Starting /dee2/code/volunteer_pipeline.sh SRR6940301 current disk space = 1551911026688 free memory = 1604594016 SRR6940301 SRAfilesize 6a2abe3db866c127f85f66ca91fe5fc0 SRR6940301.sra SRR6940301.sra file validated SRR6940301 is paired end SRR6940301 is conventional basespace SRR6940301 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940301_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.64275 34.0 31.0 34.0 30.0 34.0 2 31.88325 34.0 31.0 34.0 30.0 34.0 3 32.71475 34.0 31.0 34.0 30.0 34.0 4 36.363 37.0 37.0 37.0 35.0 37.0 5 36.344 37.0 37.0 37.0 35.0 37.0 6 36.30075 37.0 37.0 37.0 35.0 37.0 7 36.22425 37.0 37.0 37.0 35.0 37.0 8 36.3 37.0 37.0 37.0 35.0 37.0 9 38.13525 39.0 39.0 39.0 37.0 39.0 10-14 38.4533 39.4 39.2 39.4 37.0 39.4 15-19 39.5856 41.0 40.0 41.0 37.0 41.0 20-24 39.3323 41.0 39.0 41.0 36.2 41.0 25-29 38.8964 40.2 38.6 41.0 35.0 41.0 30-34 38.32725 40.0 37.8 41.0 34.2 41.0 35-39 37.67635 40.0 36.2 41.0 33.0 41.0 40-44 37.33105 39.6 35.2 41.0 33.0 41.0 45-49 36.67255 38.6 35.0 41.0 31.8 41.0 50-54 35.906150000000004 37.4 35.0 40.4 30.4 41.0 55-59 35.39765 35.6 34.8 40.0 30.2 41.0 60-64 35.15575 35.0 34.6 39.4 30.6 41.0 65-69 34.334050000000005 35.0 34.0 37.8 29.8 40.6 70-74 33.2329 35.0 33.4 36.2 27.4 39.2 75-79 32.21375 34.8 32.4 35.0 26.0 37.2 80-84 32.1546 35.0 33.0 35.0 26.0 36.2 85-89 31.641550000000002 35.0 33.0 35.0 24.4 35.4 90-94 31.293350000000004 35.0 32.8 35.0 23.8 35.0 95-99 30.8923 35.0 31.8 35.0 21.4 35.0 100-104 30.36145 34.4 31.2 35.0 18.2 35.0 105-109 29.85205 34.0 30.4 35.0 15.8 35.0 110-114 29.372249999999998 34.0 29.4 35.0 9.4 35.0 115-119 27.03185 33.2 23.4 35.0 2.0 35.0 120-124 27.60915 33.0 26.6 35.0 2.0 35.0 125-129 27.168 33.0 24.8 35.0 2.0 35.0 130-134 26.45625 33.0 24.0 35.0 2.0 35.0 135-139 25.43825 32.0 21.0 34.6 2.0 35.0 140-144 24.1342 31.0 11.4 34.0 2.0 35.0 145-149 22.5086 30.6 2.0 34.0 2.0 35.0 150 16.59275 19.0 2.0 30.0 2.0 33.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 3.0 6 4.0 7 12.0 8 6.0 9 8.0 10 13.0 11 18.0 12 8.0 13 11.0 14 10.0 15 18.0 16 15.0 17 26.0 18 43.0 19 38.0 20 27.0 21 35.0 22 50.0 23 51.0 24 48.0 25 45.0 26 61.0 27 92.0 28 95.0 29 126.0 30 140.0 31 155.0 32 227.0 33 303.0 34 449.0 35 643.0 36 795.0 37 419.0 38 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.836285560923244 11.057434245840044 11.782071926999462 42.32420826623725 2 30.0 12.35 22.35 35.3 3 28.599999999999998 13.3 17.075000000000003 41.025 4 32.775 17.549999999999997 15.225 34.449999999999996 5 35.0 20.95 18.675 25.374999999999996 6 34.225 23.3 17.75 24.725 7 23.724999999999998 27.1 29.299999999999997 19.875 8 24.7 23.974999999999998 26.174999999999997 25.15 9 27.650000000000002 17.875 27.450000000000003 27.025 10-14 26.240000000000002 24.69 22.29 26.779999999999998 15-19 26.87 22.425 22.99 27.715 20-24 26.840000000000003 23.135 22.465 27.560000000000002 25-29 27.305 21.705 22.365 28.625 30-34 26.340000000000003 23.22 22.23 28.21 35-39 27.255000000000003 22.259999999999998 21.77 28.715000000000003 40-44 27.650000000000002 22.28 21.72 28.349999999999998 45-49 27.584999999999997 21.77 22.235 28.410000000000004 50-54 27.325 21.515 22.16 28.999999999999996 55-59 26.97 21.81 22.255 28.965000000000003 60-64 27.644999999999996 22.115000000000002 21.98 28.26 65-69 27.49 23.07 21.495 27.944999999999997 70-74 27.595 22.89 21.515 28.000000000000004 75-79 27.43 22.185 21.7 28.685 80-84 28.475 22.015 20.810000000000002 28.7 85-89 