Starting /dee2/code/volunteer_pipeline.sh SRR6941595 current disk space = 1551282708480 free memory = 1603686560 SRR6941595 SRAfilesize 7e52c85ed5976f47d127a038e51ee46a SRR6941595.sra SRR6941595.sra file validated SRR6941595 is paired end SRR6941595 is conventional basespace SRR6941595 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941595_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.20775 33.0 33.0 34.0 30.0 34.0 2 32.6865 33.0 33.0 34.0 31.0 34.0 3 32.8915 34.0 33.0 34.0 32.0 34.0 4 33.17175 34.0 33.0 34.0 32.0 34.0 5 33.26075 34.0 33.0 34.0 33.0 34.0 6 36.97775 38.0 37.0 38.0 36.0 38.0 7 37.27975 38.0 38.0 38.0 36.0 38.0 8 37.456 38.0 38.0 38.0 37.0 38.0 9 37.55825 38.0 38.0 38.0 37.0 38.0 10-14 37.584849999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.58335 38.0 38.0 38.0 38.0 38.0 20-24 37.566950000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.53339999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5374 38.0 38.0 38.0 38.0 38.0 35-39 37.565999999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.5688 38.0 38.0 38.0 38.0 38.0 45-49 37.476200000000006 38.0 38.0 38.0 37.6 38.0 50-54 37.469899999999996 38.0 38.0 38.0 37.6 38.0 55-59 37.4576 38.0 38.0 38.0 37.2 38.0 60-64 37.4207 38.0 38.0 38.0 37.2 38.0 65-69 37.35205 38.0 38.0 38.0 37.0 38.0 70-74 37.27419999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.31855 38.0 38.0 38.0 37.0 38.0 80-84 37.23945 38.0 38.0 38.0 36.4 38.0 85-89 37.1689 38.0 38.0 38.0 36.2 38.0 90-94 37.1851 38.0 38.0 38.0 36.0 38.0 95-99 37.05165 38.0 38.0 38.0 35.8 38.0 100-104 37.0745 38.0 38.0 38.0 36.0 38.0 105-109 36.9346 38.0 38.0 38.0 35.2 38.0 110-114 36.76809999999999 38.0 38.0 38.0 35.0 38.0 115-119 36.662349999999996 38.0 38.0 38.0 34.6 38.0 120-124 36.584050000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.5677 38.0 38.0 38.0 34.4 38.0 130-134 36.33265 38.0 38.0 38.0 33.6 38.0 135-139 35.99315 38.0 36.6 38.0 33.0 38.0 140-144 35.8746 38.0 36.2 38.0 33.0 38.0 145-149 35.2669 38.0 36.0 38.0 31.4 38.0 150-151 31.455875 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 2.0 21 2.0 22 3.0 23 3.0 24 3.0 25 6.0 26 10.0 27 12.0 28 9.0 29 22.0 30 30.0 31 29.0 32 44.0 33 62.0 34 110.0 35 197.0 36 507.0 37 2944.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.81923279033106 10.24697845507094 5.990541250656857 35.943247503941144 2 22.630657664416105 12.653163290822706 35.183795948987246 29.532383095773945 3 19.225 16.075 25.900000000000002 38.800000000000004 4 25.15 24.275 21.525 29.049999999999997 5 25.025 29.9 22.975 22.1 6 22.400000000000002 31.1 24.025 22.475 7 18.35 24.5 37.775 19.375 8 19.975 23.799999999999997 29.549999999999997 26.674999999999997 9 19.975 22.05 32.85 25.124999999999996 10-14 22.97 26.735 25.974999999999998 24.32 15-19 22.37 25.545 26.5 25.585 20-24 23.115 26.045 26.155 24.685000000000002 25-29 22.225 26.51 25.4 25.865 30-34 22.485 25.924999999999997 26.085 25.505 35-39 22.48 24.845 26.41 26.265 40-44 22.68 26.365 25.69 25.264999999999997 45-49 22.925 26.06 25.56 25.455 50-54 22.86 26.11 25.525 25.505 55-59 22.425 26.185000000000002 25.745 25.645 60-64 23.419999999999998 25.82 25.869999999999997 24.89 65-69 23.080000000000002 25.585 26.0 25.335 70-74 23.402340234023402 25.352535253525353 25.537553755375537 25.70757075707571 75-79 22.550637659414853 25.66641660415104 25.93148287071768 25.851462865716428 80-84 23.544999999999998 26.11 