Starting /dee2/code/volunteer_pipeline.sh SRR6940285 current disk space = 1551880925184 free memory = 1599154164 SRR6940285 SRAfilesize 4a07a127c65ffef306feebf89993a6e7 SRR6940285.sra SRR6940285.sra file validated SRR6940285 is paired end SRR6940285 is conventional basespace SRR6940285 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940285_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72675 34.0 31.0 34.0 31.0 34.0 2 32.4915 34.0 31.0 34.0 31.0 34.0 3 32.9045 34.0 31.0 34.0 31.0 34.0 4 36.43125 37.0 37.0 37.0 35.0 37.0 5 36.4175 37.0 37.0 37.0 35.0 37.0 6 36.361 37.0 37.0 37.0 35.0 37.0 7 36.284 37.0 37.0 37.0 35.0 37.0 8 36.36125 37.0 37.0 37.0 35.0 37.0 9 38.11125 39.0 39.0 39.0 37.0 39.0 10-14 38.4987 39.4 39.2 39.4 37.0 39.4 15-19 39.637249999999995 41.0 40.0 41.0 37.0 41.0 20-24 39.381899999999995 41.0 39.0 41.0 36.0 41.0 25-29 39.03075 40.4 38.6 41.0 35.2 41.0 30-34 38.36110000000001 40.0 37.6 41.0 34.0 41.0 35-39 37.67645 39.8 36.4 41.0 32.8 41.0 40-44 37.31875 39.4 35.0 41.0 33.0 41.0 45-49 36.498149999999995 38.2 35.0 41.0 31.4 41.0 50-54 35.6278 36.6 34.6 40.0 30.4 41.0 55-59 35.12179999999999 35.0 34.4 39.8 30.0 41.0 60-64 34.89715 35.0 34.8 39.0 30.4 41.0 65-69 34.229049999999994 35.0 34.0 37.2 29.8 40.4 70-74 33.41779999999999 35.0 33.2 35.6 28.8 39.0 75-79 32.422399999999996 34.8 32.6 35.0 26.6 37.0 80-84 32.4122 35.0 33.0 35.0 27.0 36.0 85-89 31.910900000000005 35.0 33.0 35.0 26.0 35.0 90-94 31.4868 35.0 32.8 35.0 24.4 35.0 95-99 31.0548 35.0 31.6 35.0 23.0 35.0 100-104 30.616750000000003 34.0 31.0 35.0 20.6 35.0 105-109 30.14365 34.0 30.8 35.0 18.2 35.0 110-114 29.581799999999998 34.0 29.4 35.0 15.4 35.0 115-119 28.249000000000002 33.4 27.4 35.0 5.2 35.0 120-124 27.99275 33.0 27.0 35.0 2.0 35.0 125-129 27.3602 33.0 25.8 35.0 2.0 35.0 130-134 26.44415 32.4 23.8 35.0 2.0 35.0 135-139 25.50845 31.8 21.2 34.2 2.0 35.0 140-144 24.2905 31.0 15.0 34.0 2.0 35.0 145-149 22.3775 30.6 2.0 34.0 2.0 35.0 150 16.497 19.0 2.0 29.0 2.0 33.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 5.0 7 7.0 8 9.0 9 11.0 10 8.0 11 15.0 12 17.0 13 12.0 14 18.0 15 15.0 16 11.0 17 19.0 18 33.0 19 26.0 20 24.0 21 35.0 22 32.0 23 33.0 24 40.0 25 53.0 26 74.0 27 96.0 28 96.0 29 111.0 30 149.0 31 195.0 32 250.0 33 329.0 34 464.0 35 649.0 36 799.0 37 364.0 38 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.85969453792389 10.975925446544137 10.56173958063681 44.60264043489516 2 29.825000000000003 11.600000000000001 22.400000000000002 36.175000000000004 3 29.375 12.85 16.975 40.8 4 33.074999999999996 16.225 14.35 36.35 5 33.275 20.875 19.525000000000002 26.325 6 33.2 23.025000000000002 18.875 24.9 7 24.75 26.3 27.575 21.375 8 25.3 22.650000000000002 25.575 26.474999999999998 9 26.474999999999998 19.725 26.700000000000003 27.1 10-14 26.924999999999997 23.974999999999998 22.68 26.419999999999998 15-19 27.08 22.259999999999998 22.0 28.660000000000004 20-24 27.555000000000003 21.995 22.05 28.4 25-29 27.875 21.825 21.575 28.725 30-34 26.685 22.1 22.03 29.185 35-39 27.884999999999998 21.654999999999998 21.525 28.935 40-44 28.18 21.465 21.4 28.955 45-49 27.62 21.7 22.05 28.63 50-54 28.265 21.185000000000002 21.044999999999998 29.505 55-59 28.17 21.465 21.044999999999998 29.32 