Starting /dee2/code/volunteer_pipeline.sh SRR6940293 current disk space = 1551908814848 free memory = 1328174724 SRR6940293 SRAfilesize 83366ba1b802c45fa46ea532ad56322e SRR6940293.sra SRR6940293.sra file validated SRR6940293 is paired end SRR6940293 is conventional basespace SRR6940293 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940293_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.00675 34.0 31.0 34.0 31.0 34.0 2 32.63625 34.0 31.0 34.0 31.0 34.0 3 33.03975 34.0 33.0 34.0 31.0 34.0 4 36.49925 37.0 37.0 37.0 35.0 37.0 5 36.4765 37.0 37.0 37.0 35.0 37.0 6 36.43625 37.0 37.0 37.0 35.0 37.0 7 36.35725 37.0 37.0 37.0 35.0 37.0 8 36.37775 37.0 37.0 37.0 35.0 37.0 9 38.24525 39.0 39.0 39.0 37.0 39.0 10-14 38.5398 39.4 39.2 39.4 37.2 39.4 15-19 39.6584 41.0 40.0 41.0 37.0 41.0 20-24 39.39835000000001 41.0 39.0 41.0 36.0 41.0 25-29 38.96695 40.4 38.6 41.0 35.2 41.0 30-34 38.4111 40.0 37.8 41.0 34.2 41.0 35-39 37.7127 40.0 36.4 41.0 33.0 41.0 40-44 37.3904 39.6 35.0 41.0 33.0 41.0 45-49 36.715050000000005 38.4 35.0 41.0 32.0 41.0 50-54 35.85574999999999 37.0 34.8 40.2 30.4 41.0 55-59 35.33624999999999 35.2 34.6 40.0 30.4 41.0 60-64 35.0223 35.0 34.8 39.2 30.6 41.0 65-69 34.30425 35.0 34.0 37.6 29.6 40.4 70-74 33.306400000000004 35.0 33.4 36.0 28.2 39.0 75-79 32.27335 34.8 32.4 35.0 26.4 37.0 80-84 32.3446 35.0 33.0 35.0 27.0 36.0 85-89 31.845000000000006 35.0 33.0 35.0 25.0 35.2 90-94 31.435950000000002 35.0 32.8 35.0 24.0 35.0 95-99 31.12135 35.0 31.8 35.0 23.6 35.0 100-104 30.7337 34.6 31.2 35.0 20.6 35.0 105-109 30.245600000000003 34.0 30.6 35.0 19.0 35.0 110-114 29.814049999999998 34.0 29.8 35.0 16.2 35.0 115-119 28.54515 33.4 27.8 35.0 6.8 35.0 120-124 28.347749999999998 33.0 27.4 35.0 2.6 35.0 125-129 27.559299999999997 33.0 26.2 35.0 2.0 35.0 130-134 26.6809 32.6 24.2 35.0 2.0 35.0 135-139 25.7553 32.0 22.0 34.2 2.0 35.0 140-144 24.5508 31.2 17.4 34.0 2.0 35.0 145-149 22.690299999999997 30.6 2.6 34.0 2.0 35.0 150 16.6285 19.0 2.0 30.0 2.0 33.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 3.0 6 6.0 7 4.0 8 7.0 9 9.0 10 10.0 11 8.0 12 16.0 13 7.0 14 20.0 15 21.0 16 21.0 17 20.0 18 33.0 19 25.0 20 23.0 21 23.0 22 29.0 23 47.0 24 50.0 25 56.0 26 68.0 27 72.0 28 95.0 29 115.0 30 126.0 31 196.0 32 246.0 33 298.0 34 449.0 35 667.0 36 788.0 37 440.0 38 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.9313801079414 10.896941660241582 9.611924955024415 42.5597532767926 2 27.625 13.100000000000001 23.25 36.025 3 28.999999999999996 13.175 17.325 40.5 4 34.65 16.025 14.7 34.625 5 35.099999999999994 20.849999999999998 18.55 25.5 6 33.7 24.125 17.275 24.9 7 25.650000000000002 25.724999999999998 28.000000000000004 20.625 8 25.575 22.75 26.05 25.624999999999996 9 27.800000000000004 18.65 25.95 27.6 10-14 26.93 23.65 22.32 27.1 15-19 26.68 22.065 22.415 28.84 20-24 28.144999999999996 22.435 21.825 27.595 25-29 27.79 21.915000000000003 21.905 28.389999999999997 30-34 27.32 22.215 21.93 28.535 35-39 27.900000000000002 21.825 21.83 28.444999999999997 40-44 27.445000000000004 21.725 22.3 28.53 45-49 28.244999999999997 21.965 21.725 28.065 50-54 28.53 21.765 20.965 28.74 55-59 27.675 21.16 22.25 28.915000000000003 60-64 28.384999999999998 21.505 21.335 28.775000000000002 65-69 28.24 22.745 21.01 28.005000000000003 70-74 28.335 22.865 20.515 28.285 75-79 28.294999999999998 21.505 