Starting /dee2/code/volunteer_pipeline.sh SRR6940298 current disk space = 1551902965760 free memory = 1328169684 SRR6940298 SRAfilesize c94394fdf6c32a1cdcb725ab238c3eda SRR6940298.sra SRR6940298.sra file validated SRR6940298 is paired end SRR6940298 is conventional basespace SRR6940298 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940298_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.56775 34.0 31.0 34.0 30.0 34.0 2 31.9895 34.0 33.0 34.0 30.0 34.0 3 32.95675 34.0 34.0 34.0 30.0 34.0 4 36.50225 37.0 37.0 37.0 35.0 37.0 5 36.54675 37.0 37.0 37.0 35.0 37.0 6 36.58975 37.0 37.0 37.0 35.0 37.0 7 36.56975 37.0 37.0 37.0 35.0 37.0 8 36.5885 37.0 37.0 37.0 35.0 37.0 9 38.447 39.0 39.0 39.0 37.0 39.0 10-14 38.79295 39.4 39.2 39.4 37.2 39.4 15-19 40.0294 41.0 40.0 41.0 38.0 41.0 20-24 39.847249999999995 41.0 40.0 41.0 37.8 41.0 25-29 39.5153 41.0 39.8 41.0 36.2 41.0 30-34 39.10155 41.0 39.0 41.0 35.0 41.0 35-39 38.5852 40.2 37.6 41.0 35.0 41.0 40-44 38.01775 40.0 36.0 41.0 34.0 41.0 45-49 37.3226 39.4 35.0 41.0 33.0 41.0 50-54 36.905649999999994 38.6 35.0 41.0 33.0 41.0 55-59 36.52165 37.0 35.0 40.8 33.0 41.0 60-64 35.86025 35.4 35.0 39.6 33.0 41.0 65-69 35.1572 35.0 35.0 38.4 32.0 40.8 70-74 34.424749999999996 35.0 35.0 36.6 31.0 39.2 75-79 33.42059999999999 34.8 33.4 35.2 29.6 37.4 80-84 33.37045 35.0 34.0 35.0 30.6 36.2 85-89 32.9673 35.0 34.0 35.0 29.6 35.6 90-94 32.6483 35.0 33.8 35.0 28.6 35.0 95-99 32.29845 35.0 33.0 35.0 27.4 35.0 100-104 32.0595 35.0 33.0 35.0 26.8 35.0 105-109 31.751300000000004 35.0 33.0 35.0 25.4 35.0 110-114 31.4061 35.0 32.8 35.0 24.2 35.0 115-119 30.8074 34.6 32.0 35.0 20.6 35.0 120-124 30.340299999999996 34.0 31.0 35.0 18.6 35.0 125-129 29.9276 34.0 30.6 35.0 14.8 35.0 130-134 29.27505 34.0 29.4 35.0 5.4 35.0 135-139 28.7856 34.0 29.0 35.0 2.0 35.0 140-144 27.8705 33.2 27.0 35.0 2.0 35.0 145-149 26.742549999999994 33.0 25.6 35.0 2.0 35.0 150 23.11225 29.0 15.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 2.0 5 0.0 6 3.0 7 7.0 8 4.0 9 13.0 10 3.0 11 6.0 12 5.0 13 7.0 14 7.0 15 8.0 16 15.0 17 16.0 18 13.0 19 22.0 20 19.0 21 23.0 22 23.0 23 17.0 24 33.0 25 33.0 26 45.0 27 63.0 28 49.0 29 72.0 30 101.0 31 104.0 32 153.0 33 228.0 34 356.0 35 697.0 36 1049.0 37 798.0 38 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.31512834516658 11.551064991807754 11.74221736755871 43.39158929546696 2 28.549999999999997 12.575 23.375 35.5 3 28.95 13.925 17.349999999999998 39.775 4 32.35 17.05 16.525000000000002 34.075 5 33.775 21.475 19.375 25.374999999999996 6 33.1 25.174999999999997 18.075 23.65 7 24.75 26.125 29.075 20.05 8 25.174999999999997 22.725 26.150000000000002 25.95 9 25.624999999999996 20.150000000000002 26.900000000000002 27.325 10-14 26.22 24.7 22.39 26.69 15-19 26.645000000000003 22.99 22.795 27.57 20-24 26.5 23.445 22.625 27.43 25-29 26.845000000000002 23.215 22.23 27.71 30-34 26.634999999999998 22.965 22.575 27.825 35-39 26.740000000000002 22.57 22.68 28.01 40-44 27.189999999999998 22.605 22.470000000000002 27.735 45-49 27.52 