25.650000000000002 24.695 85-89 23.055 25.835 25.61 25.5 90-94 23.580000000000002 25.635 25.6 25.185000000000002 95-99 23.24 26.035000000000004 25.745 24.98 100-104 23.669999999999998 25.575 25.86 24.895 105-109 23.59 25.81 25.785000000000004 24.815 110-114 23.38903342005203 26.25075045027016 24.919951971182712 25.440264158495097 115-119 23.29946443765954 26.312628259672653 24.68592021622704 25.701987086440763 120-124 23.265 25.89 25.135 25.71 125-129 23.3 26.939999999999998 23.905 25.855 130-134 23.175 27.275 24.279999999999998 25.27 135-139 23.525 26.0 24.545 25.929999999999996 140-144 23.54 26.840000000000003 24.15 25.47 145-149 23.494999999999997 26.174999999999997 24.38 25.95 150-151 23.875 26.8125 24.2375 25.074999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 1.5 26 1.0 27 2.0 28 3.0 29 7.0 30 9.5 31 10.5 32 15.0 33 27.0 34 37.0 35 35.5 36 56.5 37 81.0 38 88.0 39 109.0 40 137.0 41 150.0 42 171.0 43 193.0 44 197.5 45 206.5 46 218.5 47 209.5 48 182.5 49 175.0 50 171.0 51 153.0 52 130.5 53 115.5 54 112.5 55 107.0 56 98.5 57 79.0 58 74.0 59 76.0 60 60.0 61 55.0 62 56.5 63 50.0 64 48.5 65 49.0 66 43.0 67 38.5 68 33.0 69 26.5 70 20.0 71 16.0 72 15.5 73 14.5 74 10.5 75 7.5 76 5.0 77 2.0 78 2.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8500000000000005 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.025 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.06 115-119 0.105 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.6000000000000001 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.3875 0.0 0.0 0.0 0.0 92-93 1.6 0.0 0.0 0.0 0.0 94-95 1.925 0.0 0.0 0.0 0.0 96-97 2.2125000000000004 0.0 0.0 0.0 0.0 98-99 2.6625 0.0 0.0 0.0 0.0 100-101 3.15 0.0 0.0 0.0 0.0 102-103 3.6500000000000004 0.0 0.0 0.0 0.0 104-105 4.3 0.0 0.0 0.0 0.0 106-107 4.9 0.0 0.0 0.0 0.0 108-109 5.387499999999999 0.0 0.0 0.0 0.0 110-111 5.85 0.0 0.0 0.0 0.0 112-113 6.4625 0.0 0.0 0.0 0.0 114-115 7.050000000000001 0.0 0.0 0.0 0.0 116-117 7.7375 0.0 0.0 0.0 0.0 118-119 8.6125 0.0 0.0 0.0 0.0 120-121 9.2375 0.0 0.0 0.0 0.0 122-123 9.95 0.0 0.0 0.0 0.0 124-125 10.8125 0.0 0.0 0.0 0.0 126-127 11.6875 0.0 0.0 0.0 0.0 128-129 12.5 0.0 0.0 0.0 0.0 130-131 13.412500000000001 0.0 0.0 0.0 0.0 132-133 14.412500000000001 0.0 0.0 0.0 0.0 134-135 15.375 0.0 0.0 0.0 0.0 136-137 16.262500000000003 0.0 0.0 0.0 0.0 138-139 16.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6941595 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941595_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1155 33.0 33.0 34.0 33.0 34.0 2 33.199 34.0 33.0 34.0 33.0 34.0 3 33.261 34.0 33.0 34.0 33.0 34.0 4 33.26675 34.0 33.0 34.0 33.0 34.0 5 33.2165 34.0 33.0 34.0 33.0 34.0 6 37.346 38.0 38.0 38.0 37.0 38.0 7 37.4685 38.0 38.0 38.0 38.0 38.0 8 37.405 38.0 38.0 38.0 38.0 38.0 9 37.4355 38.0 38.0 38.0 38.0 38.0 10-14 37.41615 38.0 38.0 38.0 38.0 38.0 15-19 37.3928 38.0 38.0 38.0 37.8 38.0 20-24 37.380399999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.263 38.0 38.0 38.0 37.4 38.0 30-34 37.2404 38.0 38.0 38.0 37.0 38.0 35-39 37.2273 38.0 38.0 38.0 37.0 38.0 40-44 37.23405 38.0 38.0 38.0 37.0 38.0 45-49 37.291399999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.220749999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.15675 38.0 38.0 38.0 37.0 38.0 60-64 37.1484 38.0 38.0 38.0 36.8 38.0 65-69 37.0993 38.0 38.0 38.0 36.2 38.0 70-74 37.06925 38.0 38.0 38.0 36.4 