21.32 28.88 80-84 28.29 21.38 21.46 28.87 85-89 28.615000000000002 21.725 20.919999999999998 28.74 90-94 28.655 21.240000000000002 20.845 29.26 95-99 28.585 21.4 20.985 29.03 100-104 28.725 21.84 20.849999999999998 28.585 105-109 28.405 20.995 21.48 29.12 110-114 28.939999999999998 20.995 20.794999999999998 29.270000000000003 115-119 29.199838758439988 21.162954751587222 20.83039403406228 28.806812455910514 120-124 29.160000000000004 21.099999999999998 20.505000000000003 29.235 125-129 29.165000000000003 21.255 21.085 28.494999999999997 130-134 29.78 21.17 20.335 28.715000000000003 135-139 29.635 22.045 19.98 28.34 140-144 30.09 22.045 19.415 28.449999999999996 145-149 28.915000000000003 22.689999999999998 19.42 28.975 150 30.825000000000003 22.1 16.225 30.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 1.0 28 0.5 29 0.0 30 2.0 31 5.0 32 10.0 33 12.0 34 16.0 35 23.0 36 27.0 37 31.0 38 38.0 39 49.0 40 74.0 41 94.5 42 95.0 43 92.5 44 104.5 45 115.5 46 112.5 47 121.0 48 116.5 49 108.0 50 111.0 51 114.0 52 96.0 53 85.0 54 89.0 55 86.0 56 81.0 57 70.5 58 81.0 59 86.5 60 96.5 61 105.5 62 99.5 63 103.5 64 107.0 65 118.0 66 120.0 67 116.0 68 115.0 69 110.5 70 106.0 71 94.0 72 80.5 73 70.5 74 72.0 75 66.5 76 57.0 77 50.5 78 38.0 79 32.5 80 24.5 81 17.5 82 14.0 83 11.0 84 8.0 85 5.0 86 4.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.77 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18200408997954 97.0 2 0.6646216768916156 1.3 3 0.07668711656441718 0.22499999999999998 4 0.0 0.0 5 0.025562372188139063 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051124744376278126 1.35 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 41 1.0250000000000001 TruSeq Adapter, Index 7 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 13 0.325 TruSeq Adapter, Index 5 (100% over 50bp) CACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCT 5 0.125 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.037500000000000006 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.9 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 6.3125 0.0 0.0 0.0 0.0 132-133 7.3375 0.0 0.0 0.0 0.0 134-135 8.3 0.0 0.0 0.0 0.0 136-137 9.3875 0.0 0.0 0.0 0.0 138 10.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGGGCT 10 0.006238801 149.38962 1 >>END_MODULE SRR6940293 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940293_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38275 34.0 31.0 34.0 31.0 34.0 2 32.6365 34.0 33.0 34.0 31.0 34.0 3 32.611 34.0 33.0 34.0 31.0 34.0 4 35.958 37.0 37.0 37.0 35.0 37.0 5 36.034 37.0 37.0 37.0 35.0 37.0 6 35.95375 37.0 37.0 37.0 35.0 37.0 7 35.81125 37.0 37.0 37.0 35.0 37.0 8 35.8185 37.0 37.0 37.0 35.0 37.0 9 37.452 39.0 39.0 39.0 35.0 39.0 10-14 37.6814 39.4 39.2 39.4 35.2 39.4 15-19 38.661500000000004 41.0 39.4 41.0 36.0 41.0 20-24 38.32355 41.0 39.0 41.0 34.8 41.0 25-29 37.8943 40.4 38.2 41.0 33.6 41.0 30-34 37.1672 40.0 37.6 41.0 32.2 41.0 35-39 36.297 39.6 35.4 41.0 30.2 41.0 40-44 35.558499999999995 38.6 35.0 40.8 28.8 41.0 45-49 34.907500000000006 37.4 34.8 40.6 27.0 41.0 50-54 33.6881 35.4 33.2 39.6 24.2 40.6 55-59 33.4151 35.0 33.0 39.4 23.6 41.0 60-64 32.632 35.0 33.0 37.8 22.0 40.6 65-69 31.911700000000003 35.0 32.2 36.2 20.4 39.4 70-74 31.841500000000003 35.0 33.0 35.4 22.2 38.4 75-79 31.3416 35.0 33.0 35.0 20.2 36.6 80-84 30.703249999999997 35.0 