22.5 22.14 27.839999999999996 50-54 27.474999999999998 22.145 22.255 28.125 55-59 27.515 22.545 21.709999999999997 28.23 60-64 27.145000000000003 22.245 22.24 28.37 65-69 27.334999999999997 22.509999999999998 22.040000000000003 28.115000000000002 70-74 26.825 22.495 22.335 28.345 75-79 27.375 22.535 22.134999999999998 27.955000000000002 80-84 27.560000000000002 22.395 21.7 28.345 85-89 27.35 22.545 21.25 28.854999999999997 90-94 27.47 21.765 22.314999999999998 28.449999999999996 95-99 26.93 22.5 21.75 28.82 100-104 27.73 21.995 22.175 28.1 105-109 27.195000000000004 21.6 22.439999999999998 28.765 110-114 27.975 21.915000000000003 21.265 28.845 115-119 27.786963274713163 21.724535297359587 22.065233729144744 28.423267698782507 120-124 27.819172875931393 21.933289993499024 21.983297494624193 28.264239635945394 125-129 27.755000000000003 21.54 22.095000000000002 28.610000000000003 130-134 28.28 22.009999999999998 21.295 28.415000000000003 135-139 27.944999999999997 22.43 21.305 28.32 140-144 28.389999999999997 22.025 20.86 28.725 145-149 28.355000000000004 23.06 20.53 28.055000000000003 150 28.575 22.400000000000002 19.400000000000002 29.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.5 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.5 24 1.0 25 1.0 26 0.5 27 1.0 28 1.5 29 3.5 30 5.5 31 5.5 32 9.5 33 14.5 34 18.5 35 20.0 36 21.5 37 32.5 38 50.0 39 59.5 40 75.0 41 94.0 42 103.0 43 118.5 44 136.5 45 139.5 46 134.5 47 133.5 48 129.0 49 121.5 50 114.0 51 114.5 52 110.0 53 99.5 54 89.0 55 86.5 56 88.0 57 86.5 58 92.0 59 93.0 60 95.0 61 92.5 62 96.5 63 94.5 64 81.0 65 83.5 66 88.5 67 87.0 68 86.5 69 94.5 70 101.0 71 94.5 72 84.0 73 72.5 74 61.0 75 52.0 76 51.0 77 46.0 78 32.0 79 22.5 80 19.0 81 19.5 82 12.5 83 5.5 84 4.0 85 3.0 86 2.5 87 1.0 88 0.0 89 1.0 90 1.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.450000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.20500000000000002 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77341389728097 99.075 2 0.1510574018126888 0.3 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 18 0.44999999999999996 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.85 0.0 0.0 0.0 0.0 130-131 4.5375 0.0 0.0 0.0 0.0 132-133 5.425 0.0 0.0 0.0 0.0 134-135 6.300000000000001 0.0 0.0 0.0 0.0 136-137 7.199999999999999 0.0 0.0 0.0 0.0 138 7.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGCGTG 10 0.0069808904 143.95 2 CCTTCAA 10 0.0069808904 143.95 5 GTGCTCG 10 0.0069808904 143.95 6 >>END_MODULE SRR6940298 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940298_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8205 34.0 33.0 34.0 31.0 34.0 2 33.01225 34.0 33.0 34.0 31.0 34.0 3 33.01425 34.0 34.0 34.0 31.0 34.0 4 36.311 37.0 37.0 37.0 35.0 37.0 5 36.302 37.0 37.0 37.0 35.0 37.0 6 36.2455 37.0 37.0 37.0 35.0 37.0 7 36.2075 37.0 37.0 37.0 35.0 37.0 8 36.19275 37.0 37.0 37.0 35.0 37.0 9 37.98125 39.0 39.0 39.0 37.0 39.0 10-14 38.22935 39.4 39.2 39.4 37.2 39.4 15-19 39.4 41.0 40.0 41.0 37.8 41.0 20-24 39.104499999999994 