Starting /dee2/code/volunteer_pipeline.sh SRR6941602 current disk space = 1551294406656 free memory = 1476509872 SRR6941602 SRAfilesize 4bca5c9a74cdadce9b1613021167e254 SRR6941602.sra SRR6941602.sra file validated SRR6941602 is paired end SRR6941602 is conventional basespace SRR6941602 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941602_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80925 34.0 33.0 34.0 32.0 34.0 2 32.94625 34.0 33.0 34.0 32.0 34.0 3 33.036 34.0 33.0 34.0 32.0 34.0 4 33.25225 34.0 33.0 34.0 32.0 34.0 5 33.3175 34.0 33.0 34.0 33.0 34.0 6 37.00075 38.0 37.0 38.0 36.0 38.0 7 37.35325 38.0 38.0 38.0 37.0 38.0 8 37.472 38.0 38.0 38.0 37.0 38.0 9 37.546 38.0 38.0 38.0 38.0 38.0 10-14 37.5779 38.0 38.0 38.0 37.8 38.0 15-19 37.56485 38.0 38.0 38.0 38.0 38.0 20-24 37.5746 38.0 38.0 38.0 38.0 38.0 25-29 37.53165 38.0 38.0 38.0 38.0 38.0 30-34 37.5143 38.0 38.0 38.0 38.0 38.0 35-39 37.56155 38.0 38.0 38.0 38.0 38.0 40-44 37.526599999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.513850000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.45895 38.0 38.0 38.0 37.4 38.0 55-59 37.4621 38.0 38.0 38.0 37.2 38.0 60-64 37.4323 38.0 38.0 38.0 37.2 38.0 65-69 37.37305 38.0 38.0 38.0 37.0 38.0 70-74 37.29725 38.0 38.0 38.0 37.0 38.0 75-79 37.3095 38.0 38.0 38.0 37.0 38.0 80-84 37.26055 38.0 38.0 38.0 37.0 38.0 85-89 37.201299999999996 38.0 38.0 38.0 36.2 38.0 90-94 37.186299999999996 38.0 38.0 38.0 36.0 38.0 95-99 37.0799 38.0 38.0 38.0 35.8 38.0 100-104 37.04705 38.0 38.0 38.0 35.6 38.0 105-109 36.92025000000001 38.0 38.0 38.0 35.2 38.0 110-114 36.7587 38.0 38.0 38.0 34.8 38.0 115-119 36.57395 38.0 38.0 38.0 34.2 38.0 120-124 36.5916 38.0 38.0 38.0 34.2 38.0 125-129 36.5281 38.0 38.0 38.0 34.0 38.0 130-134 36.40275 38.0 38.0 38.0 34.0 38.0 135-139 36.06855 38.0 37.2 38.0 33.0 38.0 140-144 36.056599999999996 38.0 37.2 38.0 33.0 38.0 145-149 35.337900000000005 38.0 36.0 38.0 31.4 38.0 150-151 31.4225 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 4.0 21 0.0 22 1.0 23 7.0 24 1.0 25 4.0 26 12.0 27 14.0 28 15.0 29 17.0 30 41.0 31 30.0 32 49.0 33 56.0 34 97.0 35 180.0 36 514.0 37 2957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.25738176117063 9.38071596550823 7.551607002874314 37.81029527044682 2 22.63631815907954 11.13056528264132 34.91745872936468 31.315657828914457 3 19.900000000000002 15.125 25.275 39.7 4 27.675 21.8 21.575 28.95 5 27.200000000000003 28.4 22.75 21.65 6 24.925 29.375 23.225 22.475 7 19.125 24.275 37.2 19.400000000000002 8 21.425 22.575 29.349999999999998 26.650000000000002 9 20.674999999999997 20.674999999999997 33.35 25.3 10-14 23.11 26.090000000000003 25.435000000000002 25.365 15-19 23.919999999999998 24.515 25.605 25.96 20-24 23.395 24.310000000000002 26.125 26.169999999999998 25-29 23.18 25.195 25.590000000000003 26.035000000000004 30-34 23.885 24.795 25.525 25.795 35-39 