32.0 35.0 17.6 35.8 85-89 30.15265 35.0 31.0 35.0 13.0 35.0 90-94 29.595299999999998 34.2 30.6 35.0 5.0 35.0 95-99 28.94305 34.0 29.4 35.0 2.0 35.0 100-104 28.22245 34.0 27.8 35.0 2.0 35.0 105-109 27.683450000000004 33.8 26.6 35.0 2.0 35.0 110-114 26.97475 33.0 25.0 35.0 2.0 35.0 115-119 26.162850000000002 33.0 23.2 35.0 2.0 35.0 120-124 25.5847 32.2 20.0 35.0 2.0 35.0 125-129 24.6861 31.4 17.2 34.4 2.0 35.0 130-134 23.72365 30.8 9.4 34.0 2.0 35.0 135-139 22.527300000000004 29.6 2.0 34.0 2.0 35.0 140-144 21.232049999999997 29.0 2.0 34.0 2.0 35.0 145-149 19.032649999999997 26.0 2.0 33.2 2.0 35.0 150 14.67525 2.0 2.0 29.0 2.0 33.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 24.0 4 14.0 5 21.0 6 10.0 7 12.0 8 14.0 9 33.0 10 14.0 11 18.0 12 19.0 13 20.0 14 13.0 15 19.0 16 23.0 17 32.0 18 38.0 19 37.0 20 41.0 21 50.0 22 56.0 23 65.0 24 40.0 25 71.0 26 93.0 27 96.0 28 107.0 29 107.0 30 155.0 31 211.0 32 236.0 33 296.0 34 404.0 35 590.0 36 660.0 37 303.0 38 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.75 13.600000000000001 9.85 41.8 2 33.300000000000004 17.575 18.8 30.325000000000003 3 28.1 20.1 18.175 33.625 4 33.575 19.950000000000003 16.650000000000002 29.825000000000003 5 35.175 22.025 17.5 25.3 6 29.975 28.275 17.525 24.224999999999998 7 27.35 17.075000000000003 28.725 26.85 8 27.825 21.075 20.825 30.275000000000002 9 26.424999999999997 19.400000000000002 24.625 29.549999999999997 10-14 29.065 22.46 20.165 28.310000000000002 15-19 29.2 20.794999999999998 21.39 28.615000000000002 20-24 30.259999999999998 21.11 20.349999999999998 28.28 25-29 29.705 21.47 20.225 28.599999999999998 30-34 29.770000000000003 21.33 20.5 28.4 35-39 29.520000000000003 21.23 20.855 28.395 40-44 29.985 21.01 20.419999999999998 28.585 45-49 29.64 20.810000000000002 20.605 28.945 50-54 29.849999999999998 20.865000000000002 20.76 28.525 55-59 28.42 21.02 21.315 29.244999999999997 60-64 28.76 22.055 20.95 28.235 65-69 29.09 22.84 20.105 27.965 70-74 28.749999999999996 21.795 20.505000000000003 28.95 75-79 28.7 21.62 20.405 29.275000000000002 80-84 28.435 21.395 21.279999999999998 28.89 85-89 29.325000000000003 21.029999999999998 20.645 28.999999999999996 90-94 29.110000000000003 21.415 20.275000000000002 29.2 95-99 29.235 20.91 20.794999999999998 29.060000000000002 100-104 29.470000000000002 21.17 20.97 28.389999999999997 105-109 29.365000000000002 21.165 20.715 28.754999999999995 110-114 29.189999999999998 21.6 20.380000000000003 28.83 115-119 29.26 21.545 20.085 29.110000000000003 120-124 29.4 21.515 20.62 28.465 125-129 30.049999999999997 21.795 19.794999999999998 28.360000000000003 130-134 30.509999999999998 21.595 19.82 28.075 135-139 31.240000000000002 21.584999999999997 19.155 28.02 140-144 30.945 22.015 19.3 27.74 145-149 31.885 22.24 19.08 26.795 150 34.35 21.075 16.25 28.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.0 26 1.5 27 1.0 28 2.0 29 1.5 30 3.5 31 7.5 32 10.5 33 9.0 34 13.0 35 19.5 36 20.0 37 23.0 38 24.5 39 35.0 40 52.5 41 73.0 42 85.0 43 93.5 44 102.5 45 108.5 46 114.0 47 109.0 48 99.0 49 95.5 50 96.0 51 92.0 52 87.5 53 83.0 54 88.5 55 88.5 56 82.0 57 83.5 58 97.5 59 101.5 60 96.0 61 91.0 62 94.0 63 118.5 64 115.5 65 115.0 66 130.5 67 130.0 68 121.0 69 111.0 70 119.0 71 110.0 72 93.0 73 84.0 74 77.0 75 74.5 76 59.5 77 48.0 78 43.0 79 36.5 80 27.5 81 21.5 82 19.5 83 13.5 84 9.0 85 8.5 86 5.5 87 3.5 88 4.5 89 4.0 90 2.5 91 2.