38.0 75-79 36.961200000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.8335 38.0 38.0 38.0 35.6 38.0 85-89 36.8374 38.0 38.0 38.0 35.8 38.0 90-94 36.73735 38.0 38.0 38.0 35.0 38.0 95-99 36.69005 38.0 38.0 38.0 35.0 38.0 100-104 36.58725 38.0 38.0 38.0 34.6 38.0 105-109 36.34715 38.0 38.0 38.0 34.0 38.0 110-114 36.052499999999995 38.0 37.8 38.0 33.2 38.0 115-119 35.62355 38.0 36.8 38.0 31.0 38.0 120-124 35.677049999999994 38.0 36.6 38.0 31.8 38.0 125-129 35.745149999999995 38.0 36.6 38.0 32.4 38.0 130-134 35.51625 38.0 36.0 38.0 31.4 38.0 135-139 35.161950000000004 38.0 35.8 38.0 30.6 38.0 140-144 34.6457 38.0 34.8 38.0 28.0 38.0 145-149 33.69885 38.0 33.4 38.0 22.4 38.0 150-151 28.112125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 4.0 14 0.0 15 2.0 16 4.0 17 1.0 18 1.0 19 2.0 20 4.0 21 8.0 22 5.0 23 4.0 24 11.0 25 17.0 26 17.0 27 19.0 28 21.0 29 26.0 30 33.0 31 58.0 32 63.0 33 115.0 34 153.0 35 224.0 36 568.0 37 2632.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.475 20.674999999999997 9.2 28.65 2 27.775 25.624999999999996 29.15 17.45 3 22.875 25.900000000000002 28.525 22.7 4 26.6 31.6 20.150000000000002 21.65 5 27.125 33.575 20.7 18.6 6 22.6 36.425000000000004 20.1 20.875 7 22.375 20.375 35.8 21.45 8 24.325 22.55 25.75 27.375 9 23.1 23.075000000000003 27.325 26.5 10-14 24.855 27.015 23.96 24.169999999999998 15-19 25.869999999999997 25.41 24.94 23.78 20-24 24.46 26.02 25.419999999999998 24.099999999999998 25-29 25.259999999999998 25.71 25.295 23.735 30-34 25.155 25.575 25.174999999999997 24.095 35-39 24.94 25.94 25.650000000000002 23.47 40-44 25.330000000000002 25.72 25.0 23.95 45-49 25.44 25.369999999999997 25.3 23.89 50-54 25.05 25.505 25.91 23.535 55-59 26.705000000000002 25.195 25.105 22.994999999999997 60-64 25.44 25.75 25.255 23.555 65-69 25.395 25.94 25.2 23.465 70-74 26.1 26.14 24.92 22.84 75-79 25.6 25.605 25.590000000000003 23.205000000000002 80-84 25.825 25.924999999999997 24.97 23.28 85-89 25.69 26.055 25.365 22.89 90-94 25.955000000000002 25.55 25.66 22.835 95-99 25.835 25.974999999999998 25.145 23.044999999999998 100-104 26.07 25.83 25.275 22.825 105-109 26.565 25.174999999999997 25.41 22.85 110-114 26.810000000000002 25.895000000000003 24.9 22.395 115-119 26.985 25.474999999999998 25.069999999999997 22.470000000000002 120-124 27.235 26.029999999999998 24.474999999999998 22.259999999999998 125-129 26.76 25.765 25.074999999999996 22.400000000000002 130-134 27.505000000000003 25.97 24.765 21.759999999999998 135-139 27.38 25.729999999999997 24.965 21.925 140-144 28.46 25.1 24.990000000000002 21.45 145-149 28.065 25.455 25.245 21.235 150-151 27.1 26.075 24.762500000000003 22.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.5 26 3.0 27 5.5 28 9.0 29 7.5 30 6.5 31 9.0 32 12.5 33 22.0 34 33.5 35 37.5 36 47.5 37 71.5 38 86.5 39 110.5 40 130.0 41 144.0 42 168.0 43 177.0 44 178.5 45 190.0 46 206.5 47 209.0 48 187.0 49 167.5 50 156.5 51 153.5 52 143.0 53 120.0 54 102.5 55 96.5 56 103.0 57 101.5 58 94.0 59 90.5 60 82.5 61 72.5 62 70.0 63 59.5 64 54.5 65 50.5 66 41.5 67 34.5 68 28.0 69 28.0 70 26.5 71 19.0 72 14.0 73 10.5 74 8.5 75 7.0 76 3.5 77 1.5 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16540212443095 98.02499999999999 2 0.6322711178553364 1.25 3 0.15174506828528073 0.44999999999999996 4 0.0 0.0 5 0.025290844714213456 0.125 6 0.025290844714213456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.6000000000000001 