Starting /dee2/code/volunteer_pipeline.sh SRR6941574 current disk space = 1551387521024 free memory = 1602338688 SRR6941574 SRAfilesize 540eef9bdc9f47690e88f2f83c315cb7 SRR6941574.sra SRR6941574.sra file validated SRR6941574 is paired end SRR6941574 is conventional basespace SRR6941574 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941574_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7945 34.0 33.0 34.0 32.0 34.0 2 32.91075 34.0 33.0 34.0 32.0 34.0 3 33.045 34.0 33.0 34.0 32.0 34.0 4 33.2655 34.0 33.0 34.0 32.0 34.0 5 33.2945 34.0 33.0 34.0 33.0 34.0 6 37.01025 38.0 37.0 38.0 36.0 38.0 7 37.37675 38.0 38.0 38.0 37.0 38.0 8 37.4475 38.0 38.0 38.0 37.0 38.0 9 37.5575 38.0 38.0 38.0 38.0 38.0 10-14 37.54795 38.0 38.0 38.0 38.0 38.0 15-19 37.5616 38.0 38.0 38.0 38.0 38.0 20-24 37.52135 38.0 38.0 38.0 38.0 38.0 25-29 37.562200000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.50545 38.0 38.0 38.0 38.0 38.0 35-39 37.52445 38.0 38.0 38.0 38.0 38.0 40-44 37.52105 38.0 38.0 38.0 38.0 38.0 45-49 37.4562 38.0 38.0 38.0 37.6 38.0 50-54 37.40695 38.0 38.0 38.0 37.2 38.0 55-59 37.4244 38.0 38.0 38.0 37.2 38.0 60-64 37.37305 38.0 38.0 38.0 37.0 38.0 65-69 37.31455 38.0 38.0 38.0 37.0 38.0 70-74 37.2414 38.0 38.0 38.0 36.8 38.0 75-79 37.2818 38.0 38.0 38.0 37.0 38.0 80-84 37.16495 38.0 38.0 38.0 36.0 38.0 85-89 37.129999999999995 38.0 38.0 38.0 36.0 38.0 90-94 37.13905 38.0 38.0 38.0 36.0 38.0 95-99 36.97245 38.0 38.0 38.0 35.8 38.0 100-104 36.9781 38.0 38.0 38.0 35.4 38.0 105-109 36.89919999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.7183 38.0 38.0 38.0 35.0 38.0 115-119 36.4864 38.0 38.0 38.0 34.0 38.0 120-124 36.4634 38.0 38.0 38.0 34.0 38.0 125-129 36.4851 38.0 38.0 38.0 34.0 38.0 130-134 36.2977 38.0 38.0 38.0 33.6 38.0 135-139 35.87564999999999 38.0 36.4 38.0 33.0 38.0 140-144 35.8131 38.0 36.0 38.0 32.6 38.0 145-149 35.068949999999994 38.0 35.8 38.0 31.0 38.0 150-151 31.1875 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 7.0 24 4.0 25 10.0 26 10.0 27 8.0 28 13.0 29 24.0 30 31.0 31 38.0 32 47.0 33 93.0 34 112.0 35 217.0 36 451.0 37 2929.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.78515420805019 10.297961317302667 7.318348144276006 35.59853633037115 2 22.680670167541887 13.15328832208052 34.98374593648413 29.182295573893473 3 19.1 16.35 25.624999999999996 38.925 4 24.95 24.349999999999998 22.525000000000002 28.175 5 25.424999999999997 30.4 22.925 21.25 6 21.525 32.925 24.3 21.25 7 18.4 25.624999999999996 37.574999999999996 18.4 8 21.125 23.65 28.050000000000004 27.175 9 19.625 21.8 33.85 24.725 10-14 22.66 26.805 26.119999999999997 24.415 15-19 22.689999999999998 25.21 26.66 25.44 20-24 22.545 25.61 26.185000000000002 25.66 25-29 23.330000000000002 25.490000000000002 25.919999999999998 25.259999999999998 30-34 23.35 25.540000000000003 26.1 25.009999999999998 35-39 22.725 25.81 25.95 25.515 40-44 22.939999999999998 25.685000000000002 25.83 25.545 45-49 22.625 25.685000000000002 25.785000000000004 25.905 50-54 22.38 26.16 25.605 25.855 55-59 23.125 25.885 25.53 25.46 60-64 22.84 25.924999999999997 25.365 25.869999999999997 65-69 23.115 25.71 25.814999999999998 25.36 70-74 23.162316231623162 25.07750775077508 26.37763776377638 25.38253825382538 75-79 22.793419012851928 25.75386307946192 25.978896834525177 25.473821073160973 80-84 22.919999999999998 25.41 25.869999999999997 