Starting /dee2/code/volunteer_pipeline.sh SRR6941594 current disk space = 1551213842432 free memory = 1602338760 SRR6941594 SRAfilesize 93631654e20dcf706f28974f0c52464f SRR6941594.sra SRR6941594.sra file validated SRR6941594 is paired end SRR6941594 is conventional basespace SRR6941594 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941594_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6275 34.0 33.0 34.0 31.0 34.0 2 32.8805 34.0 33.0 34.0 31.0 34.0 3 33.04875 34.0 33.0 34.0 32.0 34.0 4 33.25875 34.0 33.0 34.0 32.0 34.0 5 33.3035 34.0 33.0 34.0 33.0 34.0 6 37.027 38.0 37.0 38.0 36.0 38.0 7 37.36025 38.0 38.0 38.0 37.0 38.0 8 37.418 38.0 38.0 38.0 37.0 38.0 9 37.5235 38.0 38.0 38.0 38.0 38.0 10-14 37.54135 38.0 38.0 38.0 38.0 38.0 15-19 37.53245 38.0 38.0 38.0 38.0 38.0 20-24 37.54195 38.0 38.0 38.0 38.0 38.0 25-29 37.504599999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.502750000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.5292 38.0 38.0 38.0 38.0 38.0 40-44 37.517 38.0 38.0 38.0 38.0 38.0 45-49 37.452400000000004 38.0 38.0 38.0 37.6 38.0 50-54 37.4113 38.0 38.0 38.0 37.0 38.0 55-59 37.4292 38.0 38.0 38.0 37.0 38.0 60-64 37.37925 38.0 38.0 38.0 37.0 38.0 65-69 37.297250000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.21835 38.0 38.0 38.0 36.8 38.0 75-79 37.28735 38.0 38.0 38.0 36.8 38.0 80-84 37.2325 38.0 38.0 38.0 36.2 38.0 85-89 37.18555 38.0 38.0 38.0 36.0 38.0 90-94 37.14905 38.0 38.0 38.0 36.0 38.0 95-99 37.00665 38.0 38.0 38.0 35.8 38.0 100-104 37.0122 38.0 38.0 38.0 35.4 38.0 105-109 36.8856 38.0 38.0 38.0 35.0 38.0 110-114 36.71319999999999 38.0 38.0 38.0 35.0 38.0 115-119 36.5388 38.0 38.0 38.0 34.2 38.0 120-124 36.50835000000001 38.0 38.0 38.0 34.0 38.0 125-129 36.47755 38.0 38.0 38.0 34.0 38.0 130-134 36.2223 38.0 38.0 38.0 33.4 38.0 135-139 36.07045 38.0 37.0 38.0 33.2 38.0 140-144 35.878099999999996 38.0 36.0 38.0 33.0 38.0 145-149 35.303700000000006 38.0 36.0 38.0 31.4 38.0 150-151 31.523249999999997 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 3.0 22 2.0 23 1.0 24 5.0 25 6.0 26 7.0 27 16.0 28 16.0 29 20.0 30 31.0 31 39.0 32 47.0 33 61.0 34 120.0 35 198.0 36 516.0 37 2907.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.88915156291043 9.613869188337274 8.011557656947728 36.485421591804574 2 21.9 12.5 35.5 30.099999999999998 3 19.775000000000002 17.95 26.150000000000002 36.125 4 26.55 23.225 22.425 27.800000000000004 5 25.474999999999998 29.225 23.825 21.475 6 23.200000000000003 30.4 23.974999999999998 22.425 7 18.625 23.775 38.9 18.7 8 21.6 22.7 29.175 26.525 9 20.875 20.625 32.175 26.325 10-14 23.189999999999998 25.935000000000002 25.285000000000004 25.590000000000003 15-19 23.275000000000002 24.765 25.775 26.185000000000002 20-24 23.630000000000003 25.81 25.2 25.36 25-29 23.66 25.6 25.285000000000004 25.455 30-34 23.165 24.81 26.314999999999998 25.71 35-39 23.62 24.585 26.090000000000003 25.705 40-44 23.125 25.035 26.075 25.765 45-49 23.53 24.375 25.919999999999998 26.174999999999997 50-54 23.685000000000002 25.185000000000002 25.28 25.85 55-59 23.655 24.884999999999998 25.985000000000003 25.474999999999998 60-64 23.580000000000002 25.840000000000003 25.505 25.074999999999996 65-69 23.46 25.074999999999996 25.580000000000002 25.885 70-74 23.85619280964048 24.65623281164058 25.531276563828193 25.956297814890743 75-79 23.737373737373737 24.922492249224923 25.71257125712571 25.62756275627563 80-84 23.5 24.83 25.314999999999998 26.355 85-89 23.705000000000002 25.124999999999996 