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.375 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.95 0.0 0.0 0.0 0.0 96-97 2.2375 0.0 0.0 0.0 0.0 98-99 2.6875 0.0 0.0 0.0 0.0 100-101 3.1624999999999996 0.0 0.0 0.0 0.0 102-103 3.6375 0.0 0.0 0.0 0.0 104-105 4.25 0.0 0.0 0.0 0.0 106-107 4.85 0.0 0.0 0.0 0.0 108-109 5.3125 0.0 0.0 0.0 0.0 110-111 5.7625 0.0 0.0 0.0 0.0 112-113 6.3875 0.0 0.0 0.0 0.0 114-115 6.9375 0.0 0.0 0.0 0.0 116-117 7.625 0.0 0.0 0.0 0.0 118-119 8.4375 0.0 0.0 0.0 0.0 120-121 9.0625 0.0 0.0 0.0 0.0 122-123 9.775 0.0 0.0 0.0 0.0 124-125 10.65 0.0 0.0 0.0 0.0 126-127 11.525 0.0 0.0 0.0 0.0 128-129 12.3375 0.0 0.0 0.0 0.0 130-131 13.225 0.0 0.0 0.0 0.0 132-133 14.212499999999999 0.0 0.0 0.0 0.0 134-135 15.1375 0.0 0.0 0.0 0.0 136-137 16.0125 0.0 0.0 0.0 0.0 138-139 16.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGGC 10 0.006830828 145.0 5 CAGTTAG 10 0.006830828 145.0 9 GGCTTCT 10 0.006830828 145.0 9 GTTGGCT 10 0.006830828 145.0 6 TGGCTTC 10 0.006830828 145.0 8 >>END_MODULE Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra Read 1102176 spots for SRR6941595.sra Written 1102176 spots for SRR6941595.sra SRR ids: ['SRR6941595.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ceo095n3 SRR6941595.sra spots: 22043520 blocks: [[1, 1102176], [1102177, 2204352], [2204353, 3306528], [3306529, 4408704], [4408705, 5510880], [5510881, 6613056], [6613057, 7715232], [7715233, 8817408], [8817409, 9919584], [9919585, 11021760], [11021761, 12123936], [12123937, 13226112], [13226113, 14328288], [14328289, 15430464], [15430465, 16532640], [16532641, 17634816], [17634817, 18736992], [18736993, 19839168], [19839169, 20941344], [20941345, 22043520]] SRR6941595 file size 7448125 SRR6941595 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941595 SRR6941595_1.fastq SRR6941595_2.fastq Input file: SRR6941595_1.fastq Paired file: SRR6941595_2.fastq trimmed: SRR6941595-trimmed-pair1.fastq, SRR6941595-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:35:07 2024 >> started Fri Dec 6 12:35:40 2024 >> done (33.149s) 22043520 read pairs processed; of these: 11378 ( 0.05%) short read pairs filtered out after trimming by size control 8902 ( 0.04%) empty read pairs filtered out after trimming by size control 22023240 (99.91%) read pairs available; of these: 12190692 (55.35%) trimmed read pairs available after processing 9832548 (44.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 6 0.00% 20 16 0.00% 21 8 0.00% 22 9 0.00% 23 14 0.00% 24 10 0.00% 25 25 0.00% 26 26 0.00% 27 27 0.00% 28 14 0.00% 29 23 0.00% 30 23 0.00% 31 25 0.00% 32 20 0.00% 33 20 0.00% 34 34 0.00% 35 35 0.00% 36 37 0.00% 37 49 0.00% 38 48 0.00% 39 44 0.00% 40 64 0.00% 41 52 0.00% 42 59 0.00% 43 90 0.00% 44 90 0.00% 45 97 0.00% 46 102 0.00% 47 116 0.00% 48 123 0.00% 49 172 0.00% 50 180 0.00% 51 193 0.00% 52 215 0.00% 53 238 0.00% 54 299 0.00% 55 346 0.00% 56 386 0.00% 57 418 0.00% 58 521 0.00% 59 555 0.00% 60 662 0.00% 61 807 0.00% 62 1045 0.00% 63 1156 0.01% 64 1235 0.01% 65 1462 0.01% 66 1589 0.01% 67 1888 0.01% 68 2095 0.01% 69 2430 0.01% 70 2903 0.01% 71 3252 0.01% 72 3946 0.02% 73 4386 0.02% 74 5060 0.02% 75 5600 0.03% 76 6128 0.03% 77 6795 0.03% 78 7608 0.03% 79 8817 0.04% 80 9724 0.04% 81 11258 0.05% 82 12757 0.06% 83 14419 0.07% 84 16852 0.08% 85 18698 0.08% 86 20423 0.09% 87 21761 0.10% 88 23780 0.11% 89 25352 0.12% 90 27160 