25.8 85-89 23.47 25.245 25.585 25.7 90-94 23.7 25.695 25.275 25.330000000000002 95-99 22.965 25.4 25.495 26.14 100-104 23.29 25.935000000000002 25.405 25.369999999999997 105-109 23.395 25.679999999999996 25.64 25.285000000000004 110-114 23.77902321857486 25.98578863090472 24.92493995196157 25.31024819855885 115-119 23.513499974953664 25.63742924410159 25.321845414015932 25.527225366928818 120-124 23.785 26.125 24.565 25.525 125-129 23.810000000000002 25.585 25.405 25.2 130-134 23.669999999999998 25.45 25.240000000000002 25.64 135-139 23.635 26.365 25.085 24.915000000000003 140-144 23.26 26.090000000000003 24.58 26.07 145-149 23.26 26.784999999999997 24.08 25.874999999999996 150-151 23.474999999999998 26.6 24.125 25.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 0.5 27 0.5 28 4.5 29 5.0 30 3.0 31 10.5 32 17.0 33 21.0 34 27.0 35 36.0 36 49.0 37 72.5 38 96.0 39 105.5 40 122.5 41 151.5 42 172.5 43 185.0 44 212.0 45 214.5 46 205.0 47 206.0 48 188.5 49 183.5 50 183.5 51 159.5 52 134.0 53 124.5 54 113.0 55 101.5 56 92.0 57 82.0 58 74.5 59 59.0 60 55.5 61 69.0 62 66.5 63 58.5 64 59.0 65 56.0 66 47.0 67 36.5 68 30.0 69 26.0 70 21.0 71 17.0 72 11.5 73 8.5 74 9.5 75 6.0 76 3.0 77 2.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.35 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.015 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.08 115-119 0.185 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1375 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.8625 0.0 0.0 0.0 0.0 102-103 2.2125000000000004 0.0 0.0 0.0 0.0 104-105 2.5374999999999996 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.4125 0.0 0.0 0.0 0.0 110-111 3.9250000000000003 0.0 0.0 0.0 0.0 112-113 4.387499999999999 0.0 0.0 0.0 0.0 114-115 5.050000000000001 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.425000000000001 0.0 0.0 0.0 0.0 120-121 7.2125 0.0 0.0 0.0 0.0 122-123 7.95 0.0 0.0 0.0 0.0 124-125 8.524999999999999 0.0 0.0 0.0 0.0 126-127 9.2625 0.0 0.0 0.0 0.0 128-129 10.0375 0.0 0.0 0.0 0.0 130-131 10.65 0.0 0.0 0.0 0.0 132-133 11.35 0.0 0.0 0.0 0.0 134-135 12.075 0.0 0.0 0.0 0.0 136-137 12.95 0.0 0.0 0.0 0.0 138-139 13.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6941574 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941574_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0965 33.0 33.0 34.0 32.0 34.0 2 33.19025 34.0 33.0 34.0 32.0 34.0 3 33.207 34.0 33.0 34.0 33.0 34.0 4 33.1695 34.0 33.0 34.0 33.0 34.0 5 33.19175 34.0 33.0 34.0 33.0 34.0 6 37.23175 38.0 38.0 38.0 37.0 38.0 7 37.31475 38.0 38.0 38.0 38.0 38.0 8 37.27525 38.0 38.0 38.0 37.0 38.0 9 37.3085 38.0 38.0 38.0 37.0 38.0 10-14 37.2962 38.0 38.0 38.0 37.0 38.0 15-19 37.2618 38.0 38.0 38.0 37.0 38.0 20-24 37.229949999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.1793 38.0 38.0 38.0 37.0 38.0 30-34 37.18445 38.0 38.0 38.0 37.0 38.0 35-39 37.10675 38.0 38.0 38.0 36.8 38.0 40-44 37.126850000000005 38.0 38.0 38.0 36.8 38.0 45-49 37.160250000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.119749999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.05655 38.0 38.0 38.0 36.6 38.0 60-64 37.04815000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.955149999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.947199999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.8973 38.0 38.0 38.0 36.0 38.0 80-84 