60-64 28.17 21.135 21.495 29.2 65-69 28.494999999999997 21.345 21.13 29.03 70-74 28.78 21.435000000000002 20.810000000000002 28.975 75-79 29.145 21.425 20.4 29.03 80-84 28.804999999999996 21.19 20.9 29.104999999999997 85-89 28.7 20.66 21.22 29.42 90-94 29.03 20.82 20.8 29.349999999999998 95-99 29.25 20.585 20.645 29.520000000000003 100-104 28.615000000000002 21.07 20.775 29.54 105-109 29.455 20.755000000000003 20.419999999999998 29.37 110-114 28.965000000000003 20.93 20.979999999999997 29.125 115-119 29.280371942591472 20.856074388518294 20.472003234283402 29.391550434606835 120-124 29.625 20.990000000000002 19.975 29.409999999999997 125-129 29.985 20.369999999999997 20.13 29.515 130-134 30.275000000000002 20.87 20.265 28.59 135-139 29.9 20.965 19.965 29.17 140-144 30.255 20.665 19.400000000000002 29.68 145-149 29.775000000000002 21.634999999999998 19.605 28.985 150 31.025000000000002 19.8 17.9 31.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 1.0 29 1.5 30 3.5 31 5.5 32 7.0 33 12.0 34 14.5 35 22.0 36 30.0 37 36.0 38 39.0 39 52.0 40 71.5 41 83.0 42 84.0 43 100.0 44 117.5 45 107.5 46 104.5 47 100.5 48 100.5 49 103.0 50 91.0 51 83.0 52 91.0 53 95.0 54 74.0 55 69.5 56 85.5 57 85.5 58 90.0 59 99.0 60 99.0 61 102.5 62 107.5 63 103.5 64 110.0 65 120.5 66 121.0 67 129.5 68 130.5 69 118.0 70 118.0 71 107.5 72 84.5 73 81.0 74 75.0 75 60.0 76 58.0 77 59.0 78 47.0 79 27.0 80 16.0 81 17.5 82 13.0 83 7.5 84 6.5 85 4.0 86 4.5 87 3.0 88 1.5 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 1.06 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24242424242425 98.25 2 0.6060606060606061 1.2 3 0.10101010101010101 0.3 4 0.0 0.0 5 0.050505050505050504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 6 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6499999999999999 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.225 0.0 0.0 0.0 0.0 134-135 3.8875 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6940285 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940285_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 59 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54875 34.0 31.0 34.0 31.0 34.0 2 32.7895 34.0 33.0 34.0 31.0 34.0 3 32.76825 34.0 33.0 34.0 31.0 34.0 4 36.14575 37.0 37.0 37.0 35.0 37.0 5 36.2045 37.0 37.0 37.0 35.0 37.0 6 36.1715 37.0 37.0 37.0 35.0 37.0 7 36.0395 37.0 37.0 37.0 35.0 37.0 8 36.0345 37.0 37.0 37.0 35.0 37.0 9 37.83975 39.0 39.0 39.0 37.0 39.0 10-14 38.019 39.4 39.2 39.4 35.4 39.4 15-19 38.93695 41.0 39.2 41.0 36.2 41.0 20-24 38.687599999999996 41.0 39.0 41.0 35.0 41.0 25-29 38.1598 40.2 38.4 41.0 34.2 41.0 30-34 37.5332 40.0 37.6 41.0 32.8 41.0 35-39 36.7581 39.4 35.6 41.0 31.2 41.0 40-44 35.8457 38.4 35.0 40.8 29.8 41.0 45-49 35.26675 37.4 34.8 40.4 29.0 41.0 50-54 33.97975 35.2 33.0 39.2 26.2 40.6 55-59 33.700199999999995 35.0 33.0 39.0 25.4 41.0 60-64 32.825599999999994 35.0 33.0 37.4 23.6 40.4 65-69 32.010600000000004 35.0 32.0 36.0 22.0 39.2 70-74 31.896499999999996 35.0 33.0 35.0 23.2 38.0 75-79 31.35195 35.0 32.8 35.0 20.8 36.4 80-84 30.6661 35.0 31.6 35.0 19.6 35.4 85-89 30.010499999999997 34.8 30.6 35.0 13.4 35.0 90-94 29.55975 34.0 30.2 35.0 6.4 35.0 95-99 28.958949999999998 34.0 29.2 35.0 2.0 35.0 100-104 28.1312 33.8 27.4 35.0 2.0 35.0 105-109 27.50025 33.0 25.8 35.0 2.0 35.0 110-114 26.770400000000002 33.0 24.2 35.0 2.0 35.0 115-119 25.9241 32.6 21.8 35.0 2.0 35.0 120-124 25.2174 32.0 19.4 35.0 2.0 35.0 125-129 24.35575 31.0 15.8 34.2 2.0 35.0 130-134 23.24445 30.2 6.2 34.0 2.0 35.0 135-139 21.9046 29.0 2.0 34.0 2.0 35.0 140-144 20.824450000000002 27.8 2.0 34.0 2.0 35.0 145-149 18.774449999999998 25.4 2.0 33.0 2.0 35.0 150 14.20325 2.0 2.0 29.0 2.0 33.