25.245 25.924999999999997 90-94 23.645 24.709999999999997 24.93 26.715 95-99 23.86 25.035 25.169999999999998 25.935000000000002 100-104 24.065 25.035 25.295 25.605 105-109 24.08 25.130000000000003 24.565 26.224999999999998 110-114 23.723047676221924 24.8336585121817 25.338936415028268 26.104357396568112 115-119 23.76876876876877 25.235235235235237 25.37037037037037 25.625625625625624 120-124 24.060000000000002 25.085 24.645 26.21 125-129 23.94 25.064999999999998 24.575 26.419999999999998 130-134 23.84 25.174999999999997 24.775 26.21 135-139 24.115000000000002 24.795 24.545 26.545 140-144 24.404999999999998 25.35 24.375 25.869999999999997 145-149 24.205 24.709999999999997 24.805 26.279999999999998 150-151 24.962500000000002 24.837500000000002 24.8125 25.387500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 2.5 28 4.0 29 8.5 30 8.0 31 8.5 32 14.0 33 17.5 34 27.5 35 37.0 36 46.5 37 63.0 38 78.5 39 88.0 40 107.5 41 140.0 42 180.0 43 188.5 44 170.5 45 181.0 46 203.0 47 204.5 48 192.0 49 182.5 50 169.5 51 153.0 52 132.5 53 114.0 54 109.5 55 100.0 56 99.0 57 97.5 58 90.5 59 83.5 60 73.5 61 74.0 62 73.0 63 65.0 64 60.0 65 58.5 66 54.0 67 50.0 68 40.0 69 33.5 70 30.0 71 23.5 72 18.5 73 12.0 74 10.0 75 9.5 76 5.0 77 2.0 78 1.5 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.055 115-119 0.1 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6300403225806451 1.25 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.125 0.0125 0.0 0.0 0.0 80-81 0.2 0.025 0.0 0.0 0.0 82-83 0.275 0.025 0.0 0.0 0.0 84-85 0.38749999999999996 0.025 0.0 0.0 0.0 86-87 0.5625 0.025 0.0 0.0 0.0 88-89 0.7875000000000001 0.025 0.0 0.0 0.0 90-91 0.95 0.025 0.0 0.0 0.0 92-93 1.175 0.025 0.0 0.0 0.0 94-95 1.3875000000000002 0.025 0.0 0.0 0.0 96-97 1.6125 0.025 0.0 0.0 0.0 98-99 1.875 0.025 0.0 0.0 0.0 100-101 2.1875 0.025 0.0 0.0 0.0 102-103 2.425 0.025 0.0 0.0 0.0 104-105 2.7125 0.025 0.0 0.0 0.0 106-107 3.0125 0.025 0.0 0.0 0.0 108-109 3.4000000000000004 0.025 0.0 0.0 0.0 110-111 3.75 0.025 0.0 0.0 0.0 112-113 4.1875 0.025 0.0 0.0 0.0 114-115 4.75 0.025 0.0 0.0 0.0 116-117 5.35 0.025 0.0 0.0 0.0 118-119 5.75 0.025 0.0 0.0 0.0 120-121 6.199999999999999 0.025 0.0 0.0 0.0 122-123 6.8625 0.025 0.0 0.0 0.0 124-125 7.4125 0.025 0.0 0.0 0.0 126-127 8.0 0.025 0.0 0.0 0.0 128-129 8.6125 0.025 0.0 0.0 0.0 130-131 9.287500000000001 0.025 0.0 0.0 0.0 132-133 9.825 0.025 0.0 0.0 0.0 134-135 10.7625 0.025 0.0 0.0 0.0 136-137 11.4375 0.025 0.0 0.0 0.0 138-139 12.2375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6941594 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941594_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.083 33.0 33.0 34.0 32.0 34.0 2 33.16525 34.0 33.0 34.0 33.0 34.0 3 33.20125 34.0 33.0 34.0 33.0 34.0 4 33.18925 34.0 33.0 34.0 33.0 34.0 5 33.13275 34.0 33.0 34.0 33.0 34.0 6 37.21225 38.0 38.0 38.0 37.0 38.0 7 37.2635 38.0 38.0 38.0 37.0 38.0 8 37.25975 38.0 38.0 38.0 37.0 38.0 9 37.285 38.0 38.0 38.0 37.0 38.0 10-14 37.28185 38.0 38.0 38.0 37.0 38.0 15-19 37.3041 38.0 38.0 38.0 37.0 38.0 20-24 37.227549999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.1641 38.0 38.0 38.0 36.8 38.0 30-34 37.1785 38.0 38.0 38.0 36.8 38.0 35-39 37.17045 38.0 38.0 38.0 36.8 38.0 40-44 37.12355 38.0 38.0 38.0 36.8 38.0 45-49 37.18729999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.07715 38.0 38.0 38.0 36.6 38.0 55-59 37.07825 38.0 38.0 38.0 36.4 38.0 60-64 37.006449999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.89955 38.0 38.0 