36.75115 38.0 38.0 38.0 35.4 38.0 85-89 36.76125 38.0 38.0 38.0 35.2 38.0 90-94 36.66035000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.5698 38.0 38.0 38.0 34.8 38.0 100-104 36.45784999999999 38.0 38.0 38.0 34.2 38.0 105-109 36.24679999999999 38.0 38.0 38.0 33.8 38.0 110-114 35.8799 38.0 37.8 38.0 32.6 38.0 115-119 35.436150000000005 38.0 36.8 38.0 30.2 38.0 120-124 35.497499999999995 38.0 36.4 38.0 30.6 38.0 125-129 35.492 38.0 36.4 38.0 31.8 38.0 130-134 35.307249999999996 38.0 36.0 38.0 31.0 38.0 135-139 34.97675 38.0 35.8 38.0 30.0 38.0 140-144 34.4291 38.0 34.6 38.0 27.6 38.0 145-149 33.32085 38.0 33.2 38.0 19.2 38.0 150-151 27.663375000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 5.0 11 0.0 12 2.0 13 3.0 14 0.0 15 1.0 16 0.0 17 3.0 18 6.0 19 6.0 20 7.0 21 4.0 22 3.0 23 13.0 24 13.0 25 16.0 26 15.0 27 23.0 28 33.0 29 36.0 30 36.0 31 49.0 32 77.0 33 101.0 34 157.0 35 245.0 36 552.0 37 2587.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.05 19.925 10.45 27.575 2 28.749999999999996 24.95 28.125 18.175 3 21.625 25.0 30.225 23.150000000000002 4 26.424999999999997 31.025000000000002 20.7 21.85 5 26.875 33.425 19.975 19.725 6 23.724999999999998 36.3 20.25 19.725 7 22.85 19.125 35.275 22.75 8 22.725 23.125 25.324999999999996 28.825 9 23.275000000000002 23.549999999999997 28.425 24.75 10-14 25.345000000000002 26.790000000000003 23.65 24.215 15-19 26.529999999999998 25.180000000000003 24.82 23.47 20-24 25.385 26.179999999999996 24.709999999999997 23.724999999999998 25-29 25.44 26.025 24.59 23.945 30-34 25.724999999999998 25.564999999999998 25.080000000000002 23.630000000000003 35-39 25.369999999999997 25.665 25.345000000000002 23.62 40-44 25.900000000000002 25.69 24.92 23.49 45-49 25.724999999999998 25.71 24.945 23.62 50-54 25.765 25.845000000000002 24.615000000000002 23.775 55-59 25.945 25.83 24.845 23.380000000000003 60-64 25.845000000000002 25.845000000000002 24.97 23.34 65-69 26.119999999999997 25.405 25.369999999999997 23.105 70-74 25.345000000000002 25.230000000000004 25.825 23.599999999999998 75-79 25.619999999999997 25.790000000000003 25.165 23.425 80-84 25.995 26.045 25.145 22.814999999999998 85-89 26.314999999999998 26.090000000000003 24.154999999999998 23.44 90-94 25.64 25.445 24.845 24.07 95-99 25.955000000000002 26.05 25.005 22.99 100-104 25.905 26.14 25.25 22.705000000000002 105-109 26.135 25.919999999999998 25.014999999999997 22.93 110-114 26.365 26.305 24.834999999999997 22.495 115-119 26.625 26.155 24.52 22.7 120-124 27.165 26.005 24.279999999999998 22.55 125-129 27.01 25.979999999999997 24.55 22.46 130-134 27.375 25.95 24.86 21.815 135-139 27.52 26.02 24.775 21.685 140-144 27.815 26.77 24.4 21.015 145-149 27.665 26.8 24.26 21.275 150-151 27.712500000000002 25.474999999999998 25.3125 21.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 2.0 27 3.5 28 4.5 29 4.5 30 9.5 31 14.0 32 16.5 33 15.5 34 23.0 35 40.5 36 43.5 37 57.0 38 77.5 39 93.0 40 122.0 41 153.5 42 168.5 43 168.0 44 183.0 45 204.0 46 209.5 47 210.5 48 194.0 49 172.5 50 162.0 51 146.5 52 139.0 53 129.0 54 109.0 55 111.5 56 103.5 57 85.5 58 83.5 59 80.0 60 75.0 61 74.0 62 72.5 63 63.0 64 58.0 65 56.0 66 49.5 67 47.0 68 44.5 69 30.0 70 25.5 71 21.5 72 10.0 73 9.0 74 7.0 75 4.0 76 4.0 77 2.