41.0 40.0 41.0 36.6 41.0 25-29 38.7734 41.0 39.4 41.0 35.4 41.0 30-34 38.236650000000004 40.8 38.2 41.0 34.8 41.0 35-39 37.7054 40.0 37.2 41.0 33.4 41.0 40-44 36.89385 39.8 35.2 41.0 32.4 41.0 45-49 36.10710000000001 38.8 35.0 41.0 30.8 41.0 50-54 34.699850000000005 37.0 33.8 39.8 27.8 40.6 55-59 34.87005 35.8 34.6 40.0 29.0 41.0 60-64 34.47775 35.0 34.6 39.2 29.4 41.0 65-69 33.68485 35.0 34.0 37.6 27.8 40.6 70-74 32.9737 35.0 33.4 36.2 26.6 39.0 75-79 32.23950000000001 35.0 33.0 35.0 25.4 37.0 80-84 31.509000000000004 35.0 33.0 35.0 23.4 36.0 85-89 30.9685 35.0 32.0 35.0 21.0 35.0 90-94 30.434350000000002 34.8 31.6 35.0 18.2 35.0 95-99 29.8918 34.0 31.0 35.0 11.6 35.0 100-104 29.227549999999997 34.0 29.6 35.0 4.2 35.0 105-109 28.6322 34.0 28.6 35.0 2.0 35.0 110-114 27.917650000000002 33.2 27.0 35.0 2.0 35.0 115-119 27.09635 33.0 25.2 35.0 2.0 35.0 120-124 26.232350000000004 32.8 23.8 34.8 2.0 35.0 125-129 25.345000000000002 32.0 20.2 34.2 2.0 35.0 130-134 24.3441 31.0 16.0 34.0 2.0 35.0 135-139 23.265 30.6 3.6 34.0 2.0 35.0 140-144 21.861 29.4 2.0 34.0 2.0 35.0 145-149 20.102749999999997 28.2 2.0 33.6 2.0 35.0 150 17.27675 22.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 8.0 4 11.0 5 11.0 6 11.0 7 7.0 8 15.0 9 14.0 10 10.0 11 6.0 12 15.0 13 13.0 14 23.0 15 21.0 16 20.0 17 24.0 18 28.0 19 34.0 20 32.0 21 49.0 22 52.0 23 54.0 24 63.0 25 73.0 26 81.0 27 89.0 28 106.0 29 121.0 30 132.0 31 147.0 32 225.0 33 265.0 34 414.0 35 559.0 36 853.0 37 378.0 38 3.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.900000000000002 14.399999999999999 10.125 43.575 2 34.325 18.325 19.650000000000002 27.700000000000003 3 27.825 20.724999999999998 18.475 32.975 4 32.75 21.925 17.95 27.375 5 33.4 24.925 16.825000000000003 24.85 6 28.789394697348676 30.64032016008004 17.10855427713857 23.461730865432717 7 27.725 17.375 29.95 24.95 8 28.064032016008007 20.635317658829415 23.186593296648326 28.114057028514257 9 27.495621716287218 19.489617212909682 23.892919689767325 29.12184138103578 10-14 28.045424983741057 23.39786882785532 21.38175996798239 27.17494622042123 15-19 28.130317285557 22.490241217095384 21.88970073065759 27.48974076669002 20-24 28.864534854626434 22.098783966371414 21.84356703197718 27.19311414702497 25-29 28.46634976232174 22.526895171378534 21.51113335001251 27.495621716287218 30-34 28.899564629935444 21.81354151028374 21.59835860481409 27.688535254966723 35-39 28.302547930119637 22.600991139810784 22.150473044000602 26.945987886068977 40-44 28.61861861861862 21.9019019019019 21.676676676676678 27.802802802802802 45-49 28.15393084121503 22.268928589300906 21.628384126507534 27.94875644297653 50-54 28.602172063460284 22.206095791001452 21.67058705770482 27.521145087833442 55-59 28.86164623467601 22.271703777833373 21.52614460845634 27.340505379034276 60-64 28.701526144608458 22.316737553164874 21.225919439579684 27.755816862646988 65-69 28.83518462924047 22.490743520464328 21.620134093865705 27.0539377564295 70-74 28.376282211658744 22.376782586940205 21.966474856142106 