Starting /dee2/code/volunteer_pipeline.sh SRR6941587 current disk space = 1551444848640 free memory = 1604032824 SRR6941587 SRAfilesize e36a24acf70c2a0dd266ca88e55af61f SRR6941587.sra SRR6941587.sra file validated SRR6941587 is paired end SRR6941587 is conventional basespace SRR6941587 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941587_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.93275 33.0 33.0 34.0 31.0 34.0 2 32.70575 33.0 33.0 34.0 31.0 34.0 3 32.97175 34.0 33.0 34.0 32.0 34.0 4 33.046 34.0 33.0 34.0 32.0 34.0 5 33.17075 34.0 33.0 34.0 32.0 34.0 6 36.9605 38.0 37.0 38.0 35.0 38.0 7 37.29275 38.0 38.0 38.0 36.0 38.0 8 37.37475 38.0 38.0 38.0 37.0 38.0 9 37.356 38.0 38.0 38.0 37.0 38.0 10-14 37.39735 38.0 38.0 38.0 37.0 38.0 15-19 37.4092 38.0 38.0 38.0 37.0 38.0 20-24 37.383250000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.2342 38.0 38.0 38.0 37.0 38.0 30-34 37.2747 38.0 38.0 38.0 36.8 38.0 35-39 37.26495 38.0 38.0 38.0 37.0 38.0 40-44 37.307249999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.381099999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.28275 38.0 38.0 38.0 37.0 38.0 55-59 37.236000000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.14045 38.0 38.0 38.0 36.2 38.0 65-69 36.96555 38.0 38.0 38.0 35.6 38.0 70-74 37.01545 38.0 38.0 38.0 35.8 38.0 75-79 37.0912 38.0 38.0 38.0 36.0 38.0 80-84 36.9904 38.0 38.0 38.0 35.6 38.0 85-89 36.793150000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.7996 38.0 38.0 38.0 35.0 38.0 95-99 36.828700000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.6383 38.0 38.0 38.0 34.2 38.0 105-109 36.21470000000001 38.0 37.8 38.0 33.2 38.0 110-114 36.2025 38.0 37.8 38.0 33.8 38.0 115-119 36.15259999999999 38.0 37.8 38.0 33.2 38.0 120-124 36.18805 38.0 37.8 38.0 33.4 38.0 125-129 36.125800000000005 38.0 37.6 38.0 33.2 38.0 130-134 36.029700000000005 38.0 37.0 38.0 33.0 38.0 135-139 35.84175 38.0 36.2 38.0 32.6 38.0 140-144 35.51305 38.0 36.0 38.0 31.0 38.0 145-149 34.9461 38.0 35.4 38.0 30.0 38.0 150-151 31.189125 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 2.0 19 3.0 20 1.0 21 2.0 22 1.0 23 1.0 24 7.0 25 16.0 26 8.0 27 18.0 28 18.0 29 36.0 30 43.0 31 58.0 32 85.0 33 101.0 34 131.0 35 210.0 36 504.0 37 2750.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.34760317867214 9.202768520892079 8.433734939759036 38.01589336067675 2 22.275 11.95 36.0 29.775000000000002 3 21.25 15.5 23.875 39.375 4 28.225 21.825 21.275 28.675 5 27.175 28.349999999999998 22.7 21.775 6 24.099999999999998 32.375 21.525 22.0 7 19.1 24.349999999999998 36.925000000000004 19.625 8 19.950000000000003 23.775 29.525000000000002 26.75 9 20.225 22.6 32.75 24.425 10-14 23.43 26.479999999999997 25.069999999999997 25.019999999999996 15-19 23.211160558027903 24.71623581179059 26.256312815640783 25.816290814540725 20-24 23.62 25.230000000000004 25.5 25.650000000000002 25-29 23.461173058652932 25.746287314365716 25.28626431321566 25.506275313765688 30-34 23.561178058902946 24.681234061703087 25.636281814090705 26.121306065303262 35-39 23.476173808690433 25.401270063503173 25.326266313315664 25.796289814490724 40-44 23.592359235923592 25.17751775177518 25.272527252725276 25.95759575957596 45-49 23.400000000000002 24.62 25.575 26.405 50-54 23.755000000000003 24.495 25.995 25.755 55-59 23.645 25.3 25.145 25.91 60-64 23.445 25.085 25.074999999999996 26.395000000000003 65-69 24.0 24.905 25.64 25.455 70-74 23.652365236523654 24.49244924492449 25.60756075607561 26.247624762476246 