 0.00% 22 853 0.00% 23 1128 0.00% 24 1501 0.00% 25 1832 0.00% 26 2178 0.00% 27 2514 0.00% 28 2927 0.01% 29 3241 0.01% 30 3479 0.01% 31 3889 0.01% 32 4299 0.01% 33 4524 0.01% 34 4740 0.01% 35 4976 0.01% 36 5129 0.01% 37 5398 0.01% 38 5870 0.01% 39 5785 0.01% 40 5993 0.01% 41 6200 0.01% 42 6586 0.01% 43 6660 0.01% 44 7083 0.01% 45 7176 0.01% 46 7558 0.01% 47 7676 0.01% 48 7698 0.01% 49 8198 0.02% 50 8280 0.02% 51 8724 0.02% 52 8923 0.02% 53 9100 0.02% 54 9236 0.02% 55 9548 0.02% 56 10004 0.02% 57 10381 0.02% 58 10439 0.02% 59 10926 0.02% 60 11454 0.02% 61 11622 0.02% 62 12226 0.02% 63 12409 0.02% 64 13041 0.02% 65 13690 0.03% 66 14100 0.03% 67 14949 0.03% 68 15896 0.03% 69 16463 0.03% 70 17090 0.03% 71 17972 0.03% 72 18758 0.04% 73 20010 0.04% 74 20948 0.04% 75 22157 0.04% 76 23532 0.04% 77 25085 0.05% 78 27084 0.05% 79 28571 0.05% 80 30543 0.06% 81 32779 0.06% 82 35267 0.07% 83 38274 0.07% 84 50603 0.10% 85 53405 0.10% 86 56156 0.11% 87 59371 0.11% 88 62452 0.12% 89 64738 0.12% 90 67724 0.13% 91 69068 0.13% 92 70537 0.13% 93 72842 0.14% 94 74673 0.14% 95 78651 0.15% 96 79067 0.15% 97 79557 0.15% 98 83487 0.16% 99 84667 0.16% 100 77555 0.15% 101 77429 0.15% 102 84169 0.16% 103 86289 0.16% 104 92035 0.18% 105 104552 0.20% 106 107150 0.20% 107 109705 0.21% 108 121565 0.23% 109 127904 0.24% 110 133502 0.26% 111 152666 0.29% 112 159885 0.31% 113 165722 0.32% 114 180280 0.34% 115 198479 0.38% 116 201815 0.39% 117 188210 0.36% 118 191903 0.37% 119 208733 0.40% 120 200922 0.38% 121 207858 0.40% 122 249746 0.48% 123 270518 0.52% 124 290773 0.56% 125 275227 0.53% 126 330738 0.63% 127 315318 0.60% 128 338187 0.65% 129 421024 0.80% 130 425074 0.81% 131 437081 0.84% 132 440238 0.84% 133 515972 0.99% 134 552195 1.06% 135 573604 1.10% 136 622569 1.19% 137 659201 1.26% 138 673745 1.29% 139 706482 1.35% 140 741198 1.42% 141 788531 1.51% 142 857583 1.64% 143 929420 1.78% 144 1023926 1.96% 145 1163184 2.22% 146 1389996 2.66% 147 1740789 3.33% 148 2221409 4.25% 149 3777307 7.22% 150 24562379 46.96% 52305277 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.61 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=3.8 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=282.68 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=25.0 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=3.1 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=351.80 fanout-score-rank=1 prefix-density=1.28 prefix-fanout=27.4 sequence=GCCGCCGCCGGC SRR6940284 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:30:26 Started mapping on | Dec 06 10:30:26 Finished on | Dec 06 10:33:27 Mapping speed, Million of reads per hour | 1040.33 Number of input reads | 52305277 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 49002911 Uniquely mapped reads % | 93.69% Average mapped length | 281.57 Number of splices: Total | 34096700 Number of splices: Annotated (sjdb) | 31806471 Number of splices: GT/AG | 33526151 Number of splices: GC/AG | 476341 Number of splices: AT/AC | 22273 Number of splices: Non-canonical | 71935 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1621677 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 110717 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 1.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1805210 1805210 1805210 N_multimapping 1621677 1621677 1621677 N_noFeature 1585938 40639301 9230056 N_ambiguous 894517 27794 161188 UnstrandedReadsAssigned:46522456 PositiveStrandReadsAssigned:8335816 NegativeStrandReadsAssigned:39611667 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR6940284 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6940284-trimmed-pair1.fastq SRR6940284-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,305,277 reads, 48,807,093 reads pseudoaligned [quant] estimated average fragment length: 195.907 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR6940284.ke.tsv 35125 SRR6940284.se.tsv 88098 total ==> SRR6940284.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.279 0 0 PNS24247 1044 849.093 142.151 4.82421 PNS24249 1928 1733.09 1696.62 28.2094 PNS24246 1044 849.093 142.151 4.82421 PNS24248 1044 849.093 142.151 4.82421 PNS24244 1471 1276.09 105.93 2.39204 PNS24243 293 103.843 64 17.7596 KQK14069 1603 1408.09 15369.1 314.521 KQK14071 474 280.91 579.422 59.4374 ==> SRR6940284.se.tsv <== BRADI_1g14170v3 15968 BRADI_1g53295v3 146 BRADI_1g59795v3 1078 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 579 BRADI_1g74790v3 4035 BRADI_1g09890v3 1 BRADI_1g77505v3 500 BRADI_1g48960v3 0 SRR6940284 completed mapping pipeline successfully