Starting /dee2/code/volunteer_pipeline.sh SRR6941589 current disk space = 1551247306752 free memory = 1601341828 SRR6941589 SRAfilesize af8d80bbb29d07b1df8fe74659f30393 SRR6941589.sra SRR6941589.sra file validated SRR6941589 is paired end SRR6941589 is conventional basespace SRR6941589 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941589_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63425 34.0 33.0 34.0 32.0 34.0 2 32.96925 34.0 33.0 34.0 32.0 34.0 3 33.12775 34.0 33.0 34.0 32.0 34.0 4 33.3365 34.0 33.0 34.0 32.0 34.0 5 33.36225 34.0 33.0 34.0 33.0 34.0 6 37.0425 38.0 37.0 38.0 36.0 38.0 7 37.29875 38.0 38.0 38.0 37.0 38.0 8 37.5025 38.0 38.0 38.0 37.0 38.0 9 37.5985 38.0 38.0 38.0 38.0 38.0 10-14 37.4787 38.0 38.0 38.0 38.0 38.0 15-19 37.532000000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.4904 38.0 38.0 38.0 37.8 38.0 25-29 37.439099999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.454699999999995 38.0 38.0 38.0 37.6 38.0 35-39 37.499 38.0 38.0 38.0 38.0 38.0 40-44 37.48815 38.0 38.0 38.0 38.0 38.0 45-49 37.43005 38.0 38.0 38.0 37.0 38.0 50-54 37.373949999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.32715 38.0 38.0 38.0 37.0 38.0 60-64 37.338300000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.2568 38.0 38.0 38.0 36.8 38.0 70-74 37.182249999999996 38.0 38.0 38.0 36.4 38.0 75-79 37.20739999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.10844999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.046800000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.052049999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.897200000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.8882 38.0 38.0 38.0 35.0 38.0 105-109 36.70155 38.0 38.0 38.0 34.6 38.0 110-114 36.58710000000001 38.0 38.0 38.0 34.6 38.0 115-119 36.346500000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.3481 38.0 38.0 38.0 34.0 38.0 125-129 36.3052 38.0 38.0 38.0 33.8 38.0 130-134 36.156 38.0 37.8 38.0 33.2 38.0 135-139 35.861900000000006 38.0 36.2 38.0 32.6 38.0 140-144 35.782849999999996 38.0 36.0 38.0 32.8 38.0 145-149 35.210699999999996 38.0 36.0 38.0 31.2 38.0 150-151 31.198 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 0.0 18 3.0 19 3.0 20 2.0 21 2.0 22 4.0 23 8.0 24 5.0 25 4.0 26 10.0 27 15.0 28 12.0 29 29.0 30 18.0 31 52.0 32 61.0 33 80.0 34 107.0 35 201.0 36 480.0 37 2901.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.638522427440634 10.29023746701847 6.306068601583113 30.765171503957784 2 22.7 10.925 35.5 30.875000000000004 3 20.424999999999997 16.950000000000003 26.275 36.35 4 25.3 23.65 21.875 29.175 5 27.325 28.1 22.075 22.5 6 22.25 33.074999999999996 22.5 22.175 7 18.35 24.099999999999998 37.85 19.7 8 21.475 22.875 29.625 26.025 9 19.975 21.725 32.85 25.45 10-14 23.775 26.255 24.87 25.1 15-19 23.635 24.685000000000002 25.91 25.77 20-24 23.435 25.019999999999996 25.979999999999997 25.564999999999998 25-29 23.855 24.905 25.124999999999996 26.115 30-34 23.200000000000003 24.81 25.790000000000003 26.200000000000003 35-39 23.28 25.330000000000002 25.46 25.929999999999996 40-44 23.895 24.825 25.11 26.169999999999998 45-49 23.855 25.06 25.25 25.835 50-54 23.53 24.635 25.665 26.169999999999998 55-59 23.84 25.305 25.245 25.61 60-64 24.255 24.89 25.035 25.82 65-69 23.669999999999998 25.3 25.230000000000004 25.8 70-74 24.018602790418562 25.358803820573083 25.323798569785467 25.298794819222888 75-79 23.392017605281584 24.777433229968988 