38.0 36.0 38.0 70-74 36.91725 38.0 38.0 38.0 36.0 38.0 75-79 36.91105 38.0 38.0 38.0 35.6 38.0 80-84 36.74105 38.0 38.0 38.0 35.0 38.0 85-89 36.7162 38.0 38.0 38.0 35.0 38.0 90-94 36.684900000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.635450000000006 38.0 38.0 38.0 34.6 38.0 100-104 36.493 38.0 38.0 38.0 34.0 38.0 105-109 36.26135 38.0 38.0 38.0 33.8 38.0 110-114 35.8711 38.0 37.6 38.0 32.6 38.0 115-119 35.47835 38.0 36.4 38.0 30.2 38.0 120-124 35.458450000000006 38.0 36.2 38.0 30.0 38.0 125-129 35.68044999999999 38.0 36.4 38.0 31.6 38.0 130-134 35.4664 38.0 36.0 38.0 31.0 38.0 135-139 35.120050000000006 38.0 35.8 38.0 30.6 38.0 140-144 34.72044999999999 38.0 35.6 38.0 28.6 38.0 145-149 33.758500000000005 38.0 33.8 38.0 23.2 38.0 150-151 27.9455 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 1.0 6 2.0 7 1.0 8 0.0 9 0.0 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 5.0 18 0.0 19 3.0 20 5.0 21 4.0 22 7.0 23 8.0 24 15.0 25 18.0 26 12.0 27 23.0 28 29.0 29 30.0 30 51.0 31 47.0 32 78.0 33 107.0 34 152.0 35 275.0 36 522.0 37 2594.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.4 18.75 10.225 29.625 2 29.525000000000002 23.95 26.375 20.150000000000002 3 22.325 25.324999999999996 28.599999999999998 23.75 4 26.450000000000003 31.324999999999996 20.575 21.65 5 27.625 33.225 18.675 20.474999999999998 6 24.15 35.699999999999996 19.5 20.65 7 23.125 19.55 36.35 20.974999999999998 8 23.974999999999998 23.599999999999998 22.825 29.599999999999998 9 24.525 22.35 26.85 26.275 10-14 25.83 26.355 23.03 24.785 15-19 25.77 25.230000000000004 24.195 24.805 20-24 25.874999999999996 25.919999999999998 24.01 24.195 25-29 25.745 25.915 23.71 24.63 30-34 26.095000000000002 25.4 24.12 24.385 35-39 25.765 25.330000000000002 24.285 24.62 40-44 26.400000000000002 25.014999999999997 23.955000000000002 24.63 45-49 26.179999999999996 25.145 24.240000000000002 24.435000000000002 50-54 26.26 25.765 23.815 24.16 55-59 25.895000000000003 25.09 24.404999999999998 24.610000000000003 60-64 25.669999999999998 25.224999999999998 24.625 24.48 65-69 26.195 25.019999999999996 24.295 24.490000000000002 70-74 26.245 24.4 24.46 24.895 75-79 25.785000000000004 25.255 24.46 24.5 80-84 25.775 25.590000000000003 23.98 24.654999999999998 85-89 26.650000000000002 24.435000000000002 24.325 24.59 90-94 25.635 25.385 24.48 24.5 95-99 26.484999999999996 25.19 24.66 23.665 100-104 26.305 25.34 24.36 23.995 105-109 26.645000000000003 25.195 24.654999999999998 23.505000000000003 110-114 26.66 25.56 23.84 23.94 115-119 27.034999999999997 25.174999999999997 24.5 23.29 120-124 26.93 25.88 23.62 23.57 125-129 27.295 25.650000000000002 23.494999999999997 23.56 130-134 27.405 25.424999999999997 24.515 22.655 135-139 27.625 25.45 24.224999999999998 22.7 140-144 28.299999999999997 25.3 24.34 22.06 145-149 28.405 25.695 23.79 22.11 150-151 28.5625 26.450000000000003 22.725 22.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 1.5 27 2.0 28 4.5 29 4.5 30 4.5 31 8.0 32 11.5 33 14.0 34 19.0 35 30.0 36 42.0 37 52.0 38 67.0 39 84.0 40 102.5 41 129.5 42 156.5 43 165.5 44 171.5 45 183.0 46 190.0 47 181.0 48 176.0 49 174.5 50 159.0 51 149.5 52 140.5 53 120.0 54 115.0 55 111.5 56 102.0 57 108.5 58 111.0 59 103.5 60 84.0 61 72.5 62 74.5 63 78.0 64 78.5 65 68.0 66 54.0 67 58.5 68 54.5 69 40.5 70 40.0 71 32.5 72 20.0 73 15.0 74 11.5 75 8.5 76 6.0 77 1.5 78 1.