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 10.0 4 15.0 5 16.0 6 12.0 7 16.0 8 17.0 9 15.0 10 18.0 11 18.0 12 25.0 13 19.0 14 24.0 15 20.0 16 28.0 17 33.0 18 38.0 19 47.0 20 42.0 21 49.0 22 58.0 23 68.0 24 70.0 25 83.0 26 70.0 27 107.0 28 123.0 29 127.0 30 161.0 31 216.0 32 247.0 33 355.0 34 402.0 35 528.0 36 652.0 37 246.0 38 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.4 13.3 10.725 44.574999999999996 2 34.1 18.075 17.575 30.25 3 28.325 18.75 18.5 34.425 4 31.95 19.6 16.975 31.474999999999998 5 34.925 24.025 15.775 25.275 6 28.375 29.4 16.675 25.55 7 27.400000000000002 16.8 27.925 27.875 8 28.299999999999997 21.099999999999998 19.675 30.925000000000004 9 27.525 20.424999999999997 22.45 29.599999999999998 10-14 28.82 22.08 19.67 29.43 15-19 29.29 21.58 20.3 28.83 20-24 29.415000000000003 21.535 20.395 28.655 25-29 29.335 21.465 20.18 29.020000000000003 30-34 29.18 21.365000000000002 20.43 29.025000000000002 35-39 29.520000000000003 21.17 20.485 28.825 40-44 29.68 20.225 20.57 29.525000000000002 45-49 29.32 20.845 20.080000000000002 29.755 50-54 29.39 20.735 20.119999999999997 29.755 55-59 29.39 20.330000000000002 20.775 29.505 60-64 29.110000000000003 21.45 20.04 29.4 65-69 28.98 21.205 20.380000000000003 29.435 70-74 29.095 20.955 20.535 29.415000000000003 75-79 29.065 21.17 20.3 29.465000000000003 80-84 29.7 20.1 20.555 29.645 85-89 29.715000000000003 20.41 19.935 29.94 90-94 29.044999999999998 20.665 20.755000000000003 29.535 95-99 29.134999999999998 20.685000000000002 20.22 29.959999999999997 100-104 29.165000000000003 20.549999999999997 20.560000000000002 29.725 105-109 29.665000000000003 20.75 20.72 28.865000000000002 110-114 29.720000000000002 20.974999999999998 20.330000000000002 28.975 115-119 29.549999999999997 20.78 19.939999999999998 29.73 120-124 29.885 21.07 19.965 29.080000000000002 125-129 30.0 21.0 19.98 29.020000000000003 130-134 30.61 20.265 19.98 29.145 135-139 30.205 20.794999999999998 19.869999999999997 29.13 140-144 31.180000000000003 20.979999999999997 19.165 28.675 145-149 31.545 21.215 18.96 28.28 150 32.800000000000004 21.099999999999998 17.625 28.475 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 0.5 27 1.0 28 1.0 29 2.0 30 3.0 31 3.0 32 5.5 33 6.5 34 9.0 35 11.0 36 14.5 37 22.5 38 31.0 39 43.0 40 52.5 41 64.5 42 70.0 43 70.5 44 78.0 45 90.5 46 112.0 47 118.5 48 106.5 49 96.0 50 96.0 51 93.0 52 88.5 53 94.0 54 83.5 55 71.0 56 82.5 57 85.5 58 80.5 59 99.0 60 110.5 61 110.5 62 120.0 63 119.5 64 115.5 65 117.5 66 113.0 67 118.5 68 128.0 69 130.0 70 125.0 71 110.5 72 101.0 73 96.5 74 88.5 75 80.5 76 64.0 77 54.0 78 45.5 79 35.5 80 28.5 81 20.0 82 18.0 83 14.5 84 12.0 85 8.5 86 6.0 87 5.0 88 4.0 89 2.0 90 0.5 91 0.0 92 1.5 93 2.0 94 1.0 95 0.5 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.68287740628166 97.39999999999999 2 1.3171225937183384 2.