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62254655259186 98.97500000000001 2 0.27679919476597886 0.5499999999999999 3 0.0 0.0 4 0.0754906894816306 0.3 5 0.0 0.0 6 0.0 0.0 7 0.025163563160543533 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.55 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.4 0.0 0.0 0.0 0.0 110-111 3.875 0.0 0.0 0.0 0.0 112-113 4.3375 0.0 0.0 0.0 0.0 114-115 4.975 0.0 0.0 0.0 0.0 116-117 5.6125 0.0 0.0 0.0 0.0 118-119 6.3375 0.0 0.0 0.0 0.0 120-121 7.137499999999999 0.0 0.0 0.0 0.0 122-123 7.824999999999999 0.0 0.0 0.0 0.0 124-125 8.4125 0.0 0.0 0.0 0.0 126-127 9.149999999999999 0.0 0.0 0.0 0.0 128-129 9.95 0.0 0.0 0.0 0.0 130-131 10.575 0.0 0.0 0.0 0.0 132-133 11.3 0.0 0.0 0.0 0.0 134-135 12.05 0.0 0.0 0.0 0.0 136-137 12.9875 0.0 0.0 0.0 0.0 138-139 13.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063161 spots for SRR6941574.sra Written 1063161 spots for SRR6941574.sra Read 1063180 spots for SRR6941574.sra Written 1063180 spots for SRR6941574.sra SRR ids: ['SRR6941574.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vv7b0k0i SRR6941574.sra spots: 21263239 blocks: [[1, 1063161], [1063162, 2126322], [2126323, 3189483], [3189484, 4252644], [4252645, 5315805], [5315806, 6378966], [6378967, 7442127], [7442128, 8505288], [8505289, 9568449], [9568450, 10631610], [10631611, 11694771], [11694772, 12757932], [12757933, 13821093], [13821094, 14884254], [14884255, 15947415], [15947416, 17010576], [17010577, 18073737], [18073738, 19136898], [19136899, 20200059], [20200060, 21263239]] SRR6941574 file size 7183713 SRR6941574 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941574 SRR6941574_1.fastq SRR6941574_2.fastq Input file: SRR6941574_1.fastq Paired file: SRR6941574_2.fastq trimmed: SRR6941574-trimmed-pair1.fastq, SRR6941574-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:47:43 2024 >> started Fri Dec 6 11:48:07 2024 >> done (24.252s) 21263239 read pairs processed; of these: 11940 ( 0.06%) short read pairs filtered out after trimming by size control 8416 ( 0.04%) empty read pairs filtered out after trimming by size control 21242883 (99.90%) read pairs available; of these: 11199358 (52.72%) trimmed read pairs available after processing 10043525 (47.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 9 0.00% 21 13 0.00% 22 15 0.00% 23 9 0.00% 24 17 0.00% 25 8 0.00% 26 14 0.00% 27 15 0.00% 28 14 0.00% 29 15 0.00% 30 21 0.00% 31 27 0.00% 32 16 0.00% 33 18 0.00% 34 21 0.00% 35 22 0.00% 36 23 0.00% 37 29 0.00% 38 36 0.00% 39 48 0.00% 40 41 0.00% 41 56 0.00% 42 59 0.00% 43 67 0.00% 44 67 0.00% 45 66 0.00% 46 63 0.00% 47 100 0.00% 48 90 0.00% 49 125 0.00% 50 159 0.00% 51 167 0.00% 52 210 0.00% 53 210 0.00% 54 255 0.00% 55 286 0.00% 56 305 0.00% 57 346 0.00% 58 370 0.00% 59 497 0.00% 60 556 0.00% 61 655 0.00% 62 782 0.00% 63 933 0.00% 64 986 0.00% 65 1064 0.01% 66 1277 0.01% 67 1432 0.01% 68 1694 0.01% 69 1918 0.01% 70 2104 0.01% 71 2584 0.01% 72 2934 0.01% 73 3461 0.02% 74 3676 0.02% 75 4305 0.02% 76 4553 0.02% 77 5040 0.02% 78 5795 0.03% 79 6534 0.03% 80 7330 0.03% 81 8290 0.04% 82 9755 0.05% 83 10946 0.05% 84 12780 0.06% 85 14013 0.07% 86 14895 0.07% 87 16128 0.08% 88 17328 0.08% 89 18496 0.09% 90 20102 0.09% 91 21738 0.10% 92 23959 0.11% 93 25967 0.12% 94 28305 0.13% 95 30195 0.14% 96 31457 0.15% 97 32954 0.16% 98 34035 0.16% 99 34891 0.16% 100 38041 0.18% 101 39297 0.18% 102 42357 0.20% 103 44541 0.21% 104 46353 0.22% 105 48761 0.23% 106 50703 0.24% 107 50732 0.24% 