23.345 24.92 25.44 26.295 40-44 24.315 25.290000000000003 25.069999999999997 25.324999999999996 45-49 23.485 24.97 25.39 26.155 50-54 23.525 25.005 25.580000000000002 25.89 55-59 23.47 24.73 25.805 25.995 60-64 24.325 24.505 25.314999999999998 25.855 65-69 24.490000000000002 24.474999999999998 25.759999999999998 25.275 70-74 23.82595648912228 24.601150287571894 25.316329082270567 26.25656414103526 75-79 23.75687843921961 24.952476238119058 25.44272136068034 25.84792396198099 80-84 23.7 24.67 25.445 26.185000000000002 85-89 24.02 24.895 24.515 26.57 90-94 24.555 24.36 25.055 26.029999999999998 95-99 24.175 25.22 24.62 25.985000000000003 100-104 24.275 24.945 24.965 25.814999999999998 105-109 24.575 25.124999999999996 24.5 25.8 110-114 23.79355226271526 25.13516219463356 25.075090108129753 25.996195434521425 115-119 24.373621968330326 25.546201643615955 24.338544798556825 25.741631589496894 120-124 24.495 25.69 24.395 25.419999999999998 125-129 24.01 25.230000000000004 24.73 26.029999999999998 130-134 24.495 25.2 24.345 25.96 135-139 24.529999999999998 25.490000000000002 24.14 25.840000000000003 140-144 24.169999999999998 25.790000000000003 23.765 26.275 145-149 23.974999999999998 25.619999999999997 24.104999999999997 26.3 150-151 24.3875 25.2875 24.6 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 2.5 28 2.5 29 2.5 30 5.0 31 8.0 32 11.0 33 16.5 34 24.5 35 32.5 36 42.5 37 54.0 38 65.5 39 89.5 40 118.5 41 140.0 42 157.0 43 172.5 44 195.5 45 208.5 46 192.5 47 180.0 48 176.0 49 171.0 50 161.0 51 136.5 52 128.5 53 129.5 54 119.5 55 110.5 56 108.0 57 110.5 58 101.0 59 85.5 60 82.5 61 80.0 62 72.0 63 71.5 64 65.0 65 52.5 66 52.0 67 51.0 68 50.0 69 39.0 70 23.5 71 22.0 72 19.5 73 15.0 74 15.0 75 13.0 76 6.5 77 4.0 78 2.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.025 75-79 0.05 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.12 115-119 0.22 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.4500000000000002 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.5125 0.0 0.0 0.0 0.0 102-103 3.0625 0.0 0.0 0.0 0.0 104-105 3.3625 0.0 0.0 0.0 0.0 106-107 3.7874999999999996 0.0 0.0 0.0 0.0 108-109 4.225 0.0 0.0 0.0 0.0 110-111 4.725 0.0 0.0 0.0 0.0 112-113 5.2875 0.0 0.0 0.0 0.0 114-115 5.9125 0.0 0.0 0.0 0.0 116-117 6.4875 0.0 0.0 0.0 0.0 118-119 7.0875 0.0 0.0 0.0 0.0 120-121 7.8125 0.0 0.0 0.0 0.0 122-123 8.55 0.0 0.0 0.0 0.0 124-125 9.1 0.0 0.0 0.0 0.0 126-127 9.8 0.0 0.0 0.0 0.0 128-129 10.65 0.0 0.0 0.0 0.0 130-131 11.5875 0.0 0.0 0.0 0.0 132-133 12.5875 0.0 0.0 0.0 0.0 134-135 13.45 0.0 0.0 0.0 0.0 136-137 14.2625 0.0 0.0 0.0 0.0 138-139 15.