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.3625 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.9 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 85 0.003342231 11.858823 135-139 >>END_MODULE Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838080 spots for SRR6940285.sra Written 1838080 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra Read 1838078 spots for SRR6940285.sra Written 1838078 spots for SRR6940285.sra SRR ids: ['SRR6940285.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jke0lm7j SRR6940285.sra spots: 36761562 blocks: [[1, 1838078], [1838079, 3676156], [3676157, 5514234], [5514235, 7352312], [7352313, 9190390], [9190391, 11028468], [11028469, 12866546], [12866547, 14704624], [14704625, 16542702], [16542703, 18380780], [18380781, 20218858], [20218859, 22056936], [22056937, 23895014], [23895015, 25733092], [25733093, 27571170], [27571171, 29409248], [29409249, 31247326], [31247327, 33085404], [33085405, 34923482], [34923483, 36761562]] SRR6940285 file size 12363786 SRR6940285 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6940285 SRR6940285_1.fastq SRR6940285_2.fastq Input file: SRR6940285_1.fastq Paired file: SRR6940285_2.fastq trimmed: SRR6940285-trimmed-pair1.fastq, SRR6940285-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:30:10 2024 >> started Fri Dec 6 10:30:54 2024 >> done (44.175s) 36761562 read pairs processed; of these: 151180 ( 0.41%) short read pairs filtered out after trimming by size control 333764 ( 0.91%) empty read pairs filtered out after trimming by size control 36276618 (98.68%) read pairs available; of these: 25425193 (70.09%) trimmed read pairs available after processing 10851425 (29.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 180 0.00% 19 1040 0.00% 20 371 0.00% 21 644 0.00% 22 1040 0.00% 23 1289 0.00% 24 1681 0.00% 25 2110 0.01% 26 2525 0.01% 27 2922 0.01% 28 3455 0.01% 29 3882 0.01% 30 4535 0.01% 31 5945 0.02% 32 5629 0.02% 33 5539 0.02% 34 6000 0.02% 35 6063 0.02% 36 6393 0.02% 37 6421 0.02% 38 6758 0.02% 39 6994 0.02% 40 7184 0.02% 41 7399 0.02% 42 7456 0.02% 43 7608 0.02% 44 7994 0.02% 45 8254 0.02% 46 8297 0.02% 47 8683 0.02% 48 8579 0.02% 49 8855 0.02% 50 8748 0.02% 51 9267 0.03% 52 9105 0.03% 53 9576 0.03% 54 9542 0.03% 55 9689 0.03% 56 10137 0.03% 57 10354 0.03% 58 10673 0.03% 59 10954 0.03% 60 11232 0.03% 61 11692 0.03% 62 11858 0.03% 63 12214 0.03% 64 13019 0.04% 65 13193 0.04% 66 13939 0.04% 67 14446 0.04% 68 14686 0.04% 69 15083 0.04% 70 15880 0.04% 71 16924 0.05% 72 17705 0.05% 73 18436 0.05% 74 19375 0.05% 75 20227 0.06% 76 21807 0.06% 77 22809 0.06% 78 24080 0.07% 79 25861 0.07% 80 26778 0.07% 81 28419 0.08% 82 30590 0.08% 83 32645 0.09% 84 38611 0.11% 85 40773 0.11% 86 42118 0.12% 87 43793 0.12% 88 45498 0.13% 89 47032 0.13% 90 48552 0.13% 91 49604 0.14% 92 50519 0.14% 93 52617 0.15% 94 53549 0.15% 95 54809 0.15% 96 56931 0.16% 97 58109 0.16% 98 59808 0.16% 99 62509 0.17% 100 63045 0.17% 101 63623 0.18% 102 66169 0.18% 103 69518 0.19% 104 73150 0.20% 105 77584 0.21% 106 81406 0.22% 107 84363 0.23% 108 88625 0.24% 109 93520 0.26% 110 100021 0.28% 111 107684 0.30% 112 113454 0.31% 113 