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67819013726486 97.05 2 1.1184544992374175 2.1999999999999997 3 0.1525165226232842 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.05083884087442806 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7875000000000001 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.175 0.0 0.0 0.0 0.0 94-95 1.3875000000000002 0.0 0.0 0.0 0.0 96-97 1.6125 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.4125 0.0 0.0 0.0 0.0 104-105 2.7125 0.0 0.0 0.0 0.0 106-107 2.9625 0.0 0.0 0.0 0.0 108-109 3.325 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.074999999999999 0.0 0.0 0.0 0.0 114-115 4.65 0.0 0.0 0.0 0.0 116-117 5.225 0.0 0.0 0.0 0.0 118-119 5.575 0.0 0.0 0.0 0.0 120-121 6.050000000000001 0.0 0.0 0.0 0.0 122-123 6.7125 0.0 0.0 0.0 0.0 124-125 7.2875 0.0 0.0 0.0 0.0 126-127 7.875 0.0 0.0 0.0 0.0 128-129 8.4875 0.0 0.0 0.0 0.0 130-131 9.162500000000001 0.0 0.0 0.0 0.0 132-133 9.75 0.0 0.0 0.0 0.0 134-135 10.6875 0.0 0.0 0.0 0.0 136-137 11.375 0.0 0.0 0.0 0.0 138-139 12.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082792 spots for SRR6941594.sra Written 1082792 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra Read 1082780 spots for SRR6941594.sra Written 1082780 spots for SRR6941594.sra SRR ids: ['SRR6941594.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_65_doios SRR6941594.sra spots: 21655612 blocks: [[1, 1082780], [1082781, 2165560], [2165561, 3248340], [3248341, 4331120], [4331121, 5413900], [5413901, 6496680], [6496681, 7579460], [7579461, 8662240], [8662241, 9745020], [9745021, 10827800], [10827801, 11910580], [11910581, 12993360], [12993361, 14076140], [14076141, 15158920], [15158921, 16241700], [16241701, 17324480], [17324481, 18407260], [18407261, 19490040], [19490041, 20572820], [20572821, 21655612]] SRR6941594 file size 7316675 SRR6941594 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941594 SRR6941594_1.fastq SRR6941594_2.fastq Input file: SRR6941594_1.fastq Paired file: SRR6941594_2.fastq trimmed: SRR6941594-trimmed-pair1.fastq, SRR6941594-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:37:25 2024 >> started Fri Dec 6 12:37:50 2024 >> done (24.909s) 21655612 read pairs processed; of these: 13580 ( 0.06%) short read pairs filtered out after trimming by size control 9989 ( 0.05%) empty read pairs filtered out after trimming by size control 21632043 (99.89%) read pairs available; of these: 10989849 (50.80%) trimmed read pairs available after processing 10642194 (49.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 14 0.00% 20 14 0.00% 21 14 0.00% 22 9 0.00% 23 22 0.00% 24 16 0.00% 25 19 0.00% 26 17 0.00% 27 20 0.00% 28 20 0.00% 29 20 0.00% 30 14 0.00% 31 15 0.00% 32 16 0.00% 33 18 0.00% 34 24 0.00% 35 24 0.00% 36 17 0.00% 37 26 0.00% 38 37 0.00% 39 36 0.00% 40 40 0.00% 41 44 0.00% 42 47 0.00% 43 47 0.00% 44 64 0.00% 45 66 0.00% 46 68 0.00% 47 87 0.00% 48 77 0.00% 49 113 0.00% 50 126 0.00% 51 155 0.00% 52 184 0.00% 53 201 0.00% 54 219 0.00% 55 251 0.00% 56 251 0.00% 57 285 0.00% 58 355 0.00% 59 414 0.00% 60 494 0.00% 61 590 0.00% 62 751 0.00% 63 846 0.00% 64 917 0.00% 65 999 0.00% 66 1070 0.00% 67 1213 0.01% 68 1434 0.01% 69 1590 0.01% 70 1977 0.01% 71 2227 0.01% 72 2732 0.01% 73 3144 0.01% 74 3301 0.02% 75 3894 0.02% 76 4079 0.02% 77 4705 0.02% 78 5069 0.02% 79 5849 0.03% 80 6635 0.03% 81 7449 0.03% 82 8621 0.04% 83 9666 0.04% 84 11367 0.05% 85 12321 0.06% 86 13113 0.06% 87 14035 0.06% 88 15163 0.07% 89 16020 0.07% 90 17102 0.08% 91 19117 0.09% 92 20630 0.10% 93 22579 0.10% 94 24305 0.11% 95 25666 0.12% 96 27114 0.13% 97 27780 0.13% 98 28425 0.13% 99 