25.35760728218466 26.472941882564772 80-84 24.12 24.355 25.7 25.825 85-89 23.799999999999997 24.89 25.430000000000003 25.88 90-94 24.404999999999998 25.335 24.67 25.590000000000003 95-99 24.485 24.785 24.91 25.82 100-104 24.245 24.985 24.605 26.165 105-109 23.95 24.745 25.155 26.150000000000002 110-114 23.859087269815856 24.844875900720574 25.270216172938355 26.025820656525223 115-119 24.140003004356316 25.04631715988183 24.97120825196535 25.842471583796506 120-124 24.21 25.055 24.435000000000002 26.3 125-129 24.37 25.290000000000003 24.29 26.05 130-134 24.205 25.419999999999998 24.065 26.31 135-139 23.785 25.319999999999997 24.415 26.479999999999997 140-144 23.415 25.045 24.705 26.834999999999997 145-149 23.89 25.009999999999998 25.014999999999997 26.085 150-151 23.7625 25.087500000000002 24.762500000000003 26.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 2.5 27 2.5 28 2.5 29 3.0 30 4.0 31 8.5 32 18.0 33 19.5 34 23.0 35 34.0 36 39.5 37 54.0 38 74.0 39 86.5 40 118.5 41 151.0 42 162.0 43 187.5 44 195.0 45 193.0 46 191.0 47 192.5 48 211.5 49 189.5 50 153.5 51 140.0 52 140.5 53 132.5 54 113.0 55 94.0 56 83.5 57 79.5 58 74.0 59 76.5 60 75.0 61 66.0 62 62.5 63 68.0 64 63.5 65 58.0 66 57.0 67 52.0 68 43.0 69 39.5 70 41.5 71 30.5 72 20.5 73 20.5 74 18.0 75 10.5 76 5.5 77 5.5 78 4.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.03 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.08 115-119 0.145 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.2 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.5375 0.0 0.0 0.0 0.0 102-103 2.7750000000000004 0.0 0.0 0.0 0.0 104-105 3.175 0.0 0.0 0.0 0.0 106-107 3.675 0.0 0.0 0.0 0.0 108-109 4.112500000000001 0.0 0.0 0.0 0.0 110-111 4.6875 0.0 0.0 0.0 0.0 112-113 5.012499999999999 0.0 0.0 0.0 0.0 114-115 5.4875 0.0 0.0 0.0 0.0 116-117 5.925 0.0 0.0 0.0 0.0 118-119 6.4875 0.0 0.0 0.0 0.0 120-121 7.324999999999999 0.0 0.0 0.0 0.0 122-123 8.075 0.0 0.0 0.0 0.0 124-125 8.925 0.0 0.0 0.0 0.0 126-127 9.6875 0.0 0.0 0.0 0.0 128-129 10.3125 0.0 0.0 0.0 0.0 130-131 10.875 0.0 0.0 0.0 0.0 132-133 11.425 0.0 0.0 0.0 0.0 134-135 12.1 0.0 0.0 0.0 0.0 136-137 12.775 0.0 0.0 0.0 0.0 138-139 13.4625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCTAC 10 0.0068396386 144.9375 9 >>END_MODULE SRR6941589 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941589_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1335 33.0 33.0 34.0 33.0 34.0 2 33.213 34.0 33.0 34.0 33.0 34.0 3 33.23575 34.0 33.0 34.0 33.0 34.0 4 33.2505 34.0 33.0 34.0 33.0 34.0 5 33.21525 34.0 33.0 34.0 33.0 34.0 6 37.28175 38.0 38.0 38.0 37.0 38.0 7 37.40325 38.0 38.0 38.0 38.0 38.0 8 37.409 38.0 38.0 38.0 38.0 38.0 9 37.37975 38.0 38.0 38.0 38.0 38.0 10-14 37.36795 38.0 38.0 38.0 37.6 38.0 15-19 37.356049999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.319 38.0 38.0 38.0 37.6 38.0 25-29 37.243449999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.259499999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.2461 38.0 38.0 38.0 37.0 38.0 40-44 37.2434 38.0 38.0 38.0 37.0 38.0 45-49 37.278800000000004 38.0 38.0 38.0 37.6 38.0 50-54 37.187850000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.1513 38.0 38.0 38.0 37.0 38.0 60-64 37.11685 38.0 38.0 38.0 37.0 38.0 65-69 37.048449999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.0291 38.0 38.0 38.0 36.2 38.0 75-79 37.0111 38.0 38.0 38.0 36.0 38.0 80-84 36.8606 38.0 38.0 38.0 35.6 38.0 85-89 