27.280460345258945 75-79 28.519963974782346 22.610827579305514 21.204843390373263 27.664365055538877 80-84 29.036614645858343 22.338935574229694 21.648659463785513 26.975790316126453 85-89 28.499249624812407 21.885942971485743 21.925962981490745 27.688844422211105 90-94 28.87665749311984 22.076557418063548 21.71128346259695 27.335501626219667 95-99 29.337270998097907 22.259485433977375 21.228351186304938 27.17489238161978 100-104 28.32398878654385 22.031437725270326 21.405686824189026 28.238886663996798 105-109 29.18188641481111 22.41180885664248 21.080810607955964 27.32549412059044 110-114 28.951055950355318 21.88970073065759 21.419277349614653 27.739965969372438 115-119 29.249486807189705 21.388874981224653 21.589145346217393 27.77249286536825 120-124 29.123492015818194 21.519747709866348 21.61986284226861 27.736897432046852 125-129 29.665382884009407 21.702595908567996 21.137398089331267 27.494623118091333 130-134 30.321224857400182 21.900330231161814 20.239167417192032 27.539277494245972 135-139 30.17970666266206 22.175501827101165 20.413475496821345 27.23131601341543 140-144 30.708779657623385 22.24446891580739 19.961958153969366 27.08479327259986 145-149 31.63898339003402 22.31338803281969 19.61176706023614 26.435861516910148 150 33.575 21.7 17.375 27.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.0 25 0.5 26 2.0 27 2.0 28 1.5 29 4.0 30 4.0 31 3.5 32 6.5 33 12.0 34 15.0 35 17.5 36 23.5 37 31.0 38 39.0 39 50.0 40 67.5 41 85.5 42 96.5 43 109.0 44 116.5 45 109.5 46 119.0 47 128.5 48 134.0 49 131.0 50 120.5 51 117.5 52 95.0 53 88.0 54 106.5 55 109.0 56 100.0 57 93.5 58 99.0 59 102.5 60 90.5 61 92.5 62 96.5 63 91.0 64 90.5 65 95.5 66 89.5 67 85.5 68 96.0 69 96.5 70 93.5 71 92.0 72 84.5 73 70.5 74 66.0 75 58.5 76 44.5 77 43.5 78 38.5 79 24.0 80 18.5 81 17.5 82 18.5 83 18.0 84 10.0 85 6.0 86 4.0 87 4.0 88 3.5 89 1.5 90 1.0 91 0.5 92 1.0 93 1.0 94 0.0 95 1.5 96 1.5 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.05 9 0.075 10-14 0.055 15-19 0.09 20-24 0.08499999999999999 25-29 0.075 30-34 0.08499999999999999 35-39 0.11499999999999999 40-44 0.1 45-49 0.08499999999999999 50-54 0.095 55-59 0.075 60-64 0.075 65-69 0.06999999999999999 70-74 0.075 75-79 0.06999999999999999 80-84 0.04 85-89 0.05 90-94 0.075 95-99 0.11 100-104 0.12 105-109 0.075 110-114 0.09 115-119 0.135 120-124 0.11499999999999999 125-129 0.034999999999999996 130-134 0.06999999999999999 135-139 0.11499999999999999 140-144 0.11 145-149 0.06 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1625 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.925 0.0 0.0 0.0 0.0 122-123 2.2125 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.1 0.0 0.0 0.0 0.0 128-129 3.6 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.887499999999999 0.0 0.0 0.0 0.0 136-137 6.7375 0.0 0.0 0.0 0.0 138 7.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGATC 10 0.006973645 144.0 2 >>END_MODULE Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298500 spots for SRR6940298.sra Written 2298500 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra Read 2298484 spots for SRR6940298.sra Written 2298484 spots for SRR6940298.sra SRR ids: ['SRR6940298.