75-79 23.535 25.180000000000003 25.380000000000003 25.905 80-84 23.576178808940448 25.301265063253165 25.526276313815693 25.5962798139907 85-89 23.84119205960298 24.91624581229061 25.781289064453222 25.461273063653184 90-94 23.445 24.385 25.95 26.22 95-99 24.19 24.785 25.465 25.56 100-104 23.702110633189957 25.592677803341 24.86245873762129 25.842752825847754 105-109 24.115000000000002 24.755 25.16 25.97 110-114 23.92459641030783 25.21307530331896 25.553995788629297 25.30833249774391 115-119 23.981583425082576 25.04253828445601 24.852367130417374 26.12351116004404 120-124 24.275924165874642 25.546495923165423 24.466009704366964 25.711570206592967 125-129 23.7 25.174999999999997 24.5 26.625 130-134 24.125 25.1 24.515 26.26 135-139 23.575 25.019999999999996 25.6 25.805 140-144 24.135 25.365 24.87 25.629999999999995 145-149 23.5 25.040000000000003 25.005 26.455000000000002 150-151 23.4875 25.525 24.275 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.0 26 1.0 27 3.0 28 4.0 29 6.0 30 10.5 31 12.5 32 16.5 33 20.5 34 20.5 35 28.5 36 35.0 37 50.0 38 82.5 39 103.0 40 120.5 41 120.0 42 145.5 43 191.5 44 198.0 45 191.0 46 186.5 47 191.5 48 188.0 49 168.0 50 168.5 51 168.0 52 148.0 53 134.5 54 117.5 55 103.5 56 109.0 57 99.0 58 83.0 59 79.0 60 77.0 61 73.5 62 71.5 63 67.5 64 55.0 65 62.0 66 54.5 67 42.0 68 39.0 69 30.5 70 23.0 71 21.5 72 19.5 73 18.0 74 16.5 75 8.0 76 3.5 77 4.0 78 3.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.005 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.27 115-119 0.09 120-124 0.045 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11638475132543 98.15 2 0.7826306488260539 1.55 3 0.10098459984852311 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.6875 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.3875 0.0 0.0 0.0 0.0 118-119 4.9625 0.0 0.0 0.0 0.0 120-121 5.574999999999999 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.6125 0.0 0.0 0.0 0.0 126-127 7.1875 0.0 0.0 0.0 0.0 128-129 7.7625 0.0 0.0 0.0 0.0 130-131 8.4875 0.0 0.0 0.0 0.0 132-133 9.087499999999999 0.0 0.0 0.0 0.0 134-135 9.7625 0.0 0.0 0.0 0.0 136-137 10.45 0.0 0.0 0.0 0.0 138-139 11.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6941587 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941587_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80425 33.0 33.0 34.0 32.0 34.0 2 33.0125 34.0 33.0 34.0 32.0 34.0 3 33.03175 34.0 33.0 34.0 32.0 34.0 4 32.972 34.0 33.0 34.0 32.0 34.0 5 32.99875 34.0 33.0 34.0 32.0 34.0 6 37.08725 38.0 38.0 38.0 36.0 38.0 7 37.13875 38.0 38.0 38.0 37.0 38.0 8 37.15975 38.0 38.0 38.0 37.0 38.0 9 37.08625 38.0 38.0 38.0 36.0 38.0 10-14 37.0824 38.0 38.0 38.0 36.6 38.0 15-19 37.025099999999995 38.0 38.0 38.0 36.2 38.0 20-24 37.036500000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.985749999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.962349999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.9033 38.0 38.0 38.0 36.0 38.0 40-44 36.97915 38.0 38.0 38.0 36.0 38.0 45-49 36.95295 38.0 38.0 38.0 36.0 38.0 50-54 36.903999999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.77329999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.816649999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.5843 38.0 38.0 38.0 35.0 38.0 70-74 36.698699999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.58195 38.0 38.0 38.0 34.6 38.0 80-84 36.499649999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.55925 38.0 38.0 38.0 34.4 38.0 90-94 36.44985 38.0 38.0 38.0 34.0 38.0 