0.12% 91 30136 0.14% 92 32129 0.15% 93 34767 0.16% 94 37837 0.17% 95 40555 0.18% 96 42566 0.19% 97 44615 0.20% 98 46618 0.21% 99 48136 0.22% 100 52144 0.24% 101 53666 0.24% 102 57478 0.26% 103 60145 0.27% 104 62856 0.29% 105 65324 0.30% 106 67807 0.31% 107 69249 0.31% 108 70314 0.32% 109 73451 0.33% 110 75548 0.34% 111 78073 0.35% 112 81579 0.37% 113 84951 0.39% 114 86596 0.39% 115 90034 0.41% 116 92073 0.42% 117 93668 0.43% 118 95974 0.44% 119 95188 0.43% 120 97408 0.44% 121 98847 0.45% 122 100153 0.45% 123 104073 0.47% 124 107685 0.49% 125 110803 0.50% 126 111315 0.51% 127 112464 0.51% 128 113393 0.51% 129 115575 0.52% 130 115836 0.53% 131 117736 0.53% 132 121169 0.55% 133 124534 0.57% 134 127697 0.58% 135 131242 0.60% 136 134867 0.61% 137 138131 0.63% 138 140598 0.64% 139 147497 0.67% 140 150882 0.69% 141 159465 0.72% 142 170172 0.77% 143 181152 0.82% 144 199953 0.91% 145 226581 1.03% 146 266639 1.21% 147 337691 1.53% 148 477080 2.17% 149 891158 4.05% 150 4619527 20.98% 151 9832548 44.65% 22023240 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=33 prefix-density=0.57 prefix-fanout=2.4 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=77.60 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.71 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=71.46 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTT SRR6941595 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:36:23 Started mapping on | Dec 06 12:36:23 Finished on | Dec 06 12:38:26 Mapping speed, Million of reads per hour | 644.58 Number of input reads | 22023240 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 21216498 Uniquely mapped reads % | 96.34% Average mapped length | 286.76 Number of splices: Total | 21665311 Number of splices: Annotated (sjdb) | 20203949 Number of splices: GT/AG | 21365511 Number of splices: GC/AG | 267156 Number of splices: AT/AC | 11466 Number of splices: Non-canonical | 21178 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255573 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 28799 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 559249 559249 559249 N_multimapping 255573 255573 255573 N_noFeature 1052453 20534891 1318573 N_ambiguous 493847 2878 78172 UnstrandedReadsAssigned:19670198 PositiveStrandReadsAssigned:678729 NegativeStrandReadsAssigned:19819753 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=141 echo kmer=137 SRR6941595 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941595-trimmed-pair1.fastq SRR6941595-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,023,240 reads, 19,946,271 reads pseudoaligned [quant] estimated average fragment length: 226.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR6941595.ke.tsv 35125 SRR6941595.se.tsv 88098 total ==> SRR6941595.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.162 1.59514e-08 1.67855e-09 PNS24247 1044 818.596 106.887 9.7715 PNS24249 1928 1702.6 94.1768 4.1394 PNS24246 1044 818.596 106.887 9.7715 PNS24248 1044 818.596 106.887 9.7715 PNS24244 1471 1245.6 44.1617 2.65323 PNS24243 293 113.918 0 0 KQK14069 1603 1377.6 24165.5 1312.74 KQK14071 474 265.498 664.55 187.314 ==> SRR6941595.se.tsv <== BRADI_1g14170v3 28517 BRADI_1g53295v3 243 BRADI_1g59795v3 1227 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 192 BRADI_1g74790v3 130 BRADI_1g09890v3 0 BRADI_1g77505v3 447 BRADI_1g48960v3 0 SRR6941595 completed mapping pipeline successfully