113722 0.31% 114 123133 0.34% 115 141712 0.39% 116 144420 0.40% 117 142816 0.39% 118 150855 0.42% 119 155051 0.43% 120 182681 0.50% 121 195079 0.54% 122 206228 0.57% 123 213188 0.59% 124 237954 0.66% 125 249304 0.69% 126 260362 0.72% 127 277176 0.76% 128 291957 0.80% 129 317613 0.88% 130 336186 0.93% 131 355458 0.98% 132 380287 1.05% 133 401948 1.11% 134 425736 1.17% 135 454494 1.25% 136 485306 1.34% 137 516798 1.42% 138 546516 1.51% 139 588102 1.62% 140 635397 1.75% 141 690800 1.90% 142 765813 2.11% 143 853862 2.35% 144 969153 2.67% 145 1131227 3.12% 146 1393776 3.84% 147 1798646 4.96% 148 2363846 6.52% 149 4328929 11.93% 150 10851425 29.91% 36276618 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=31 prefix-density=0.83 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=36 fanout-score=19.26 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=4.6 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=23 prefix-density=0.63 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.21 sequence-density-rank=32 fanout-score=14.65 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=2.5 sequence=GAGCTCAAGCTCAAGGAGATCAA SRR6940285 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:31:46 Started mapping on | Dec 06 10:31:46 Finished on | Dec 06 10:33:40 Mapping speed, Million of reads per hour | 1145.58 Number of input reads | 36276618 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 34664885 Uniquely mapped reads % | 95.56% Average mapped length | 278.70 Number of splices: Total | 24882857 Number of splices: Annotated (sjdb) | 23677466 Number of splices: GT/AG | 24547091 Number of splices: GC/AG | 282851 Number of splices: AT/AC | 6784 Number of splices: Non-canonical | 46131 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471049 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 68090 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 1.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1243070 1243070 1243070 N_multimapping 471049 471049 471049 N_noFeature 683896 27896574 6799128 N_ambiguous 831811 26717 159906 UnstrandedReadsAssigned:33149178 PositiveStrandReadsAssigned:6741594 NegativeStrandReadsAssigned:27705851 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR6940285 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6940285-trimmed-pair1.fastq SRR6940285-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,276,618 reads, 34,314,614 reads pseudoaligned [quant] estimated average fragment length: 195.106 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR6940285.ke.tsv 35125 SRR6940285.se.tsv 88098 total ==> SRR6940285.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.984 0 0 PNS24247 1044 849.894 23.7597 1.00091 PNS24249 1928 1733.89 325.731 6.72599 PNS24246 1044 849.894 23.7597 1.00091 PNS24248 1044 849.894 23.7597 1.00091 PNS24244 1471 1276.89 25.9903 0.728747 PNS24243 293 102.957 15 5.2162 KQK14069 1603 1408.89 7768.71 197.42 KQK14071 474 280.887 718.159 91.5396 ==> SRR6940285.se.tsv <== BRADI_1g14170v3 8709 BRADI_1g53295v3 42 BRADI_1g59795v3 714 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 286 BRADI_1g74790v3 408 BRADI_1g09890v3 0 BRADI_1g77505v3 411 BRADI_1g48960v3 0 SRR6940285 completed mapping pipeline successfully