Starting /dee2/code/volunteer_pipeline.sh SRR6941588 current disk space = 1551481970688 free memory = 1604029720 SRR6941588 SRAfilesize 6c39cf83f2d7a5713893b70ea90af5b3 SRR6941588.sra SRR6941588.sra file validated SRR6941588 is paired end SRR6941588 is conventional basespace SRR6941588 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941588_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.705 34.0 33.0 34.0 32.0 34.0 2 33.09425 34.0 33.0 34.0 32.0 34.0 3 33.21425 34.0 33.0 34.0 32.0 34.0 4 33.328 34.0 33.0 34.0 33.0 34.0 5 33.365 34.0 33.0 34.0 33.0 34.0 6 37.11425 38.0 38.0 38.0 36.0 38.0 7 37.4425 38.0 38.0 38.0 37.0 38.0 8 37.55625 38.0 38.0 38.0 38.0 38.0 9 37.60475 38.0 38.0 38.0 38.0 38.0 10-14 37.544850000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.53915 38.0 38.0 38.0 38.0 38.0 20-24 37.557249999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5363 38.0 38.0 38.0 38.0 38.0 30-34 37.49125 38.0 38.0 38.0 38.0 38.0 35-39 37.527300000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.5217 38.0 38.0 38.0 38.0 38.0 45-49 37.49855 38.0 38.0 38.0 37.8 38.0 50-54 37.3813 38.0 38.0 38.0 37.2 38.0 55-59 37.3747 38.0 38.0 38.0 37.0 38.0 60-64 37.3629 38.0 38.0 38.0 37.0 38.0 65-69 37.29625 38.0 38.0 38.0 37.0 38.0 70-74 37.1858 38.0 38.0 38.0 36.4 38.0 75-79 37.26035 38.0 38.0 38.0 37.0 38.0 80-84 37.16895 38.0 38.0 38.0 36.4 38.0 85-89 37.0911 38.0 38.0 38.0 36.0 38.0 90-94 37.122949999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.943799999999996 38.0 38.0 38.0 35.6 38.0 100-104 37.0061 38.0 38.0 38.0 35.6 38.0 105-109 36.899350000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.646950000000004 38.0 38.0 38.0 34.6 38.0 115-119 36.402649999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.5496 38.0 38.0 38.0 34.0 38.0 125-129 36.49695 38.0 38.0 38.0 34.0 38.0 130-134 36.34895 38.0 38.0 38.0 33.8 38.0 135-139 36.03605 38.0 37.0 38.0 33.0 38.0 140-144 35.887800000000006 38.0 36.0 38.0 33.0 38.0 145-149 35.1986 38.0 35.8 38.0 31.0 38.0 150-151 31.305125 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 2.0 18 3.0 19 0.0 20 1.0 21 1.0 22 2.0 23 3.0 24 7.0 25 6.0 26 10.0 27 12.0 28 21.0 29 17.0 30 39.0 31 35.0 32 40.0 33 73.0 34 102.0 35 192.0 36 501.0 37 2931.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.77777777777778 11.190476190476192 6.031746031746032 35.0 2 22.400000000000002 12.950000000000001 35.925000000000004 28.725 3 18.425 18.8 26.825 35.949999999999996 4 26.05 23.775 23.599999999999998 26.575 5 25.35 29.775000000000002 23.775 21.099999999999998 6 23.474999999999998 31.75 23.849999999999998 20.925 7 18.25 23.75 37.375 20.625 8 20.275000000000002 23.225 29.299999999999997 27.200000000000003 9 19.425 21.775 32.5 26.3 10-14 22.939999999999998 26.555 25.665 24.84 15-19 22.88 24.965 26.174999999999997 25.979999999999997 20-24 23.13 25.695 26.19 24.985 25-29 23.544999999999998 25.525 25.95 24.98 30-34 22.915 25.080000000000002 25.945 26.06 35-39 23.395 25.035 26.095000000000002 25.474999999999998 40-44 23.305 25.64 25.905 25.15 45-49 22.785 25.679999999999996 25.759999999999998 25.775 50-54 22.994999999999997 25.380000000000003 25.929999999999996 25.695 55-59 23.335 25.745 25.924999999999997 24.995 60-64 23.025000000000002 25.0 26.025 25.95 65-69 23.69 24.825 25.755 25.729999999999997 70-74 23.38350752612892 25.2737910686603 25.588838325748863 25.75386307946192 75-79 23.392017605281584 25.292587776332898 25.862758827648296 25.452635790737222 