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96412329459324 97.925 2 1.010611419909045 2.0 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.1624999999999996 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.4875 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 8.1625 0.0 0.0 0.0 0.0 138 9.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 140 1.10358655E-4 10.285714 65-69 >>END_MODULE Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452864 spots for SRR6940293.sra Written 1452864 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra Read 1452851 spots for SRR6940293.sra Written 1452851 spots for SRR6940293.sra SRR ids: ['SRR6940293.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7uciuhfa SRR6940293.sra spots: 29057033 blocks: [[1, 1452851], [1452852, 2905702], [2905703, 4358553], [4358554, 5811404], [5811405, 7264255], [7264256, 8717106], [8717107, 10169957], [10169958, 11622808], [11622809, 13075659], [13075660, 14528510], [14528511, 15981361], [15981362, 17434212], [17434213, 18887063], [18887064, 20339914], [20339915, 21792765], [21792766, 23245616], [23245617, 24698467], [24698468, 26151318], [26151319, 27604169], [27604170, 29057033]] SRR6940293 file size 9768022 SRR6940293 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6940293 SRR6940293_1.fastq SRR6940293_2.fastq Input file: SRR6940293_1.fastq Paired file: SRR6940293_2.fastq trimmed: SRR6940293-trimmed-pair1.fastq, SRR6940293-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:26:12 2024 >> started Fri Dec 6 10:26:55 2024 >> done (42.935s) 29057033 read pairs processed; of these: 152012 ( 0.52%) short read pairs filtered out after trimming by size control 431221 ( 1.48%) empty read pairs filtered out after trimming by size control 28473800 (97.99%) read pairs available; of these: 20094693 (70.57%) trimmed read pairs available after processing 8379107 (29.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 170 0.00% 19 1010 0.00% 20 278 0.00% 21 445 0.00% 22 678 0.00% 23 942 0.00% 24 1193 0.00% 25 1464 0.01% 26 1806 0.01% 27 1992 0.01% 28 2203 0.01% 29 2474 0.01% 30 2772 0.01% 31 3062 0.01% 32 3234 0.01% 33 3545 0.01% 34 3796 0.01% 35 3985 0.01% 36 4423 0.02% 37 4538 0.02% 38 5050 0.02% 39 4964 0.02% 40 5348 0.02% 41 5443 0.02% 42 5682 0.02% 43 5779 0.02% 44 5973 0.02% 45 6112 0.02% 46 6117 0.02% 47 6372 0.02% 48 6547 0.02% 49 7046 0.02% 50 6788 0.02% 51 7190 0.03% 52 7197 0.03% 53 7344 0.03% 54 7462 0.03% 55 7415 0.03% 56 7618 0.03% 57 7914 0.03% 58 7792 0.03% 59 7977 0.03% 60 8240 0.03% 61 9143 0.03% 62 8762 0.03% 63 9461 0.03% 64 9710 0.03% 65 10829 0.04% 66 10170 0.04% 67 12159 0.04% 68 10714 0.04% 69 11485 0.04% 70 11778 0.04% 71 15063 0.05% 72 13089 0.05% 73 15232 0.05% 74 15230 0.05% 75 21424 0.08% 76 16595 0.06% 77 19947 0.07% 78 19125 0.07% 79 19109 0.07% 80 20554 0.07% 81 21377 0.08% 82 22935 0.08% 83 24395 0.09% 84 28320 0.10% 85 30048 0.11% 86 31266 0.11% 87 32326 0.11% 88 33615 0.12% 89 34780 0.12% 90 35578 0.12% 91 36562 0.13% 92 37982 0.13% 93 39082 0.14% 94 39720 0.14% 95 40569 0.14% 96 41832 0.15% 97 42425 0.15% 98 45781 0.16% 99 47549 0.17% 100 46726 0.16% 101 46818 0.16% 102 48587 0.17% 103 54438 0.19% 104 62742 0.22% 105 66346 0.23% 106 66075 0.23% 107 71337 0.25% 108 70709 0.25% 109 77341 0.27% 110 87327 0.31% 