36.85575 38.0 38.0 38.0 35.8 38.0 90-94 36.7946 38.0 38.0 38.0 35.2 38.0 95-99 36.714150000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.5935 38.0 38.0 38.0 35.0 38.0 105-109 36.37565 38.0 38.0 38.0 34.0 38.0 110-114 36.06945 38.0 38.0 38.0 33.6 38.0 115-119 35.67095 38.0 37.0 38.0 30.8 38.0 120-124 35.710499999999996 38.0 36.6 38.0 31.6 38.0 125-129 35.77645 38.0 37.0 38.0 32.0 38.0 130-134 35.6611 38.0 36.6 38.0 31.4 38.0 135-139 35.4516 38.0 36.4 38.0 31.0 38.0 140-144 34.9894 38.0 36.0 38.0 30.0 38.0 145-149 34.0794 38.0 35.0 38.0 25.8 38.0 150-151 28.192875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 4.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 2.0 19 2.0 20 1.0 21 4.0 22 6.0 23 6.0 24 10.0 25 11.0 26 11.0 27 14.0 28 35.0 29 30.0 30 40.0 31 52.0 32 71.0 33 86.0 34 114.0 35 234.0 36 511.0 37 2736.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.075 18.775 8.5 24.65 2 29.525000000000002 23.674999999999997 26.900000000000002 19.900000000000002 3 23.75 25.974999999999998 27.375 22.900000000000002 4 28.025 30.375000000000004 19.05 22.55 5 28.449999999999996 32.975 18.975 19.6 6 23.325000000000003 36.95 19.175 20.549999999999997 7 23.525 19.475 33.925 23.075000000000003 8 23.05 23.0 24.95 28.999999999999996 9 25.5 21.275 26.450000000000003 26.775 10-14 25.585 27.095000000000002 22.99 24.33 15-19 26.06 25.03 23.87 25.040000000000003 20-24 25.765 25.77 23.915 24.55 25-29 25.2 25.080000000000002 24.345 25.374999999999996 30-34 25.924999999999997 24.709999999999997 24.14 25.224999999999998 35-39 25.169999999999998 25.480000000000004 24.675 24.675 40-44 25.895000000000003 24.8 24.345 24.959999999999997 45-49 25.745 25.1 24.175 24.98 50-54 26.245 24.905 24.215 24.635 55-59 26.39 25.374999999999996 23.79 24.445 60-64 25.7 25.155 24.404999999999998 24.740000000000002 65-69 25.580000000000002 25.695 24.025 24.7 70-74 26.235000000000003 25.235000000000003 24.035 24.495 75-79 26.119999999999997 25.495 24.48 23.905 80-84 25.86 24.47 25.009999999999998 24.66 85-89 26.625 25.1 23.965 24.310000000000002 90-94 26.340000000000003 24.79 24.25 24.62 95-99 26.57 25.295 24.505 23.630000000000003 100-104 26.229999999999997 25.430000000000003 24.13 24.21 105-109 26.715 25.814999999999998 23.765 23.705000000000002 110-114 26.669999999999998 25.745 24.104999999999997 23.48 115-119 27.13 25.47 24.09 23.31 120-124 27.26 25.745 23.79 23.205000000000002 125-129 28.115000000000002 25.385 24.015 22.485 130-134 27.634999999999998 26.224999999999998 23.57 22.57 135-139 28.125 25.47 24.445 21.959999999999997 140-144 27.96 26.05 24.335 21.654999999999998 145-149 28.299999999999997 26.179999999999996 23.735 21.785 150-151 28.499999999999996 27.200000000000003 23.3375 20.962500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.0 27 2.5 28 3.5 29 5.0 30 7.5 31 7.5 32 10.5 33 17.5 34 24.0 35 26.0 36 38.0 37 52.0 38 67.0 39 96.5 40 133.0 41 145.0 42 150.0 43 173.0 44 177.5 45 166.0 46 167.0 47 181.5 48 188.0 49 171.5 50 161.5 51 144.5 52 120.5 53 119.0 54 115.0 55 104.0 56 87.5 57 83.0 58 91.5 59 89.5 60 85.0 61 79.0 62 76.5 63 79.0 64 77.0 65 68.5 66 57.0 67 51.0 68 46.5 69 46.0 70 43.0 71 37.5 72 31.0 73 28.0 74 21.5 75 14.0 76 12.5 77 7.5 78 3.0 79 1.5 80 0.5 81 1.5 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90973630831643 97.52499999999999 2 0.8367139959432048 1.6500000000000001 3 0.17748478701825557 0.525 4 0.07606490872210953 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.2 