80-84 23.544999999999998 25.575 25.415 25.465 85-89 23.775 25.169999999999998 25.169999999999998 25.885 90-94 23.59 24.84 25.564999999999998 26.005 95-99 23.775 24.585 25.655 25.985000000000003 100-104 23.155 25.435000000000002 25.935000000000002 25.474999999999998 105-109 23.73 25.53 25.369999999999997 25.369999999999997 110-114 23.717274866096012 25.619462381738998 25.544376032437306 25.118886719727683 115-119 23.431549408699137 25.982160753658047 25.536179595109243 25.050110242533574 120-124 23.915 25.115 24.95 26.02 125-129 23.674999999999997 25.095 25.545 25.685000000000002 130-134 23.119999999999997 25.615 25.44 25.825 135-139 23.46 25.6 24.855 26.085 140-144 23.61 25.335 25.014999999999997 26.040000000000003 145-149 24.07 25.564999999999998 24.805 25.56 150-151 24.3 25.2875 24.337500000000002 26.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 3.5 26 3.5 27 1.5 28 2.5 29 3.5 30 7.0 31 11.0 32 14.5 33 20.5 34 27.0 35 39.5 36 50.0 37 59.5 38 77.0 39 93.0 40 122.0 41 148.0 42 174.0 43 187.5 44 202.5 45 203.0 46 201.0 47 208.0 48 198.0 49 181.0 50 168.5 51 169.0 52 139.0 53 118.5 54 108.0 55 90.5 56 94.5 57 89.5 58 70.0 59 76.5 60 84.0 61 76.5 62 67.5 63 57.0 64 58.0 65 52.0 66 43.0 67 40.0 68 39.0 69 37.0 70 26.5 71 18.5 72 11.5 73 8.5 74 7.5 75 5.5 76 2.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.03 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.11499999999999999 115-119 0.22 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.2000000000000002 0.0 0.0 0.0 0.0 96-97 1.3625 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.925 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.4125 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 3.0875 0.0 0.0 0.0 0.0 110-111 3.525 0.0 0.0 0.0 0.0 112-113 3.9625 0.0 0.0 0.0 0.0 114-115 4.325 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 5.175000000000001 0.0 0.0 0.0 0.0 120-121 5.725 0.0 0.0 0.0 0.0 122-123 6.125 0.0 0.0 0.0 0.0 124-125 6.525 0.0 0.0 0.0 0.0 126-127 6.9375 0.0 0.0 0.0 0.0 128-129 7.387499999999999 0.0 0.0 0.0 0.0 130-131 8.037500000000001 0.0 0.0 0.0 0.0 132-133 8.65 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 9.875 0.0 0.0 0.0 0.0 138-139 10.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAATT 10 0.0068378756 144.95 2 >>END_MODULE SRR6941588 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941588_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0715 33.0 33.0 34.0 32.0 34.0 2 33.105 34.0 33.0 34.0 33.0 34.0 3 33.235 34.0 33.0 34.0 33.0 34.0 4 33.1185 34.0 33.0 34.0 33.0 34.0 5 33.12225 34.0 33.0 34.0 33.0 34.0 6 37.19025 38.0 38.0 38.0 37.0 38.0 7 37.3155 38.0 38.0 38.0 37.0 38.0 8 37.28725 38.0 38.0 38.0 37.0 38.0 9 37.2795 38.0 38.0 38.0 37.0 38.0 10-14 37.2875 38.0 38.0 38.0 37.4 38.0 15-19 37.249900000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.2134 38.0 38.0 38.0 37.0 38.0 25-29 37.11395 38.0 38.0 38.0 36.8 38.0 30-34 37.11030000000001 38.0 38.0 38.0 36.8 38.0 35-39 37.06225 38.0 38.0 38.0 36.8 38.0 40-44 37.103950000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.1077 38.0 38.0 38.0 37.0 38.0 50-54 37.0442 38.0 38.0 38.0 36.6 38.0 55-59 36.96724999999999 38.0 38.0 38.0 36.2 38.0 60-64 36.98305 38.0 38.0 38.0 36.2 38.0 65-69 36.91844999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.8331 38.0 38.0 38.0 36.0 38.0 75-79 36.75985000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.667350000000006 38.0 38.0 38.0 35.2 38.0 85-89 36.6872 38.0 38.0 