Starting /dee2/code/volunteer_pipeline.sh SRR6941575 current disk space = 1551412133888 free memory = 1601337796 SRR6941575 SRAfilesize b4870ba9927a324e41c12b7ae23dbcea SRR6941575.sra SRR6941575.sra file validated SRR6941575 is paired end SRR6941575 is conventional basespace SRR6941575 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63325 34.0 33.0 34.0 32.0 34.0 2 32.9665 34.0 33.0 34.0 32.0 34.0 3 33.0405 34.0 33.0 34.0 32.0 34.0 4 33.2895 34.0 33.0 34.0 32.0 34.0 5 33.36325 34.0 33.0 34.0 33.0 34.0 6 37.10675 38.0 37.0 38.0 36.0 38.0 7 37.42975 38.0 38.0 38.0 37.0 38.0 8 37.53225 38.0 38.0 38.0 38.0 38.0 9 37.63975 38.0 38.0 38.0 38.0 38.0 10-14 37.5372 38.0 38.0 38.0 38.0 38.0 15-19 37.569100000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.5659 38.0 38.0 38.0 38.0 38.0 25-29 37.553450000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.517849999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.5621 38.0 38.0 38.0 38.0 38.0 40-44 37.5208 38.0 38.0 38.0 38.0 38.0 45-49 37.51335 38.0 38.0 38.0 38.0 38.0 50-54 37.44865 38.0 38.0 38.0 37.2 38.0 55-59 37.4111 38.0 38.0 38.0 37.2 38.0 60-64 37.36285 38.0 38.0 38.0 37.0 38.0 65-69 37.3123 38.0 38.0 38.0 37.0 38.0 70-74 37.28205 38.0 38.0 38.0 37.0 38.0 75-79 37.2554 38.0 38.0 38.0 37.0 38.0 80-84 37.191 38.0 38.0 38.0 36.4 38.0 85-89 37.1202 38.0 38.0 38.0 36.0 38.0 90-94 37.12265 38.0 38.0 38.0 36.0 38.0 95-99 36.9641 38.0 38.0 38.0 35.8 38.0 100-104 36.947500000000005 38.0 38.0 38.0 35.6 38.0 105-109 36.81660000000001 38.0 38.0 38.0 34.8 38.0 110-114 36.687400000000004 38.0 38.0 38.0 34.8 38.0 115-119 36.5198 38.0 38.0 38.0 34.2 38.0 120-124 36.48125 38.0 38.0 38.0 34.0 38.0 125-129 36.410849999999996 38.0 38.0 38.0 34.0 38.0 130-134 36.17595 38.0 38.0 38.0 33.6 38.0 135-139 35.9043 38.0 36.8 38.0 33.0 38.0 140-144 35.742 38.0 36.0 38.0 32.8 38.0 145-149 35.13535 38.0 36.0 38.0 31.4 38.0 150-151 31.280500000000004 35.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 3.0 16 0.0 17 1.0 18 2.0 19 0.0 20 0.0 21 4.0 22 5.0 23 5.0 24 4.0 25 8.0 26 6.0 27 14.0 28 15.0 29 20.0 30 30.0 31 39.0 32 51.0 33 70.0 34 109.0 35 174.0 36 505.0 37 2933.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.33439069521544 9.807031456515993 7.903780068728522 36.95479777954005 2 21.810905452726363 12.73136568284142 35.36768384192096 30.09004502251126 3 20.65 16.2 25.624999999999996 37.525 4 25.324999999999996 24.4 22.400000000000002 27.875 5 26.325 28.65 22.375 22.650000000000002 6 23.525 31.825 22.900000000000002 21.75 7 17.525 24.875 38.15 19.45 8 20.125 22.85 30.4 26.625 9 20.200000000000003 21.25 31.974999999999998 26.575 10-14 23.56 26.169999999999998 25.064999999999998 25.205 15-19 22.045 25.645 25.945 26.365 20-24 23.055 25.36 26.185000000000002 25.4 25-29 23.385 25.674999999999997 25.165 25.775 30-34 22.770000000000003 25.335 26.055 25.840000000000003 35-39 22.925 25.040000000000003 26.375 25.66 40-44 23.36 25.365 25.45 25.825 45-49 23.425 24.654999999999998 26.029999999999998 25.89 50-54 23.005 24.865000000000002 26.21 25.919999999999998 55-59 22.91 25.215 26.075 25.8 60-64 23.415 25.245 25.245 26.095000000000002 65-69 23.505000000000003 25.264999999999997 25.665 25.564999999999998 70-74 23.330000000000002 25.335 25.259999999999998 26.075 75-79 23.665 25.095 25.7 25.540000000000003 80-84 23.200000000000003 25.919999999999998 25.735000000000003 25.145 85-89 23.845 25.069999999999997 25.224999999999998 