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.2750000000000004 0.0 0.0 0.0 0.0 100-101 2.5375 0.0 0.0 0.0 0.0 102-103 2.7625 0.0 0.0 0.0 0.0 104-105 3.175 0.0 0.0 0.0 0.0 106-107 3.625 0.0 0.0 0.0 0.0 108-109 4.0875 0.0 0.0 0.0 0.0 110-111 4.6875 0.0 0.0 0.0 0.0 112-113 5.050000000000001 0.0 0.0 0.0 0.0 114-115 5.5375 0.0 0.0 0.0 0.0 116-117 5.925 0.0 0.0 0.0 0.0 118-119 6.4375 0.0 0.0 0.0 0.0 120-121 7.275 0.0 0.0 0.0 0.0 122-123 8.0 0.0 0.0 0.0 0.0 124-125 8.85 0.0 0.0 0.0 0.0 126-127 9.662500000000001 0.0 0.0 0.0 0.0 128-129 10.3125 0.0 0.0 0.0 0.0 130-131 10.875 0.0 0.0 0.0 0.0 132-133 11.425 0.0 0.0 0.0 0.0 134-135 12.1375 0.0 0.0 0.0 0.0 136-137 12.825 0.0 0.0 0.0 0.0 138-139 13.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTTC 10 0.006830828 145.0 2 GCCACTT 10 0.006830828 145.0 1 AATTGCA 10 0.006830828 145.0 4 >>END_MODULE Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125109 spots for SRR6941589.sra Written 1125109 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra Read 1125105 spots for SRR6941589.sra Written 1125105 spots for SRR6941589.sra SRR ids: ['SRR6941589.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4h5bf866 SRR6941589.sra spots: 22502104 blocks: [[1, 1125105], [1125106, 2250210], [2250211, 3375315], [3375316, 4500420], [4500421, 5625525], [5625526, 6750630], [6750631, 7875735], [7875736, 9000840], [9000841, 10125945], [10125946, 11251050], [11251051, 12376155], [12376156, 13501260], [13501261, 14626365], [14626366, 15751470], [15751471, 16876575], [16876576, 18001680], [18001681, 19126785], [19126786, 20251890], [20251891, 21376995], [21376996, 22502104]] SRR6941589 file size 7603524 SRR6941589 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941589 SRR6941589_1.fastq SRR6941589_2.fastq Input file: SRR6941589_1.fastq Paired file: SRR6941589_2.fastq trimmed: SRR6941589-trimmed-pair1.fastq, SRR6941589-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:20:01 2024 >> started Fri Dec 6 12:20:26 2024 >> done (25.208s) 22502104 read pairs processed; of these: 15347 ( 0.07%) short read pairs filtered out after trimming by size control 14082 ( 0.06%) empty read pairs filtered out after trimming by size control 22472675 (99.87%) read pairs available; of these: 11635530 (51.78%) trimmed read pairs available after processing 10837145 (48.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 15 0.00% 21 23 0.00% 22 21 0.00% 23 16 0.00% 24 19 0.00% 25 14 0.00% 26 21 0.00% 27 14 0.00% 28 16 0.00% 29 20 0.00% 30 27 0.00% 31 29 0.00% 32 26 0.00% 33 23 0.00% 34 40 0.00% 35 34 0.00% 36 45 0.00% 37 52 0.00% 38 70 0.00% 39 57 0.00% 40 78 0.00% 41 83 0.00% 42 98 0.00% 43 111 0.00% 44 99 0.00% 45 93 0.00% 46 125 0.00% 47 165 0.00% 48 186 0.00% 49 244 0.00% 50 240 0.00% 51 304 0.00% 52 341 0.00% 53 353 0.00% 54 386 0.00% 55 436 0.00% 56 517 0.00% 57 591 0.00% 58 733 0.00% 59 828 0.00% 60 932 0.00% 61 1027 0.00% 62 1199 0.01% 63 1414 0.01% 64 1596 0.01% 65 1759 0.01% 66 1888 0.01% 67 2171 0.01% 68 2612 0.01% 69 2887 0.01% 70 3430 0.02% 71 3890 0.02% 72 4391 0.02% 73 4954 0.02% 74 5586 0.02% 75 6214 0.03% 76 6750 0.03% 77 7451 0.03% 78 8360 0.04% 79 9433 0.04% 80 10191 0.05% 81 11242 0.05% 82 12820 0.06% 83 14269 0.06% 84 16468 0.07% 85 17902 0.08% 86 19272 0.09% 87 20479 0.09% 88 22098 0.10% 89 23023 0.10% 90 24672 0.11% 91 26533 0.12% 92 28117 0.13% 93 30159 0.13% 94 32373 0.14% 95 33646 0.15% 96 35578 0.16% 97 37031 