38.0 35.0 38.0 90-94 36.6285 38.0 38.0 38.0 35.0 38.0 95-99 36.511649999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.3972 38.0 38.0 38.0 34.0 38.0 105-109 36.18 38.0 38.0 38.0 34.0 38.0 110-114 35.789 38.0 37.8 38.0 32.4 38.0 115-119 35.3753 38.0 36.8 38.0 30.2 38.0 120-124 35.4414 38.0 36.4 38.0 30.2 38.0 125-129 35.6503 38.0 36.6 38.0 32.6 38.0 130-134 35.31945 38.0 36.0 38.0 31.0 38.0 135-139 35.04065000000001 38.0 36.0 38.0 30.6 38.0 140-144 34.5971 38.0 35.4 38.0 28.0 38.0 145-149 33.6169 38.0 33.6 38.0 22.2 38.0 150-151 27.961375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 3.0 5 1.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 4.0 14 3.0 15 1.0 16 2.0 17 2.0 18 2.0 19 4.0 20 6.0 21 5.0 22 9.0 23 5.0 24 5.0 25 14.0 26 11.0 27 29.0 28 28.0 29 33.0 30 35.0 31 55.0 32 70.0 33 112.0 34 122.0 35 251.0 36 553.0 37 2615.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.25 20.175 8.025 27.55 2 27.6 25.124999999999996 27.474999999999998 19.8 3 22.425 25.35 28.125 24.099999999999998 4 25.4 30.349999999999998 20.7 23.549999999999997 5 25.7 32.95 21.075 20.275000000000002 6 24.375 35.099999999999994 19.775000000000002 20.75 7 21.2 20.974999999999998 34.075 23.75 8 23.275000000000002 24.4 25.05 27.275 9 23.849999999999998 23.05 27.6 25.5 10-14 26.08 25.874999999999996 23.57 24.474999999999998 15-19 26.11 25.045 24.925 23.919999999999998 20-24 25.374999999999996 25.965 24.22 24.44 25-29 25.545 25.580000000000002 24.310000000000002 24.565 30-34 25.180000000000003 26.179999999999996 24.34 24.3 35-39 25.759999999999998 25.490000000000002 24.455 24.295 40-44 26.13 25.915 24.065 23.89 45-49 26.365 25.790000000000003 24.32 23.525 50-54 25.795 25.995 24.490000000000002 23.72 55-59 26.435 25.47 24.41 23.685000000000002 60-64 26.205000000000002 25.105 24.425 24.265 65-69 25.929999999999996 25.590000000000003 24.990000000000002 23.49 70-74 25.869999999999997 25.455 24.75 23.925 75-79 25.895000000000003 25.985000000000003 24.645 23.474999999999998 80-84 26.085 26.125 24.04 23.75 85-89 25.974999999999998 25.88 24.825 23.32 90-94 25.705 25.785000000000004 24.515 23.995 95-99 25.595000000000002 25.6 24.834999999999997 23.97 100-104 26.305 25.335 24.834999999999997 23.525 105-109 26.169999999999998 26.035000000000004 24.310000000000002 23.485 110-114 26.419999999999998 25.669999999999998 24.43 23.48 115-119 26.705000000000002 25.915 23.995 23.385 120-124 26.39 25.990000000000002 24.38 23.24 125-129 26.355 26.405 24.37 22.869999999999997 130-134 27.015 25.81 24.33 22.845 135-139 26.935 26.575 24.745 21.745 140-144 27.224999999999998 26.22 24.95 21.605 145-149 27.310000000000002 25.924999999999997 24.55 22.215 150-151 28.4375 26.487500000000004 24.0125 21.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 3.0 27 5.0 28 4.5 29 5.0 30 9.0 31 14.0 32 11.5 33 12.5 34 20.0 35 32.0 36 47.5 37 57.0 38 75.0 39 92.0 40 117.5 41 134.5 42 149.5 43 189.0 44 182.0 45 183.0 46 203.0 47 192.0 48 173.5 49 172.0 50 174.5 51 153.0 52 137.5 53 121.5 54 108.0 55 102.5 56 97.5 57 87.5 58 92.5 59 97.0 60 84.5 61 77.5 62 68.5 63 70.0 64 73.0 65 67.0 66 58.5 67 50.0 68 47.0 69 42.5 70 31.5 71 25.0 72 15.5 73 11.5 74 12.0 75 4.0 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7068921989396617 1.4000000000000001 3 0.10098459984852311 0.3 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.075 0.0 0.0 0.0 0.025 76-77 0.075 0.0 0.0 0.0 0.025 78-79 0.125 0.0 0.0 0.0 0.025 80-81 0.175 0.0 0.0 0.0 0.025 82-83 