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTCA 10 0.0060887975 150.61038 1 GTGGAGT 10 0.0060887975 150.61038 1 >>END_MODULE SRR6941602 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941602_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14325 33.0 33.0 34.0 33.0 34.0 2 33.25 34.0 33.0 34.0 33.0 34.0 3 33.305 34.0 33.0 34.0 33.0 34.0 4 33.24175 34.0 33.0 34.0 33.0 34.0 5 33.26275 34.0 33.0 34.0 33.0 34.0 6 37.4085 38.0 38.0 38.0 37.0 38.0 7 37.4645 38.0 38.0 38.0 38.0 38.0 8 37.43475 38.0 38.0 38.0 38.0 38.0 9 37.40875 38.0 38.0 38.0 38.0 38.0 10-14 37.4368 38.0 38.0 38.0 38.0 38.0 15-19 37.36805 38.0 38.0 38.0 37.8 38.0 20-24 37.3476 38.0 38.0 38.0 37.6 38.0 25-29 37.29605 38.0 38.0 38.0 37.2 38.0 30-34 37.28995 38.0 38.0 38.0 37.0 38.0 35-39 37.271 38.0 38.0 38.0 37.2 38.0 40-44 37.287549999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.30815 38.0 38.0 38.0 37.2 38.0 50-54 37.238350000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.1863 38.0 38.0 38.0 37.0 38.0 60-64 37.1529 38.0 38.0 38.0 37.0 38.0 65-69 37.086949999999995 38.0 38.0 38.0 36.4 38.0 70-74 37.103950000000005 38.0 38.0 38.0 36.4 38.0 75-79 37.0334 38.0 38.0 38.0 36.0 38.0 80-84 36.845000000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.9013 38.0 38.0 38.0 36.0 38.0 90-94 36.8498 38.0 38.0 38.0 35.6 38.0 95-99 36.76775 38.0 38.0 38.0 35.2 38.0 100-104 36.652049999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.442699999999995 38.0 38.0 38.0 34.2 38.0 110-114 36.05455 38.0 38.0 38.0 33.4 38.0 115-119 35.72685 38.0 36.8 38.0 31.8 38.0 120-124 35.68365 38.0 36.6 38.0 31.6 38.0 125-129 35.824549999999995 38.0 37.2 38.0 32.6 38.0 130-134 35.720299999999995 38.0 36.8 38.0 31.4 38.0 135-139 35.290800000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.81095 38.0 35.6 38.0 29.4 38.0 145-149 33.69755 38.0 33.8 38.0 22.6 38.0 150-151 28.191625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 3.0 14 2.0 15 1.0 16 2.0 17 3.0 18 5.0 19 2.0 20 5.0 21 2.0 22 5.0 23 4.0 24 8.0 25 15.0 26 7.0 27 21.0 28 18.0 29 32.0 30 33.0 31 48.0 32 66.0 33 84.0 34 127.0 35 231.0 36 593.0 37 2670.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 18.175 10.15 31.275 2 28.449999999999996 24.5 26.450000000000003 20.599999999999998 3 22.525000000000002 25.0 26.900000000000002 25.575 4 27.650000000000002 29.549999999999997 20.8 22.0 5 28.225 32.625 19.15 20.0 6 23.075000000000003 36.375 19.025 21.525 7 22.900000000000002 19.175 33.7 24.224999999999998 8 22.900000000000002 24.325 24.7 28.075 9 24.85 21.75 28.125 25.275 10-14 26.0 26.435 23.005 24.560000000000002 15-19 25.845000000000002 24.69 24.5 24.965 20-24 26.205000000000002 25.09 24.12 24.585 25-29 25.915 25.255 24.3 24.529999999999998 30-34 26.045 25.295 24.01 24.65 35-39 26.115 25.405 24.145 24.335 40-44 26.36 24.490000000000002 24.25 24.9 45-49 26.325 25.06 24.305 24.310000000000002 50-54 25.974999999999998 25.44 24.175 24.41 55-59 26.25 24.740000000000002 24.01 25.0 60-64 26.174999999999997 25.145 23.615 25.064999999999998 65-69 25.924999999999997 24.875 24.625 24.575 70-74 26.3 24.72 24.215 24.765 75-79 25.924999999999997 24.63 24.455 24.990000000000002 