95-99 36.194950000000006 38.0 38.0 38.0 33.6 38.0 100-104 36.08085 38.0 38.0 38.0 33.4 38.0 105-109 35.73695 38.0 37.2 38.0 31.6 38.0 110-114 35.15875 38.0 36.0 38.0 28.0 38.0 115-119 35.1783 38.0 36.0 38.0 28.4 38.0 120-124 35.0466 38.0 35.8 38.0 27.8 38.0 125-129 35.0762 38.0 35.6 38.0 28.8 38.0 130-134 35.096500000000006 38.0 35.8 38.0 28.6 38.0 135-139 34.579899999999995 38.0 34.6 38.0 27.8 38.0 140-144 34.11125 38.0 33.2 38.0 25.2 38.0 145-149 32.9577 38.0 33.0 38.0 16.2 38.0 150-151 27.005625000000002 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 1.0 5 1.0 6 0.0 7 0.0 8 2.0 9 1.0 10 3.0 11 1.0 12 1.0 13 0.0 14 1.0 15 4.0 16 4.0 17 0.0 18 7.0 19 7.0 20 4.0 21 4.0 22 6.0 23 10.0 24 13.0 25 17.0 26 23.0 27 23.0 28 40.0 29 49.0 30 64.0 31 77.0 32 86.0 33 108.0 34 188.0 35 278.0 36 619.0 37 2349.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.675 18.3 11.25 32.775 2 29.099999999999998 24.099999999999998 26.775 20.025000000000002 3 22.8 24.85 26.700000000000003 25.650000000000002 4 26.650000000000002 29.925 20.25 23.175 5 28.499999999999996 33.525 19.35 18.625 6 23.905976494123532 34.2335583895974 21.405351337834457 20.455113778444613 7 22.85 19.675 34.725 22.75 8 23.200000000000003 23.0 25.2 28.599999999999998 9 23.525 21.125 29.125 26.224999999999998 10-14 25.545 25.814999999999998 23.705000000000002 24.935 15-19 25.290000000000003 25.31 24.715 24.685000000000002 20-24 26.369999999999997 25.45 24.16 24.02 25-29 25.590000000000003 25.590000000000003 24.2 24.62 30-34 25.629999999999995 25.735000000000003 24.529999999999998 24.104999999999997 35-39 25.45 25.365 24.87 24.315 40-44 26.490000000000002 25.045 24.404999999999998 24.060000000000002 45-49 25.509999999999998 25.165 24.515 24.81 50-54 26.375 25.2 24.55 23.875 55-59 26.369999999999997 24.775 24.169999999999998 24.685000000000002 60-64 25.91 25.15 24.665 24.275 65-69 26.284999999999997 25.145 24.445 24.125 70-74 26.415 24.855 24.7 24.03 75-79 25.81 24.625 25.0 24.565 80-84 26.062606260626065 25.327532753275328 24.197419741974198 24.412441244124413 85-89 26.431321566078303 25.336266813340668 24.196209810490522 24.036201810090503 90-94 26.4026402640264 25.412541254125415 24.57245724572457 23.612361236123615 95-99 26.27762776277628 25.192519251925194 24.56245624562456 23.96739673967397 100-104 26.11 25.319999999999997 24.455 24.115000000000002 105-109 26.009999999999998 25.755 24.4 23.835 110-114 26.52 25.985000000000003 24.349999999999998 23.145 115-119 27.365000000000002 25.564999999999998 23.91 23.16 120-124 26.715 25.985000000000003 24.04 23.26 125-129 26.85 26.46 23.93 22.759999999999998 130-134 27.556377818890944 25.136256812840642 24.291214560728037 23.016150807540377 135-139 27.416370818540926 25.99129956497825 23.896194809740486 22.696134806740336 140-144 27.330466093218643 26.100220044008804 24.14482896579316 22.424484896979397 145-149 27.89057811562313 26.305261052210444 24.259851970394077 21.544308861772354 150-151 27.803475434429302 25.99074884360545 24.353044130516317 21.852731591448933 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.0 25 1.0 26 1.5 27 1.0 28 1.5 29 5.5 30 8.5 31 9.5 32 13.5 33 13.0 34 17.0 35 32.5 36 40.5 37 57.5 38 78.5 39 90.5 40 118.5 41 126.0 42 136.0 43 163.5 44 172.5 45 179.0 46 181.5 47 188.5 48 187.5 49 182.5 50 172.5 51 155.0 52 144.0 53 120.5 54 104.0 55 114.0 56 113.0 57 97.5 58 84.5 59 80.5 60 85.5 61 83.5 62 73.0 63 69.0 64 75.0 65 69.5 66 56.0 67 52.5 68 47.0 69 41.5 70 35.5 71 28.5 72 26.0 73 19.0 74 17.0 75 11.5 76 5.0 77 3.5 78 1.