27.82 21.775 21.185000000000002 29.220000000000002 90-94 28.754999999999995 21.68 20.51 29.054999999999996 95-99 28.515 21.43 21.029999999999998 29.025000000000002 100-104 28.28 21.385 21.115000000000002 29.220000000000002 105-109 28.415000000000003 21.57 20.845 29.17 110-114 28.43 20.91 21.560000000000002 29.099999999999998 115-119 28.943322742646306 21.020805575484268 21.20528851081275 28.830583171056677 120-124 28.694999999999997 21.279999999999998 20.89 29.134999999999998 125-129 29.235 20.990000000000002 20.87 28.904999999999998 130-134 28.615000000000002 21.645 20.669999999999998 29.07 135-139 28.595 21.505 20.599999999999998 29.299999999999997 140-144 29.45 22.005 20.43 28.115000000000002 145-149 29.220000000000002 22.075 19.765 28.939999999999998 150 30.275000000000002 20.974999999999998 17.5 31.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.0 26 1.5 27 3.0 28 2.5 29 3.0 30 3.5 31 6.0 32 8.5 33 12.0 34 18.5 35 26.0 36 30.0 37 37.0 38 47.0 39 53.5 40 69.5 41 85.0 42 96.5 43 107.5 44 122.5 45 126.0 46 130.5 47 136.5 48 126.5 49 110.0 50 105.0 51 109.5 52 95.5 53 84.0 54 77.5 55 77.5 56 90.5 57 89.5 58 82.0 59 87.5 60 94.5 61 103.0 62 110.5 63 108.0 64 104.5 65 100.5 66 91.0 67 98.0 68 106.0 69 87.0 70 80.0 71 83.0 72 82.5 73 78.5 74 63.0 75 60.0 76 59.5 77 52.0 78 47.0 79 32.0 80 20.5 81 18.5 82 14.5 83 12.5 84 9.5 85 6.0 86 3.5 87 3.0 88 1.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.8500000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 2.4299999999999997 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.23391215526047 97.15 2 0.6639427987742594 1.3 3 0.05107252298263534 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02553626149131767 0.22499999999999998 >10 0.02553626149131767 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 47 1.175 TruSeq Adapter, Index 5 (100% over 50bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 5 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.7625000000000002 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.9 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 4.3875 0.0 0.0 0.0 0.0 138 4.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGATG 10 0.00714285 142.84999 4 GGGGGGG 90 0.005439104 11.110557 35-39 >>END_MODULE SRR6940301 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6940301_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.103 34.0 31.0 34.0 31.0 34.0 2 32.3705 34.0 31.0 34.0 31.0 34.0 3 32.4415 34.0 31.0 34.0 31.0 34.0 4 35.73 37.0 37.0 37.0 35.0 37.0 5 35.758 37.0 37.0 37.0 35.0 37.0 6 35.577 37.0 37.0 37.0 35.0 37.0 7 35.53775 37.0 37.0 37.0 35.0 37.0 8 35.57575 37.0 37.0 37.0 35.0 37.0 9 37.2915 39.0 39.0 39.0 35.0 39.0 10-14 37.514300000000006 39.4 38.8 39.4 35.2 39.4 15-19 38.583299999999994 41.0 39.2 41.0 35.6 41.0 20-24 38.367 41.0 39.0 41.0 35.0 41.0 25-29 37.941500000000005 40.4 38.2 41.0 33.8 41.0 30-34 37.36515 40.0 37.6 41.0 32.6 41.0 35-39 36.62695 39.8 35.4 41.0 31.2 41.0 40-44 35.810700000000004 39.0 35.0 40.8 29.4 41.0 45-49 35.29200000000001 37.8 35.0 40.8 28.2 41.0 50-54 33.9606 35.6 33.2 39.6 25.4 40.6 55-59 33.66054999999999 35.0 33.0 39.4 24.4 41.0 60-64 32.86185 35.0 33.0 38.0 22.6 40.6 65-69 32.158699999999996 35.0 32.6 36.4 21.6 39.6 70-74 31.99525 35.0 33.0 35.4 23.2 38.4 75-79 31.37905 35.0 33.0 35.0 20.4 36.6 80-84 30.692700000000002 35.0 31.8 35.0 18.2 35.8 85-89 30.19355 35.0 31.0 35.0 13.4 35.0 90-94 29.6399 34.4 30.6 35.0 