0.16% 98 38422 0.17% 99 39758 0.18% 100 42194 0.19% 101 43224 0.19% 102 45516 0.20% 103 47051 0.21% 104 48852 0.22% 105 50459 0.22% 106 52577 0.23% 107 53425 0.24% 108 55434 0.25% 109 57198 0.25% 110 58367 0.26% 111 59933 0.27% 112 62597 0.28% 113 64219 0.29% 114 65997 0.29% 115 68219 0.30% 116 69965 0.31% 117 71752 0.32% 118 72882 0.32% 119 73099 0.33% 120 74501 0.33% 121 75460 0.34% 122 77344 0.34% 123 80410 0.36% 124 82645 0.37% 125 84654 0.38% 126 85853 0.38% 127 87549 0.39% 128 88319 0.39% 129 91124 0.41% 130 92477 0.41% 131 93622 0.42% 132 96917 0.43% 133 100217 0.45% 134 103429 0.46% 135 106502 0.47% 136 109596 0.49% 137 112982 0.50% 138 117073 0.52% 139 123576 0.55% 140 128928 0.57% 141 136214 0.61% 142 147962 0.66% 143 159858 0.71% 144 179143 0.80% 145 206100 0.92% 146 247692 1.10% 147 322897 1.44% 148 471683 2.10% 149 916998 4.08% 150 5092225 22.66% 151 10837145 48.22% 22472675 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=3.0 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=32.31 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCTACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=28 prefix-density=0.43 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=67.24 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6941589 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:21:25 Started mapping on | Dec 06 12:21:26 Finished on | Dec 06 12:25:18 Mapping speed, Million of reads per hour | 348.71 Number of input reads | 22472675 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 21163161 Uniquely mapped reads % | 94.17% Average mapped length | 288.63 Number of splices: Total | 22697464 Number of splices: Annotated (sjdb) | 21313867 Number of splices: GT/AG | 22359377 Number of splices: GC/AG | 263656 Number of splices: AT/AC | 9457 Number of splices: Non-canonical | 64974 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.03% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345275 % of reads mapped to multiple loci | 1.54% Number of reads mapped to too many loci | 25502 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.59% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 974534 974534 974534 N_multimapping 345275 345275 345275 N_noFeature 806736 20460433 1055289 N_ambiguous 537248 3211 83477 UnstrandedReadsAssigned:19819177 PositiveStrandReadsAssigned:699517 NegativeStrandReadsAssigned:20024395 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6941589 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941589-trimmed-pair1.fastq SRR6941589-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,472,675 reads, 20,041,915 reads pseudoaligned [quant] estimated average fragment length: 238.432 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52973 SRR6941589.ke.tsv 35125 SRR6941589.se.tsv 88098 total ==> SRR6941589.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.895 0 0 PNS24247 1044 806.568 61.2008 5.66092 PNS24249 1928 1690.57 101.209 4.46641 PNS24246 1044 806.568 61.2008 5.66092 PNS24248 1044 806.568 61.2008 5.66092 PNS24244 1471 1233.57 51.1882 3.09584 PNS24243 293 105.59 0 0 KQK14069 1603 1365.57 6183.09 337.803 KQK14071 474 253.08 160.504 47.3149 ==> SRR6941589.se.tsv <== BRADI_1g14170v3 7112 BRADI_1g53295v3 833 BRADI_1g59795v3 173 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 440 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 321 BRADI_1g48960v3 0 SRR6941589 completed mapping pipeline successfully