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.005 90-94 0.01 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.02 145-149 0.02 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93428063943162 97.475 2 0.7612281146917027 1.5 3 0.2283684344075108 0.675 4 0.050748540979446845 0.2 5 0.0 0.0 6 0.025374270489723422 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 1.9749999999999999 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.6625 0.0 0.0 0.0 0.0 110-111 2.9749999999999996 0.0 0.0 0.0 0.0 112-113 3.425 0.0 0.0 0.0 0.0 114-115 3.85 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.449999999999999 0.0 0.0 0.0 0.0 122-123 5.9 0.0 0.0 0.0 0.0 124-125 6.4625 0.0 0.0 0.0 0.0 126-127 7.0375 0.0 0.0 0.0 0.0 128-129 7.6375 0.0 0.0 0.0 0.0 130-131 8.3625 0.0 0.0 0.0 0.0 132-133 8.975 0.0 0.0 0.0 0.0 134-135 9.625 0.0 0.0 0.0 0.0 136-137 10.3125 0.0 0.0 0.0 0.0 138-139 11.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 40-44 >>END_MODULE Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248689 spots for SRR6941587.sra Written 1248689 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra Read 1248675 spots for SRR6941587.sra Written 1248675 spots for SRR6941587.sra SRR ids: ['SRR6941587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zyhfgc9o SRR6941587.sra spots: 24973514 blocks: [[1, 1248675], [1248676, 2497350], [2497351, 3746025], [3746026, 4994700], [4994701, 6243375], [6243376, 7492050], [7492051, 8740725], [8740726, 9989400], [9989401, 11238075], [11238076, 12486750], [12486751, 13735425], [13735426, 14984100], [14984101, 16232775], [16232776, 17481450], [17481451, 18730125], [18730126, 19978800], [19978801, 21227475], [21227476, 22476150], [22476151, 23724825], [23724826, 24973514]] SRR6941587 file size 8441004 SRR6941587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941587 SRR6941587_1.fastq SRR6941587_2.fastq Input file: SRR6941587_1.fastq Paired file: SRR6941587_2.fastq trimmed: SRR6941587-trimmed-pair1.fastq, SRR6941587-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:16:53 2024 >> started Fri Dec 6 12:17:20 2024 >> done (26.823s) 24973514 read pairs processed; of these: 14712 ( 0.06%) short read pairs filtered out after trimming by size control 12746 ( 0.05%) empty read pairs filtered out after trimming by size control 24946056 (99.89%) read pairs available; of these: 13134146 (52.65%) trimmed read pairs available after processing 11811910 (47.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 14 0.00% 20 20 0.00% 21 11 0.00% 22 13 0.00% 23 8 0.00% 24 7 0.00% 25 14 0.00% 26 9 0.00% 27 6 0.00% 28 11 0.00% 29 21 0.00% 30 11 0.00% 31 13 0.00% 32 18 0.00% 33 28 0.00% 34 21 0.00% 35 23 0.00% 36 24 0.00% 37 29 0.00% 38 30 0.00% 39 37 0.00% 40 51 0.00% 41 46 0.00% 42 61 0.00% 43 57 0.00% 44 60 0.00% 45 66 0.00% 46 104 0.00% 47 100 0.00% 48 126 0.00% 49 131 0.00% 50 186 0.00% 51 207 0.00% 52 222 0.00% 53 230 0.00% 54 296 0.00% 55 297 0.00% 56 349 0.00% 57 411 0.00% 58 469 0.00% 59 536 0.00% 60 650 0.00% 61 781 0.00% 62 848 0.00% 63 956 0.00% 64 1139 0.00% 65 1272 0.01% 66 1402 0.01% 67 1573 0.01% 68 1892 0.01% 69 2162 0.01% 70 2475 0.01% 71 2751 0.01% 72 3262 0.01% 73 3681 0.01% 74 4097 0.02% 75 4571 0.02% 76 5162 0.02% 77 5731 0.02% 78 6501 0.03% 79 7050 0.03% 80 8075 0.03% 81 9025 0.04% 82 9995 0.04% 83 11497 0.05% 84 13160 0.05% 85 15145 0.06% 86 15970 0.06% 87 17328 0.07% 88 18811 0.08% 89 19999 0.08% 90 21174 0.08% 91 22690 0.09% 92 24407 0.10% 93 26292 0.11% 94 