6.6 35.0 95-99 29.090300000000003 34.0 29.4 35.0 2.0 35.0 100-104 28.431400000000004 34.0 28.2 35.0 2.0 35.0 105-109 27.9326 33.8 27.0 35.0 2.0 35.0 110-114 27.17575 33.0 24.8 35.0 2.0 35.0 115-119 26.346299999999996 33.0 23.4 35.0 2.0 35.0 120-124 25.75835 33.0 21.0 35.0 2.0 35.0 125-129 24.760250000000003 31.4 17.2 34.6 2.0 35.0 130-134 23.77685 30.8 9.2 34.0 2.0 35.0 135-139 22.44545 30.0 2.0 34.0 2.0 35.0 140-144 21.3602 29.0 2.0 34.0 2.0 35.0 145-149 19.418599999999998 26.6 2.0 34.0 2.0 35.0 150 14.9735 15.0 2.0 29.0 2.0 33.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 72.0 3 14.0 4 6.0 5 10.0 6 9.0 7 10.0 8 11.0 9 16.0 10 14.0 11 15.0 12 22.0 13 22.0 14 15.0 15 31.0 16 32.0 17 20.0 18 44.0 19 28.0 20 44.0 21 53.0 22 57.0 23 66.0 24 63.0 25 62.0 26 89.0 27 86.0 28 108.0 29 132.0 30 149.0 31 169.0 32 220.0 33 342.0 34 441.0 35 531.0 36 683.0 37 312.0 38 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.800000000000004 14.099999999999998 11.425 40.675 2 33.675 17.875 18.325 30.125 3 28.799999999999997 20.375 17.925 32.9 4 33.4 20.175 16.875 29.549999999999997 5 32.9 24.125 17.075000000000003 25.900000000000002 6 30.15 28.199999999999996 17.474999999999998 24.175 7 28.675 17.25 29.099999999999998 24.975 8 29.275000000000002 20.825 21.2 28.7 9 27.175 21.075 24.349999999999998 27.400000000000002 10-14 28.645 23.135 20.19 28.03 15-19 28.955 22.16 20.48 28.405 20-24 29.270000000000003 21.404999999999998 21.245 28.08 25-29 29.29 22.23 20.74 27.74 30-34 29.45 21.765 20.82 27.965 35-39 28.84 22.085 21.015 28.060000000000002 40-44 30.080000000000002 21.099999999999998 20.59 28.23 45-49 29.565 20.94 21.075 28.42 50-54 29.515 21.18 20.555 28.749999999999996 55-59 28.485 21.175 21.605 28.735 60-64 28.13 22.775000000000002 20.419999999999998 28.675 65-69 28.46 23.095 20.225 28.22 70-74 28.249999999999996 22.305 20.369999999999997 29.075 75-79 28.084999999999997 21.845 21.33 28.74 80-84 28.689999999999998 21.675 21.07 28.565 85-89 28.505000000000003 21.5 20.885 29.110000000000003 90-94 28.68 21.77 21.325 28.225 95-99 28.71 21.645 20.630000000000003 29.015 100-104 29.59 20.61 21.3 28.499999999999996 105-109 28.59 21.905 20.474999999999998 29.03 110-114 29.549999999999997 21.195 20.96 28.294999999999998 115-119 28.68 21.46 20.71 29.15 120-124 28.54 21.85 20.89 28.720000000000002 125-129 29.555 21.23 20.575 28.64 130-134 30.464999999999996 21.21 19.994999999999997 28.33 135-139 29.87 21.395 20.32 28.415000000000003 140-144 30.335 21.27 19.7 28.694999999999997 145-149 30.464999999999996 21.790000000000003 19.455 28.29 150 32.074999999999996 20.724999999999998 17.95 29.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 0.5 27 1.0 28 1.5 29 3.0 30 5.0 31 6.0 32 5.5 33 8.0 34 11.5 35 14.0 36 22.5 37 28.5 38 35.0 39 52.5 40 58.0 41 69.5 42 75.5 43 86.5 44 117.5 45 117.0 46 112.5 47 110.5 48 112.5 49 111.5 50 102.0 51 101.0 52 90.0 53 90.5 54 93.0 55 85.5 56 84.5 57 97.5 58 100.0 59 94.5 60 104.0 61 101.0 62 101.5 63 113.0 64 115.0 65 115.5 66 107.5 67 105.0 68 113.5 69 108.0 70 94.5 71 87.5 72 98.0 73 90.5 74 73.0 75 63.5 76 54.5 77 50.0 78 45.0 79 35.5 80 28.0 81 26.0 82 16.5 83 11.5 84 8.0 85 4.0 86 3.0 87 3.5 88 4.5 89 2.0 90 1.0 91 1.5 92 2.0 93 1.