108 52536 0.25% 109 54653 0.26% 110 56136 0.26% 111 57511 0.27% 112 60541 0.28% 113 63967 0.30% 114 65951 0.31% 115 69110 0.33% 116 70707 0.33% 117 71765 0.34% 118 73066 0.34% 119 72590 0.34% 120 74746 0.35% 121 76004 0.36% 122 78103 0.37% 123 81408 0.38% 124 85134 0.40% 125 87808 0.41% 126 88899 0.42% 127 90445 0.43% 128 91245 0.43% 129 93250 0.44% 130 94749 0.45% 131 95453 0.45% 132 98940 0.47% 133 103544 0.49% 134 106902 0.50% 135 110886 0.52% 136 114459 0.54% 137 118100 0.56% 138 122239 0.58% 139 127475 0.60% 140 131790 0.62% 141 141391 0.67% 142 152880 0.72% 143 164325 0.77% 144 185764 0.87% 145 214598 1.01% 146 255459 1.20% 147 331057 1.56% 148 476145 2.24% 149 903926 4.26% 150 4703122 22.14% 151 10043525 47.28% 21242883 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=30 prefix-density=0.47 prefix-fanout=2.4 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=219.08 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=25.2 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=39 prefix-density=0.61 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=344.55 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=15.4 sequence=GAAGCAGAGTGTGGGTGAGGTCGCCACACTCGTCCTGAGCTCAGAGCTGAGCTGCTCCACCGAGGAGAAGAAGAAAAGATGGATCCCTGCAAGTACCGCCCGTCGAGCAGCTTCGACAAGAAGACCACGACGACCAACGCCGGCGCACCGGTGTGGAACGACAACGAGGCGCTGACGGTG SRR6941574 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:49:28 Started mapping on | Dec 06 11:50:06 Finished on | Dec 06 11:52:22 Mapping speed, Million of reads per hour | 562.31 Number of input reads | 21242883 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 20366793 Uniquely mapped reads % | 95.88% Average mapped length | 289.49 Number of splices: Total | 21281470 Number of splices: Annotated (sjdb) | 19892957 Number of splices: GT/AG | 20991363 Number of splices: GC/AG | 259093 Number of splices: AT/AC | 11385 Number of splices: Non-canonical | 19629 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232715 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 24719 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651911 651911 651911 N_multimapping 232715 232715 232715 N_noFeature 996823 19703796 1243652 N_ambiguous 491640 2765 75153 UnstrandedReadsAssigned:18878330 PositiveStrandReadsAssigned:660232 NegativeStrandReadsAssigned:19047988 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6941574 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941574-trimmed-pair1.fastq SRR6941574-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,242,883 reads, 19,163,190 reads pseudoaligned [quant] estimated average fragment length: 237.76 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 SRR6941574.ke.tsv 35125 SRR6941574.se.tsv 88098 total ==> SRR6941574.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.01 0 0 PNS24247 1044 807.24 100.673 9.82388 PNS24249 1928 1691.24 59.3925 2.76629 PNS24246 1044 807.24 100.673 9.82388 PNS24248 1044 807.24 100.673 9.82388 PNS24244 1471 1234.24 63.5871 4.05827 PNS24243 293 107.64 0 0 KQK14069 1603 1366.24 17308.5 997.937 KQK14071 474 255.384 430.856 132.896 ==> SRR6941574.se.tsv <== BRADI_1g14170v3 20477 BRADI_1g53295v3 198 BRADI_1g59795v3 1140 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 254 BRADI_1g74790v3 109 BRADI_1g09890v3 1 BRADI_1g77505v3 439 BRADI_1g48960v3 0 SRR6941574 completed mapping pipeline successfully