28463 0.11% 95 30553 0.12% 96 32238 0.13% 97 33932 0.14% 98 35173 0.14% 99 36586 0.15% 100 39403 0.16% 101 40423 0.16% 102 42434 0.17% 103 45043 0.18% 104 46852 0.19% 105 48928 0.20% 106 50988 0.20% 107 52109 0.21% 108 54090 0.22% 109 56114 0.22% 110 58679 0.24% 111 59774 0.24% 112 61681 0.25% 113 63584 0.25% 114 65800 0.26% 115 69326 0.28% 116 70494 0.28% 117 72492 0.29% 118 74562 0.30% 119 75363 0.30% 120 77354 0.31% 121 78117 0.31% 122 79557 0.32% 123 83252 0.33% 124 85700 0.34% 125 88225 0.35% 126 89878 0.36% 127 92785 0.37% 128 94317 0.38% 129 97776 0.39% 130 100345 0.40% 131 101766 0.41% 132 105701 0.42% 133 110140 0.44% 134 113372 0.45% 135 118466 0.47% 136 123303 0.49% 137 128143 0.51% 138 133934 0.54% 139 144871 0.58% 140 152025 0.61% 141 162312 0.65% 142 178199 0.71% 143 197154 0.79% 144 226914 0.91% 145 261957 1.05% 146 319437 1.28% 147 415222 1.66% 148 598180 2.40% 149 1146733 4.60% 150 5788022 23.20% 151 11811910 47.35% 24946056 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=16 prefix-density=0.73 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=105.64 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.7 sequence=TGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCATCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGCTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=62.20 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=11.8 sequence=GCCGCCGCCGCC SRR6941587 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:18:04 Started mapping on | Dec 06 12:18:04 Finished on | Dec 06 12:21:22 Mapping speed, Million of reads per hour | 453.56 Number of input reads | 24946056 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 23726494 Uniquely mapped reads % | 95.11% Average mapped length | 289.97 Number of splices: Total | 25793424 Number of splices: Annotated (sjdb) | 24249016 Number of splices: GT/AG | 25420587 Number of splices: GC/AG | 291868 Number of splices: AT/AC | 10389 Number of splices: Non-canonical | 70580 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.03% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385595 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 32603 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 844164 844164 844164 N_multimapping 385595 385595 385595 N_noFeature 883673 22940432 1120354 N_ambiguous 641642 3652 92559 UnstrandedReadsAssigned:22201179 PositiveStrandReadsAssigned:782410 NegativeStrandReadsAssigned:22513581 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6941587 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941587-trimmed-pair1.fastq SRR6941587-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,946,056 reads, 22,534,523 reads pseudoaligned [quant] estimated average fragment length: 244.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52973 SRR6941587.ke.tsv 35125 SRR6941587.se.tsv 88098 total ==> SRR6941587.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.588 0 0 PNS24247 1044 800.928 77.8687 6.40557 PNS24249 1928 1684.93 64.1746 2.5094 PNS24246 1044 800.928 77.8687 6.40557 PNS24248 1044 800.928 77.8687 6.40557 PNS24244 1471 1227.93 66.2192 3.55304 PNS24243 293 102.135 0 0 KQK14069 1603 1359.93 5386.15 260.946 KQK14071 474 247.335 107.717 28.6937 ==> SRR6941587.se.tsv <== BRADI_1g14170v3 6134 BRADI_1g53295v3 843 BRADI_1g59795v3 191 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 506 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 331 BRADI_1g48960v3 0 SRR6941587 completed mapping pipeline successfully