25.86 90-94 23.794999999999998 25.369999999999997 25.03 25.805 95-99 24.27 25.865 24.7 25.165 100-104 23.93 25.755 24.705 25.61 105-109 23.655 26.055 24.665 25.624999999999996 110-114 23.76688344172086 26.3831915957979 24.18209104552276 25.667833916958475 115-119 23.81238424187816 26.16508985333133 24.398057766431396 25.624468138359113 120-124 23.445 26.72 23.765 26.07 125-129 24.14 26.105 23.71 26.045 130-134 23.724999999999998 26.77 23.25 26.255 135-139 23.94 26.174999999999997 23.665 26.22 140-144 23.380000000000003 26.145000000000003 23.93 26.545 145-149 23.36 26.3 23.97 26.369999999999997 150-151 22.8625 25.75 23.8375 27.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 4.0 30 5.5 31 9.0 32 14.5 33 16.5 34 24.5 35 35.0 36 42.5 37 60.0 38 80.5 39 100.0 40 127.0 41 156.0 42 170.5 43 175.5 44 199.0 45 212.0 46 204.0 47 194.5 48 192.0 49 174.5 50 165.5 51 174.0 52 153.5 53 128.0 54 111.5 55 103.0 56 96.5 57 87.5 58 89.5 59 80.0 60 73.5 61 71.0 62 55.0 63 52.0 64 47.0 65 41.5 66 43.5 67 45.0 68 47.0 69 35.0 70 19.5 71 19.5 72 18.0 73 13.0 74 12.0 75 7.5 76 5.0 77 4.5 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.425 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.05 115-119 0.11499999999999999 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.7 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.375 0.0 0.0 0.0 0.0 84-85 1.65 0.0 0.0 0.0 0.0 86-87 2.075 0.0 0.0 0.0 0.0 88-89 2.6 0.0 0.0 0.0 0.0 90-91 3.05 0.0 0.0 0.0 0.0 92-93 3.7625 0.0 0.0 0.0 0.0 94-95 4.3 0.0 0.0 0.0 0.0 96-97 5.0 0.0 0.0 0.0 0.0 98-99 5.8 0.0 0.0 0.0 0.0 100-101 6.65 0.0 0.0 0.0 0.0 102-103 7.3625 0.0 0.0 0.0 0.0 104-105 8.0375 0.0 0.0 0.0 0.0 106-107 9.0 0.0 0.0 0.0 0.0 108-109 9.9875 0.0 0.0 0.0 0.0 110-111 11.0625 0.0 0.0 0.0 0.0 112-113 12.0375 0.0 0.0 0.0 0.0 114-115 13.1125 0.0 0.0 0.0 0.0 116-117 14.275 0.0 0.0 0.0 0.0 118-119 15.4625 0.0 0.0 0.0 0.0 120-121 16.6375 0.0 0.0 0.0 0.0 122-123 17.9375 0.0 0.0 0.0 0.0 124-125 19.15 0.0 0.0 0.0125 0.0 126-127 20.425 0.0 0.0 0.025 0.0 128-129 21.4625 0.0 0.0 0.025 0.0 130-131 22.5625 0.0 0.0 0.025 0.0 132-133 23.45 0.0 0.0 0.025 0.0 134-135 24.5625 0.0 0.0 0.025 0.0 136-137 25.85 0.0 0.0 0.025 0.0 138-139 27.1 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6941575 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941575_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18675 33.0 33.0 34.0 33.0 34.0 2 33.2465 34.0 33.0 34.0 33.0 34.0 3 33.2995 34.0 33.0 34.0 33.0 34.0 4 33.30175 34.0 33.0 34.0 33.0 34.0 5 33.27925 34.0 33.0 34.0 33.0 34.0 6 37.44375 38.0 38.0 38.0 38.0 38.0 7 37.4955 38.0 38.0 38.0 38.0 38.0 8 37.48325 38.0 38.0 38.0 38.0 38.0 9 37.51575 38.0 38.0 38.0 38.0 38.0 10-14 37.5029 38.0 38.0 38.0 38.0 38.0 15-19 37.43384999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.450199999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.387550000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.34605 38.0 38.0 38.0 37.8 38.0 35-39 37.3188 38.0 38.0 38.0 37.6 38.0 40-44 37.3533 38.0 38.0 38.0 37.0 38.0 45-49 37.363699999999994 38.0 38.0 38.0 37.8 38.0 50-54 37.2993 38.0 38.0 38.0 37.4 38.0 55-59 37.26780000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.2895 38.0 38.0 38.0 37.0 38.0 65-69 37.18755 38.0 38.0 38.0 37.0 38.0 70-74 37.188199999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.10565 38.0 38.0 38.0 36.4 38.0 80-84 36.97655 38.0 38.0 38.0 36.0 38.0 85-89 