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09136799596163 98.15 2 0.8581524482584554 1.7000000000000002 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.037500000000000006 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.5375 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.425 0.0 0.0 0.0 0.0 136-137 4.1375 0.0 0.0 0.0 0.0 138 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCCA 10 0.006973645 144.0 5 AACTTCC 10 0.006973645 144.0 4 TAACTTC 10 0.006973645 144.0 3 CTAACTT 10 0.006973645 144.0 2 TTCCATG 10 0.006973645 144.0 7 GCTAACT 10 0.006973645 144.0 1 CTTCCAT 10 0.006973645 144.0 6 TCATGGC 20 0.006139246 28.8 45-49 >>END_MODULE Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767617 spots for SRR6940301.sra Written 4767617 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra Read 4767606 spots for SRR6940301.sra Written 4767606 spots for SRR6940301.sra SRR ids: ['SRR6940301.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h62gd_tv SRR6940301.sra spots: 95352131 blocks: [[1, 4767606], [4767607, 9535212], [9535213, 14302818], [14302819, 19070424], [19070425, 23838030], [23838031, 28605636], [28605637, 33373242], [33373243, 38140848], [38140849, 42908454], [42908455, 47676060], [47676061, 52443666], [52443667, 57211272], [57211273, 61978878], [61978879, 66746484], [66746485, 71514090], [71514091, 76281696], [76281697, 81049302], [81049303, 85816908], [85816909, 90584514], [90584515, 95352131]] SRR6940301 file size 32103773 SRR6940301 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6940301 SRR6940301_1.fastq SRR6940301_2.fastq Input file: SRR6940301_1.fastq Paired file: SRR6940301_2.fastq trimmed: SRR6940301-trimmed-pair1.fastq, SRR6940301-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:39:44 2024 >> started Fri Dec 6 10:41:53 2024 >> done (128.459s) 95352131 read pairs processed; of these: 386239 ( 0.41%) short read pairs filtered out after trimming by size control 1535526 ( 1.61%) empty read pairs filtered out after trimming by size control 93430366 (97.98%) read pairs available; of these: 63206928 (67.65%) trimmed read pairs available after processing 30223438 (32.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 384 0.00% 19 1436 0.00% 20 960 0.00% 21 1591 0.00% 22 2331 0.00% 23 3295 0.00% 24 4156 0.00% 25 5040 0.01% 26 5847 0.01% 27 6911 0.01% 28 8010 0.01% 29 8904 0.01% 30 9827 0.01% 31 10796 0.01% 32 11863 0.01% 33 12362 0.01% 34 13334 0.01% 35 14078 0.02% 36 14866 0.02% 37 15370 0.02% 38 16146 0.02% 39 16430 0.02% 40 17386 0.02% 41 18275 0.02% 42 18710 0.02% 43 18797 0.02% 44 19487 0.02% 45 19865 0.02% 46 20385 0.02% 47 21582 0.02% 48 20911 0.02% 49 22062 0.02% 50 21832 0.02% 51 23621 0.03% 52 22718 0.02% 53 23142 0.02% 54 23588 0.03% 55 24483 0.03% 56 24483 0.03% 57 25534 0.03% 58 25633 0.03% 59 27263 0.03% 60 27400 0.03% 61 29456 0.03% 62 28931 0.03% 63 29955 0.03% 64 31352 0.03% 65 32948 0.04% 66 33501 0.04% 67 34571 0.04% 68 36024 0.04% 69 37692 0.04% 70 38476 0.04% 71 41358 0.04% 72 42178 0.05% 73 43744 0.05% 74 46983 0.05% 75 48666 0.05% 76 51117 0.05% 77 54075 0.06% 78 57399 0.06% 79 61047 0.07% 80 64369 0.07% 81 68941 0.07% 82 73087 0.08% 83 77500 0.08% 84 92315 0.10% 85 98188 0.11% 86 105392 0.11% 87 110985 0.12% 88 112734 0.12% 89 115686 0.12% 90 117400 0.13% 91 120196 0.13% 92 123836 0.13% 93 126720 0.14% 94 129822 0.14% 95 132262 0.14% 96 136428 0.15% 97 138356 0.15% 98 143591 0.15% 99 146575 0.16% 100 145005 0.16% 101 148183 0.16% 102 155572 0.17% 103 160493 0.17% 104 173578 0.19% 105 181012 0.19% 106 191249 0.20% 107 195825 0.21% 108 209491 0.22% 109 216543 0.23% 110 236707 0.25% 111 252597 0.27% 112 271469 0.29% 