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_541_qnz5 SRR6940298.sra spots: 45969696 blocks: [[1, 2298484], [2298485, 4596968], [4596969, 6895452], [6895453, 9193936], [9193937, 11492420], [11492421, 13790904], [13790905, 16089388], [16089389, 18387872], [18387873, 20686356], [20686357, 22984840], [22984841, 25283324], [25283325, 27581808], [27581809, 29880292], [29880293, 32178776], [32178777, 34477260], [34477261, 36775744], [36775745, 39074228], [39074229, 41372712], [41372713, 43671196], [43671197, 45969696]] SRR6940298 file size 15466136 SRR6940298 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6940298 SRR6940298_1.fastq SRR6940298_2.fastq Input file: SRR6940298_1.fastq Paired file: SRR6940298_2.fastq trimmed: SRR6940298-trimmed-pair1.fastq, SRR6940298-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:30:42 2024 >> started Fri Dec 6 10:31:49 2024 >> done (67.799s) 45969696 read pairs processed; of these: 228255 ( 0.50%) short read pairs filtered out after trimming by size control 341820 ( 0.74%) empty read pairs filtered out after trimming by size control 45399621 (98.76%) read pairs available; of these: 25621727 (56.44%) trimmed read pairs available after processing 19777894 (43.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 169 0.00% 19 1008 0.00% 20 368 0.00% 21 588 0.00% 22 913 0.00% 23 1178 0.00% 24 1526 0.00% 25 1840 0.00% 26 2238 0.00% 27 2582 0.01% 28 2920 0.01% 29 3374 0.01% 30 3667 0.01% 31 4069 0.01% 32 4352 0.01% 33 4615 0.01% 34 4810 0.01% 35 5077 0.01% 36 5180 0.01% 37 5399 0.01% 38 5876 0.01% 39 6065 0.01% 40 6026 0.01% 41 6253 0.01% 42 6641 0.01% 43 6943 0.02% 44 6937 0.02% 45 7196 0.02% 46 7548 0.02% 47 7797 0.02% 48 7743 0.02% 49 8347 0.02% 50 8126 0.02% 51 8386 0.02% 52 8640 0.02% 53 9064 0.02% 54 9269 0.02% 55 9498 0.02% 56 9794 0.02% 57 10232 0.02% 58 11146 0.02% 59 10647 0.02% 60 11158 0.02% 61 11625 0.03% 62 11961 0.03% 63 12356 0.03% 64 12823 0.03% 65 13498 0.03% 66 14133 0.03% 67 14777 0.03% 68 15281 0.03% 69 16115 0.04% 70 17034 0.04% 71 18067 0.04% 72 18715 0.04% 73 19853 0.04% 74 21137 0.05% 75 22488 0.05% 76 23659 0.05% 77 25099 0.06% 78 26634 0.06% 79 28947 0.06% 80 30642 0.07% 81 32823 0.07% 82 35582 0.08% 83 38126 0.08% 84 49355 0.11% 85 51817 0.11% 86 55931 0.12% 87 59917 0.13% 88 61508 0.14% 89 62311 0.14% 90 64590 0.14% 91 66092 0.15% 92 67839 0.15% 93 69978 0.15% 94 71382 0.16% 95 74096 0.16% 96 74488 0.16% 97 75050 0.17% 98 77840 0.17% 99 81317 0.18% 100 74780 0.16% 101 75241 0.17% 102 85186 0.19% 103 92341 0.20% 104 103462 0.23% 105 105556 0.23% 106 111049 0.24% 107 111345 0.25% 108 125537 0.28% 109 130509 0.29% 110 138682 0.31% 111 148549 0.33% 112 152847 0.34% 113 166145 0.37% 114 182333 0.40% 115 201340 0.44% 116 203487 0.45% 117 209487 0.46% 118 201639 0.44% 119 224997 0.50% 120 235008 0.52% 121 261443 0.58% 122 267127 0.59% 123 288293 0.64% 124 300294 0.66% 125 285973 