36.98479999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.90215 38.0 38.0 38.0 35.8 38.0 95-99 36.88505 38.0 38.0 38.0 35.6 38.0 100-104 36.79905 38.0 38.0 38.0 35.0 38.0 105-109 36.5557 38.0 38.0 38.0 34.2 38.0 110-114 36.18095 38.0 38.0 38.0 33.8 38.0 115-119 35.8426 38.0 37.2 38.0 32.0 38.0 120-124 35.79935 38.0 36.8 38.0 32.2 38.0 125-129 35.7889 38.0 36.8 38.0 32.2 38.0 130-134 35.53815 38.0 36.2 38.0 31.0 38.0 135-139 35.0354 38.0 35.6 38.0 29.6 38.0 140-144 34.30844999999999 38.0 34.2 38.0 26.4 38.0 145-149 33.1614 38.0 33.0 38.0 18.2 38.0 150-151 27.0195 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 3.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 3.0 14 3.0 15 0.0 16 1.0 17 0.0 18 2.0 19 3.0 20 1.0 21 3.0 22 5.0 23 5.0 24 5.0 25 13.0 26 19.0 27 17.0 28 14.0 29 33.0 30 35.0 31 56.0 32 52.0 33 93.0 34 159.0 35 276.0 36 594.0 37 2598.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.025 18.075 10.725 30.175 2 29.45 23.075000000000003 27.625 19.85 3 22.125 27.150000000000002 27.825 22.900000000000002 4 27.425 29.475 20.575 22.525000000000002 5 28.15 31.825 20.1 19.925 6 22.85 36.225 19.975 20.95 7 22.95 19.175 34.825 23.05 8 22.575 23.674999999999997 24.6 29.15 9 24.25 23.35 26.775 25.624999999999996 10-14 25.474999999999998 26.685 23.294999999999998 24.545 15-19 25.36 25.61 25.145 23.885 20-24 25.845000000000002 25.655 24.775 23.724999999999998 25-29 25.729999999999997 25.52 24.73 24.02 30-34 25.974999999999998 25.94 24.325 23.76 35-39 25.619999999999997 25.369999999999997 25.055 23.955000000000002 40-44 25.790000000000003 25.16 24.654999999999998 24.395 45-49 26.029999999999998 25.345000000000002 24.695 23.93 50-54 26.52 25.61 24.54 23.330000000000002 55-59 25.35 25.669999999999998 24.86 24.12 60-64 25.515 25.319999999999997 25.285000000000004 23.880000000000003 65-69 25.885 25.669999999999998 24.635 23.810000000000002 70-74 25.845000000000002 25.275 25.085 23.794999999999998 75-79 25.45 25.235000000000003 25.34 23.974999999999998 80-84 26.21 26.055 24.695 23.04 85-89 26.495 26.055 24.295 23.155 90-94 26.015 25.655 24.855 23.474999999999998 95-99 26.590000000000003 26.05 24.275 23.085 100-104 27.22 26.06 24.240000000000002 22.48 105-109 27.439999999999998 26.085 24.095 22.38 110-114 27.825 26.25 24.099999999999998 21.825 115-119 28.415000000000003 26.855 23.48 21.25 120-124 28.305000000000003 26.88 24.235 20.580000000000002 125-129 28.410000000000004 27.01 24.01 20.57 130-134 29.310000000000002 26.93 24.26 19.5 135-139 29.044999999999998 27.075 24.5 19.38 140-144 29.299999999999997 27.284999999999997 24.48 18.935 145-149 29.395 27.16 24.395 19.05 150-151 30.099999999999998 27.3 24.2375 18.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 2.5 27 2.5 28 2.5 29 5.0 30 6.0 31 7.0 32 13.5 33 19.0 34 19.5 35 28.5 36 40.0 37 51.5 38 80.0 39 100.5 40 112.0 41 145.5 42 170.5 43 184.0 44 194.0 45 197.5 46 202.0 47 191.5 48 175.5 49 174.0 50 158.5 51 146.0 52 137.5 53 128.0 54 119.5 55 108.5 56 104.0 57 96.0 58 86.5 59 82.0 60 74.0 61 70.0 62 75.5 63 72.5 64 65.5 65 50.0 66 48.5 67 47.5 68 40.0 69 37.5 70 32.0 71 21.5 72 15.5 73 14.5 74 14.0 75 10.0 76 4.0 77 4.0 78 3.