0.2625 0.0 0.0 0.0 0.025 84-85 0.38749999999999996 0.0 0.0 0.0 0.025 86-87 0.4625 0.0 0.0 0.0 0.025 88-89 0.6125 0.0 0.0 0.0 0.025 90-91 0.7375 0.0 0.0 0.0 0.025 92-93 0.9750000000000001 0.0 0.0 0.0 0.025 94-95 1.225 0.0 0.0 0.0 0.025 96-97 1.4 0.0 0.0 0.0 0.025 98-99 1.6875 0.0 0.0 0.0 0.025 100-101 1.9625 0.0 0.0 0.0 0.025 102-103 2.1500000000000004 0.0 0.0 0.0 0.025 104-105 2.4625 0.0 0.0 0.0 0.025 106-107 2.75 0.0 0.0 0.0 0.025 108-109 3.1375 0.0 0.0 0.0 0.025 110-111 3.575 0.0 0.0 0.0 0.025 112-113 4.025 0.0 0.0 0.0 0.025 114-115 4.35 0.0 0.0 0.0 0.025 116-117 4.762499999999999 0.0 0.0 0.0 0.025 118-119 5.2125 0.0 0.0 0.0 0.025 120-121 5.737500000000001 0.0 0.0 0.0 0.025 122-123 6.15 0.0 0.0 0.0 0.025 124-125 6.55 0.0 0.0 0.0 0.025 126-127 6.987500000000001 0.0 0.0 0.0 0.025 128-129 7.425000000000001 0.0 0.0 0.0 0.025 130-131 8.125 0.0 0.0 0.0 0.025 132-133 8.725 0.0 0.0 0.0 0.025 134-135 9.35 0.0 0.0 0.0 0.025 136-137 9.9 0.0 0.0 0.0 0.025 138-139 10.4875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra Read 1276954 spots for SRR6941588.sra Written 1276954 spots for SRR6941588.sra SRR ids: ['SRR6941588.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y6_gbz03 SRR6941588.sra spots: 25539080 blocks: [[1, 1276954], [1276955, 2553908], [2553909, 3830862], [3830863, 5107816], [5107817, 6384770], [6384771, 7661724], [7661725, 8938678], [8938679, 10215632], [10215633, 11492586], [11492587, 12769540], [12769541, 14046494], [14046495, 15323448], [15323449, 16600402], [16600403, 17877356], [17877357, 19154310], [19154311, 20431264], [20431265, 21708218], [21708219, 22985172], [22985173, 24262126], [24262127, 25539080]] SRR6941588 file size 8632655 SRR6941588 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941588 SRR6941588_1.fastq SRR6941588_2.fastq Input file: SRR6941588_1.fastq Paired file: SRR6941588_2.fastq trimmed: SRR6941588-trimmed-pair1.fastq, SRR6941588-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:20:05 2024 >> started Fri Dec 6 12:20:33 2024 >> done (28.341s) 25539080 read pairs processed; of these: 15462 ( 0.06%) short read pairs filtered out after trimming by size control 11130 ( 0.04%) empty read pairs filtered out after trimming by size control 25512488 (99.90%) read pairs available; of these: 12909047 (50.60%) trimmed read pairs available after processing 12603441 (49.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 14 0.00% 20 17 0.00% 21 7 0.00% 22 25 0.00% 23 17 0.00% 24 16 0.00% 25 15 0.00% 26 19 0.00% 27 26 0.00% 28 25 0.00% 29 19 0.00% 30 22 0.00% 31 24 0.00% 32 26 0.00% 33 27 0.00% 34 31 0.00% 35 16 0.00% 36 35 0.00% 37 30 0.00% 38 35 0.00% 39 43 0.00% 40 59 0.00% 41 49 0.00% 42 64 0.00% 43 80 0.00% 44 65 0.00% 45 79 0.00% 46 78 0.00% 47 91 0.00% 48 115 0.00% 49 159 0.00% 50 164 0.00% 51 204 0.00% 52 223 0.00% 53 247 0.00% 54 229 0.00% 55 290 0.00% 56 301 0.00% 57 375 0.00% 58 437 0.00% 59 517 0.00% 60 622 0.00% 61 750 0.00% 62 860 0.00% 63 991 0.00% 64 1080 0.00% 65 1223 0.00% 66 1368 0.01% 67 1530 0.01% 68 1769 0.01% 69 2014 0.01% 70 2441 0.01% 71 2820 0.01% 72 3270 0.01% 73 3877 0.02% 74 4171 0.02% 75 4602 0.02% 76 5185 0.02% 77 5710 0.02% 78 6431 0.03% 79 7180 0.03% 80 8016 0.03% 81 9135 0.04% 82 10670 0.04% 83 11696 0.05% 84 13622 0.05% 85 14963 0.06% 86 16107 0.06% 87 17183 0.07% 88 18329 0.07% 89 19257 0.08% 90 20838 0.08% 91 22607 0.09% 92 24759 0.10% 93 27038 0.11% 94 29020 0.11% 95 30396 0.12% 96 31686 0.12% 97 33020 0.13% 98 33800 