0.63% 126 320784 0.71% 127 339377 0.75% 128 374787 0.83% 129 394086 0.87% 130 421474 0.93% 131 447909 0.99% 132 451103 0.99% 133 476392 1.05% 134 506565 1.12% 135 537525 1.18% 136 572415 1.26% 137 599759 1.32% 138 620731 1.37% 139 643722 1.42% 140 676882 1.49% 141 710280 1.56% 142 768715 1.69% 143 822852 1.81% 144 902855 1.99% 145 1019021 2.24% 146 1207969 2.66% 147 1502030 3.31% 148 1892894 4.17% 149 3138859 6.91% 150 19777894 43.56% 45399621 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.46 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=4.2 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=337.72 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=29.9 sequence=CGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=31 prefix-density=0.28 prefix-fanout=3.0 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=348.62 fanout-score-rank=1 prefix-density=1.36 prefix-fanout=25.0 sequence=GGCGGCGGCGCC SRR6940298 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:32:40 Started mapping on | Dec 06 10:32:41 Finished on | Dec 06 10:35:44 Mapping speed, Million of reads per hour | 893.11 Number of input reads | 45399621 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 42336312 Uniquely mapped reads % | 93.25% Average mapped length | 279.40 Number of splices: Total | 29740201 Number of splices: Annotated (sjdb) | 27770356 Number of splices: GT/AG | 29217309 Number of splices: GC/AG | 442475 Number of splices: AT/AC | 18375 Number of splices: Non-canonical | 62042 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1369805 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 100866 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 1.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1804001 1804001 1804001 N_multimapping 1369805 1369805 1369805 N_noFeature 1329097 34327293 8709741 N_ambiguous 769857 25978 127257 UnstrandedReadsAssigned:40237358 PositiveStrandReadsAssigned:7983041 NegativeStrandReadsAssigned:33499314 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR6940298 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6940298-trimmed-pair1.fastq SRR6940298-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,399,621 reads, 42,200,041 reads pseudoaligned [quant] estimated average fragment length: 192.665 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR6940298.ke.tsv 35125 SRR6940298.se.tsv 88098 total ==> SRR6940298.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.598 0 0 PNS24247 1044 852.335 111.386 4.42028 PNS24249 1928 1736.34 1304.02 25.4027 PNS24246 1044 852.335 111.386 4.42028 PNS24248 1044 852.335 111.386 4.42028 PNS24244 1471 1279.34 145.824 3.85544 PNS24243 293 108.038 53 16.5932 KQK14069 1603 1411.34 12574.4 301.36 KQK14071 474 284.769 670.664 79.6603 ==> SRR6940298.se.tsv <== BRADI_1g14170v3 13246 BRADI_1g53295v3 192 BRADI_1g59795v3 862 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 607 BRADI_1g74790v3 4254 BRADI_1g09890v3 0 BRADI_1g77505v3 451 BRADI_1g48960v3 1 SRR6940298 completed mapping pipeline successfully