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39531368102796 98.625 2 0.5291005291005291 1.05 3 0.0 0.0 4 0.05039052658100278 0.2 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.7 0.0 0.0 0.0 0.0 80-81 1.0125000000000002 0.0 0.0 0.0 0.0 82-83 1.35 0.0 0.0 0.0 0.0 84-85 1.625 0.0 0.0 0.0 0.0 86-87 2.05 0.0 0.0 0.0 0.0 88-89 2.575 0.0 0.0 0.0 0.0 90-91 3.0374999999999996 0.0 0.0 0.0 0.0 92-93 3.7750000000000004 0.0 0.0 0.0 0.0 94-95 4.3125 0.0 0.0 0.0 0.0 96-97 5.0 0.0 0.0 0.0 0.0 98-99 5.825 0.0 0.0 0.0 0.0 100-101 6.6875 0.0 0.0 0.0 0.0 102-103 7.4375 0.0 0.0 0.0 0.0 104-105 8.1375 0.0 0.0 0.0 0.0 106-107 9.1 0.0 0.0 0.0 0.0 108-109 10.1375 0.0 0.0 0.0 0.0 110-111 11.225 0.0 0.0 0.0 0.0 112-113 12.1375 0.0 0.0 0.0 0.0 114-115 13.162500000000001 0.0 0.0 0.0 0.0 116-117 14.3 0.0 0.0 0.0 0.0 118-119 15.4875 0.0 0.0 0.0 0.0 120-121 16.675 0.0 0.0 0.0 0.0 122-123 17.975 0.0 0.0 0.0 0.0 124-125 19.2 0.0 0.0 0.0 0.0 126-127 20.55 0.0 0.0 0.0 0.0 128-129 21.575 0.0 0.0 0.0 0.0 130-131 22.7125 0.0 0.0 0.0 0.0 132-133 23.6 0.0 0.0 0.0 0.0 134-135 24.7375 0.0 0.0 0.0 0.0 136-137 26.025 0.0 0.0 0.0 0.0 138-139 27.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAACT 10 0.006830828 145.0 3 >>END_MODULE Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098603 spots for SRR6941575.sra Written 1098603 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra Read 1098590 spots for SRR6941575.sra Written 1098590 spots for SRR6941575.sra SRR ids: ['SRR6941575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_23vbevfy SRR6941575.sra spots: 21971813 blocks: [[1, 1098590], [1098591, 2197180], [2197181, 3295770], [3295771, 4394360], [4394361, 5492950], [5492951, 6591540], [6591541, 7690130], [7690131, 8788720], [8788721, 9887310], [9887311, 10985900], [10985901, 12084490], [12084491, 13183080], [13183081, 14281670], [14281671, 15380260], [15380261, 16478850], [16478851, 17577440], [17577441, 18676030], [18676031, 19774620], [19774621, 20873210], [20873211, 21971813]] SRR6941575 file size 7423826 SRR6941575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941575 SRR6941575_1.fastq SRR6941575_2.fastq Input file: SRR6941575_1.fastq Paired file: SRR6941575_2.fastq trimmed: SRR6941575-trimmed-pair1.fastq, SRR6941575-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:52:03 2024 >> started Fri Dec 6 11:52:28 2024 >> done (25.176s) 21971813 read pairs processed; of these: 13160 ( 0.06%) short read pairs filtered out after trimming by size control 13492 ( 0.06%) empty read pairs filtered out after trimming by size control 21945161 (99.88%) read pairs available; of these: 13206386 (60.18%) trimmed read pairs available after processing 8738775 (39.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 13 0.00% 20 8 0.00% 21 11 0.00% 22 13 0.00% 23 20 0.00% 24 9 0.00% 25 22 0.00% 26 18 0.00% 27 13 0.00% 28 21 0.00% 29 18 0.00% 30 28 0.00% 31 30 0.00% 32 33 0.00% 33 39 0.00% 34 34 0.00% 35 52 0.00% 36 50 0.00% 37 69 0.00% 38 79 0.00% 39 84 0.00% 40 106 0.00% 41 130 0.00% 42 154 0.00% 43 139 0.00% 44 166 0.00% 45 176 0.00% 46 229 0.00% 47 257 0.00% 48 341 0.00% 49 377 0.00% 50 467 0.00% 51 539 0.00% 52 591 0.00% 53 751 0.00% 54 827 0.00% 55 823 0.00% 56 928 0.00% 57 1102 0.01% 58 1293 0.01% 59 1556 0.01% 60 1822 0.01% 61 2181 0.01% 62 2590 0.01% 63 2843 0.01% 64 3274 0.01% 65 3641 0.02% 66 4018 0.02% 67 4540 0.02% 68 5306 0.02% 69 5969 0.03% 70 7256 0.03% 71 8280 0.04% 72 9673 0.04% 73 11124 0.05% 74 12399 0.06% 75 13824 0.06% 76 15009 0.07% 77 16796 0.08% 78 18739 0.09% 79 20802 0.09% 80 23453 0.11% 81 26326 0.12% 82 29956 0.14% 83 33352 0.15% 84 37350 0.17% 85 40627 0.19% 86 43689 0.20% 87 46675 0.21% 88 50575 0.23% 89 53284 0.24% 90 57524 0.26% 91 