0.13% 99 35368 0.14% 100 37736 0.15% 101 39722 0.16% 102 42460 0.17% 103 44613 0.17% 104 47073 0.18% 105 48495 0.19% 106 50600 0.20% 107 51024 0.20% 108 52177 0.20% 109 53593 0.21% 110 54861 0.22% 111 57119 0.22% 112 60443 0.24% 113 63690 0.25% 114 65254 0.26% 115 68727 0.27% 116 70368 0.28% 117 71242 0.28% 118 72485 0.28% 119 71966 0.28% 120 73632 0.29% 121 74781 0.29% 122 77990 0.31% 123 82021 0.32% 124 85213 0.33% 125 88713 0.35% 126 89382 0.35% 127 91559 0.36% 128 91922 0.36% 129 93462 0.37% 130 95892 0.38% 131 97167 0.38% 132 102635 0.40% 133 107552 0.42% 134 110897 0.43% 135 116575 0.46% 136 121063 0.47% 137 124862 0.49% 138 129696 0.51% 139 137361 0.54% 140 142724 0.56% 141 153072 0.60% 142 168382 0.66% 143 184424 0.72% 144 209716 0.82% 145 243933 0.96% 146 294705 1.16% 147 387496 1.52% 148 568818 2.23% 149 1099604 4.31% 150 5850415 22.93% 151 12603441 49.40% 25512488 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=18 prefix-density=0.79 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=116.43 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.2 sequence=TGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCATCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGCTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=19 prefix-density=0.49 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=101.29 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6941588 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:23:12 Started mapping on | Dec 06 12:23:12 Finished on | Dec 06 12:27:04 Mapping speed, Million of reads per hour | 395.88 Number of input reads | 25512488 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 24052147 Uniquely mapped reads % | 94.28% Average mapped length | 290.34 Number of splices: Total | 26275842 Number of splices: Annotated (sjdb) | 24693770 Number of splices: GT/AG | 25891838 Number of splices: GC/AG | 299470 Number of splices: AT/AC | 10787 Number of splices: Non-canonical | 73747 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.03% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376948 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 30290 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1094467 1094467 1094467 N_multimapping 376948 376948 376948 N_noFeature 987976 23216510 1262582 N_ambiguous 655310 3848 94588 UnstrandedReadsAssigned:22408861 PositiveStrandReadsAssigned:831789 NegativeStrandReadsAssigned:22694977 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6941588 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941588-trimmed-pair1.fastq SRR6941588-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,512,488 reads, 22,718,795 reads pseudoaligned [quant] estimated average fragment length: 244.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52973 SRR6941588.ke.tsv 35125 SRR6941588.se.tsv 88098 total ==> SRR6941588.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.124 0 0 PNS24247 1044 800.669 89.7288 7.54884 PNS24249 1928 1684.67 50.254 2.00936 PNS24246 1044 800.669 89.7288 7.54884 PNS24248 1044 800.669 89.7288 7.54884 PNS24244 1471 1227.67 74.5594 4.09094 PNS24243 293 101.383 0 0 KQK14069 1603 1359.67 2532.61 125.469 KQK14071 474 247.503 27.5432 7.4961 ==> SRR6941588.se.tsv <== BRADI_1g14170v3 2925 BRADI_1g53295v3 807 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 725 BRADI_1g74790v3 154 BRADI_1g09890v3 0 BRADI_1g77505v3 280 BRADI_1g48960v3 1 SRR6941588 completed mapping pipeline successfully