29872 0.14% 100 31905 0.15% 101 34026 0.16% 102 35991 0.17% 103 38606 0.18% 104 40314 0.19% 105 41981 0.19% 106 43151 0.20% 107 43619 0.20% 108 44585 0.21% 109 46283 0.21% 110 47758 0.22% 111 49773 0.23% 112 52531 0.24% 113 55282 0.26% 114 57266 0.26% 115 59865 0.28% 116 61210 0.28% 117 61809 0.29% 118 63139 0.29% 119 62182 0.29% 120 64037 0.30% 121 65390 0.30% 122 67822 0.31% 123 71833 0.33% 124 75400 0.35% 125 77334 0.36% 126 78528 0.36% 127 79434 0.37% 128 80053 0.37% 129 81715 0.38% 130 82972 0.38% 131 84663 0.39% 132 88747 0.41% 133 92666 0.43% 134 96604 0.45% 135 101885 0.47% 136 104446 0.48% 137 107815 0.50% 138 111523 0.52% 139 118234 0.55% 140 122546 0.57% 141 130856 0.60% 142 143643 0.66% 143 158419 0.73% 144 178977 0.83% 145 208154 0.96% 146 250312 1.16% 147 329363 1.52% 148 479716 2.22% 149 925048 4.28% 150 4953058 22.90% 151 10642194 49.20% 21632043 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=15 prefix-density=0.97 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.16 sequence-density-rank=20 fanout-score=11.43 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=3.6 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCGACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGTGTATG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=15 prefix-density=0.63 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=98.93 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6941594 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:38:47 Started mapping on | Dec 06 12:38:47 Finished on | Dec 06 12:41:31 Mapping speed, Million of reads per hour | 474.85 Number of input reads | 21632043 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20607115 Uniquely mapped reads % | 95.26% Average mapped length | 290.28 Number of splices: Total | 22139691 Number of splices: Annotated (sjdb) | 20816145 Number of splices: GT/AG | 21818678 Number of splices: GC/AG | 251497 Number of splices: AT/AC | 8667 Number of splices: Non-canonical | 60849 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.03% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313002 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 26783 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 721244 721244 721244 N_multimapping 313002 313002 313002 N_noFeature 776886 19876100 1009931 N_ambiguous 578643 3291 80887 UnstrandedReadsAssigned:19251586 PositiveStrandReadsAssigned:727724 NegativeStrandReadsAssigned:19516297 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6941594 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941594-trimmed-pair1.fastq SRR6941594-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,632,043 reads, 19,511,958 reads pseudoaligned [quant] estimated average fragment length: 242.738 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52973 SRR6941594.ke.tsv 35125 SRR6941594.se.tsv 88098 total ==> SRR6941594.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.747 0 0 PNS24247 1044 802.262 71.3462 6.81967 PNS24249 1928 1686.26 62.5483 2.84445 PNS24246 1044 802.262 71.3462 6.81967 PNS24248 1044 802.262 71.3462 6.81967 PNS24244 1471 1229.26 45.413 2.83299 PNS24243 293 102.161 0 0 KQK14069 1603 1361.26 3297.95 185.785 KQK14071 474 248.44 73.9597 22.8287 ==> SRR6941594.se.tsv <== BRADI_1g14170v3 3811 BRADI_1g53295v3 615 BRADI_1g59795v3 105 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 515 BRADI_1g74790v3 122 BRADI_1g09890v3 0 BRADI_1g77505v3 251 BRADI_1g48960v3 0 SRR6941594 completed mapping pipeline successfully