111 93292 0.33% 112 98704 0.35% 113 106692 0.37% 114 118354 0.42% 115 130310 0.46% 116 130617 0.46% 117 131070 0.46% 118 126952 0.45% 119 133272 0.47% 120 135551 0.48% 121 175733 0.62% 122 191229 0.67% 123 199514 0.70% 124 199433 0.70% 125 204133 0.72% 126 218161 0.77% 127 239721 0.84% 128 261842 0.92% 129 281600 0.99% 130 294339 1.03% 131 298627 1.05% 132 323795 1.14% 133 342158 1.20% 134 362913 1.27% 135 385895 1.36% 136 410574 1.44% 137 429587 1.51% 138 450819 1.58% 139 479582 1.68% 140 512610 1.80% 141 550591 1.93% 142 603997 2.12% 143 662465 2.33% 144 742865 2.61% 145 855047 3.00% 146 1035957 3.64% 147 1332052 4.68% 148 1742173 6.12% 149 3260920 11.45% 150 8379107 29.43% 28473800 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=29 prefix-density=0.63 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=35 fanout-score=19.78 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=3.9 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=28 prefix-density=0.56 prefix-fanout=2.6 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.17 sequence-density-rank=34 fanout-score=15.44 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=2.7 sequence=GAGCTCAAGCTCAAGGAGATCAA SRR6940293 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:29:07 Started mapping on | Dec 06 10:29:07 Finished on | Dec 06 10:30:52 Mapping speed, Million of reads per hour | 976.24 Number of input reads | 28473800 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 27052480 Uniquely mapped reads % | 95.01% Average mapped length | 278.28 Number of splices: Total | 19507848 Number of splices: Annotated (sjdb) | 18469423 Number of splices: GT/AG | 19231589 Number of splices: GC/AG | 232858 Number of splices: AT/AC | 6521 Number of splices: Non-canonical | 36880 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421851 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 63497 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.62% % of reads unmapped: other | 1.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1068439 1068439 1068439 N_multimapping 421851 421851 421851 N_noFeature 638583 21437958 5733700 N_ambiguous 631747 20026 97994 UnstrandedReadsAssigned:25782150 PositiveStrandReadsAssigned:5594496 NegativeStrandReadsAssigned:21220786 Dataset is classified unstranded MeadianReadLen=149 20thPercentileLength=136 echo kmer=131 SRR6940293 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6940293-trimmed-pair1.fastq SRR6940293-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,473,800 reads, 26,775,628 reads pseudoaligned [quant] estimated average fragment length: 185.599 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR6940293.ke.tsv 35125 SRR6940293.se.tsv 88098 total ==> SRR6940293.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.506 0 0 PNS24247 1044 859.401 29.1624 1.6413 PNS24249 1928 1743.4 266.148 7.3839 PNS24246 1044 859.401 29.1624 1.6413 PNS24248 1044 859.401 29.1624 1.6413 PNS24244 1471 1286.4 62.3645 2.34488 PNS24243 293 112.43 17 7.3135 KQK14069 1603 1418.4 5262.07 179.439 KQK14071 474 290.821 568.786 94.5982 ==> SRR6940293.se.tsv <== BRADI_1g14170v3 6057 BRADI_1g53295v3 82 BRADI_1g59795v3 611 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 322 BRADI_1g74790v3 326 BRADI_1g09890v3 0 BRADI_1g77505v3 367 BRADI_1g48960v3 0 SRR6940293 completed mapping pipeline successfully