62283 0.28% 92 65784 0.30% 93 70455 0.32% 94 75428 0.34% 95 79887 0.36% 96 82648 0.38% 97 85145 0.39% 98 87997 0.40% 99 89700 0.41% 100 94773 0.43% 101 96362 0.44% 102 101769 0.46% 103 105225 0.48% 104 107511 0.49% 105 110389 0.50% 106 113777 0.52% 107 114320 0.52% 108 115527 0.53% 109 117747 0.54% 110 119636 0.55% 111 120249 0.55% 112 124504 0.57% 113 128828 0.59% 114 130089 0.59% 115 132344 0.60% 116 134282 0.61% 117 133929 0.61% 118 134693 0.61% 119 132012 0.60% 120 133041 0.61% 121 133003 0.61% 122 133613 0.61% 123 136754 0.62% 124 138968 0.63% 125 140097 0.64% 126 140563 0.64% 127 140238 0.64% 128 139128 0.63% 129 139386 0.64% 130 139082 0.63% 131 139098 0.63% 132 141169 0.64% 133 143469 0.65% 134 143662 0.65% 135 146955 0.67% 136 148431 0.68% 137 149775 0.68% 138 149549 0.68% 139 152650 0.70% 140 155239 0.71% 141 159478 0.73% 142 167290 0.76% 143 173978 0.79% 144 188571 0.86% 145 207887 0.95% 146 235836 1.07% 147 290267 1.32% 148 398992 1.82% 149 728934 3.32% 150 3979470 18.13% 151 8738775 39.82% 21945161 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=30 prefix-density=0.40 prefix-fanout=2.6 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=68.44 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.27 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=116.47 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=20.6 sequence=CAAGAAGAAGGT SRR6941575 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:53:27 Started mapping on | Dec 06 11:53:27 Finished on | Dec 06 11:55:34 Mapping speed, Million of reads per hour | 622.07 Number of input reads | 21945161 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 20916944 Uniquely mapped reads % | 95.31% Average mapped length | 278.97 Number of splices: Total | 20643954 Number of splices: Annotated (sjdb) | 19299300 Number of splices: GT/AG | 20362337 Number of splices: GC/AG | 251258 Number of splices: AT/AC | 11416 Number of splices: Non-canonical | 18943 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228770 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 30393 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 808128 808128 808128 N_multimapping 228770 228770 228770 N_noFeature 924490 20265005 1157690 N_ambiguous 489803 2646 70941 UnstrandedReadsAssigned:19502651 PositiveStrandReadsAssigned:649293 NegativeStrandReadsAssigned:19688313 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=125 echo kmer=121 SRR6941575 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941575-trimmed-pair1.fastq SRR6941575-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,945,161 reads, 19,803,146 reads pseudoaligned [quant] estimated average fragment length: 205.119 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6941575.ke.tsv 35125 SRR6941575.se.tsv 88098 total ==> SRR6941575.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.193 0 0 PNS24247 1044 839.881 92.902 8.51828 PNS24249 1928 1723.88 88.4507 3.95129 PNS24246 1044 839.881 92.902 8.51828 PNS24248 1044 839.881 92.902 8.51828 PNS24244 1471 1266.88 59.8434 3.63769 PNS24243 293 126.315 0 0 KQK14069 1603 1398.88 14973.1 824.281 KQK14071 474 282.303 520.734 142.051 ==> SRR6941575.se.tsv <== BRADI_1g14170v3 17971 BRADI_1g53295v3 263 BRADI_1g59795v3 990 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 328 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 476 BRADI_1g48960v3 0 SRR6941575 completed mapping pipeline successfully