113 284855 0.30% 114 298100 0.32% 115 332924 0.36% 116 327536 0.35% 117 347805 0.37% 118 331011 0.35% 119 354137 0.38% 120 363969 0.39% 121 414890 0.44% 122 441304 0.47% 123 522380 0.56% 124 565565 0.61% 125 563451 0.60% 126 575567 0.62% 127 588879 0.63% 128 695712 0.74% 129 756256 0.81% 130 783756 0.84% 131 816133 0.87% 132 925005 0.99% 133 996533 1.07% 134 1057408 1.13% 135 1125511 1.20% 136 1208818 1.29% 137 1277812 1.37% 138 1355531 1.45% 139 1457895 1.56% 140 1576977 1.69% 141 1714300 1.83% 142 1906130 2.04% 143 2126740 2.28% 144 2415263 2.59% 145 2822413 3.02% 146 3480680 3.73% 147 4543292 4.86% 148 6060822 6.49% 149 11588894 12.40% 150 30223438 32.35% 93430366 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=15 prefix-density=0.63 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.20 sequence-density-rank=24 fanout-score=85.31 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=14.6 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGAC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=10 prefix-density=0.74 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.21 sequence-density-rank=17 fanout-score=96.32 fanout-score-rank=1 prefix-density=1.30 prefix-fanout=15.9 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGATGGACATCAGAAAGTATACTGTGTTTTACCACCCTAATTAAGTAAACAACTTTTGG SRR6940301 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:42:41 Started mapping on | Dec 06 10:42:41 Finished on | Dec 06 10:49:28 Mapping speed, Million of reads per hour | 826.41 Number of input reads | 93430366 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 88193704 Uniquely mapped reads % | 94.40% Average mapped length | 280.19 Number of splices: Total | 68323690 Number of splices: Annotated (sjdb) | 64914709 Number of splices: GT/AG | 67354465 Number of splices: GC/AG | 822208 Number of splices: AT/AC | 21146 Number of splices: Non-canonical | 125871 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1509809 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 190716 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 1.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3982623 3982623 3982623 N_multimapping 1509809 1509809 1509809 N_noFeature 2023398 71642120 16926778 N_ambiguous 2095292 66749 407894 UnstrandedReadsAssigned:84075014 PositiveStrandReadsAssigned:16484835 NegativeStrandReadsAssigned:70859032 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR6940301 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6940301-trimmed-pair1.fastq SRR6940301-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 93,430,366 reads, 87,545,543 reads pseudoaligned [quant] estimated average fragment length: 196.24 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52973 SRR6940301.ke.tsv 35125 SRR6940301.se.tsv 88098 total ==> SRR6940301.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.837 0 0 PNS24247 1044 848.76 73.4663 1.27824 PNS24249 1928 1732.76 698.616 5.95399 PNS24246 1044 848.76 73.4663 1.27824 PNS24248 1044 848.76 73.4663 1.27824 PNS24244 1471 1275.76 134.986 1.56252 PNS24243 293 103.476 55 7.84931 KQK14069 1603 1407.76 1180.97 12.3885 KQK14071 474 280.273 121.862 6.42088 ==> SRR6940301.se.tsv <== BRADI_1g14170v3 1394 BRADI_1g53295v3 180 BRADI_1g59795v3 1890 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 1444 BRADI_1g74790v3 2396 BRADI_1g09890v3 3 BRADI_1g77505v3 968 BRADI_1g48960v3 1 SRR6940301 completed mapping pipeline successfully