80-84 25.305 25.585 24.42 24.69 85-89 26.07 24.89 24.52 24.52 90-94 25.874999999999996 25.085 24.47 24.57 95-99 26.615 25.405 23.73 24.25 100-104 26.455000000000002 24.84 24.495 24.21 105-109 26.740000000000002 25.455 24.33 23.474999999999998 110-114 27.29 25.895000000000003 23.47 23.345 115-119 27.215 26.11 23.25 23.425 120-124 27.345000000000002 25.865 23.7 23.09 125-129 27.775 26.075 23.494999999999997 22.655 130-134 28.585 25.669999999999998 23.294999999999998 22.45 135-139 28.110000000000003 26.39 23.665 21.834999999999997 140-144 29.26 26.009999999999998 23.474999999999998 21.255 145-149 29.28 25.990000000000002 23.45 21.279999999999998 150-151 29.4125 25.85 23.3375 21.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.5 28 3.0 29 2.5 30 7.0 31 9.5 32 7.5 33 13.5 34 20.5 35 25.5 36 41.5 37 49.0 38 62.5 39 90.0 40 109.0 41 134.5 42 149.0 43 151.5 44 168.0 45 172.0 46 172.0 47 186.0 48 186.5 49 183.0 50 161.0 51 136.5 52 127.0 53 123.0 54 128.5 55 121.0 56 109.5 57 109.0 58 104.5 59 94.5 60 88.5 61 75.0 62 81.5 63 88.0 64 69.0 65 65.0 66 66.5 67 59.0 68 46.0 69 35.0 70 35.5 71 37.5 72 29.5 73 20.0 74 16.5 75 10.0 76 3.0 77 2.5 78 3.5 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80437547697787 97.1 2 0.9157975069956754 1.7999999999999998 3 0.17807173747138133 0.525 4 0.05087763927753752 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02543881963876876 0.17500000000000002 8 0.02543881963876876 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 8 0.2 No Hit GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.4500000000000002 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.4875 0.0 0.0 0.0 0.0 102-103 3.0125 0.0 0.0 0.0 0.0 104-105 3.3375 0.0 0.0 0.0 0.0 106-107 3.7625 0.0 0.0 0.0 0.0 108-109 4.199999999999999 0.0 0.0 0.0 0.0 110-111 4.737500000000001 0.0 0.0 0.0 0.0 112-113 5.300000000000001 0.0 0.0 0.0 0.0 114-115 5.9375 0.0 0.0 0.0 0.0 116-117 6.5375 0.0 0.0 0.0 0.0 118-119 7.125 0.0 0.0 0.0 0.0 120-121 7.8125 0.0 0.0 0.0 0.0 122-123 8.55 0.0 0.0 0.0 0.0 124-125 9.1 0.0 0.0 0.0 0.0 126-127 9.774999999999999 0.0 0.0 0.0 0.0 128-129 10.662500000000001 0.0 0.0 0.0 0.0 130-131 11.5875 0.0 0.0 0.0 0.0 132-133 12.5875 0.0 0.0 0.0 0.0 134-135 13.4375 0.0 0.0 0.0 0.0 136-137 14.2375 0.0 0.0 0.0 0.0 138-139 15.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009815 spots for SRR6941602.sra Written 1009815 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra Read 1009800 spots for SRR6941602.sra Written 1009800 spots for SRR6941602.sra SRR ids: ['SRR6941602.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0yr6d2w8 SRR6941602.sra spots: 20196015 blocks: [[1, 1009800], [1009801, 2019600], [2019601, 3029400], [3029401, 4039200], [4039201, 5049000], [5049001, 6058800], [6058801, 7068600], [7068601, 8078400], [8078401, 9088200], [9088201, 10098000], [10098001, 11107800], [11107801, 12117600], [12117601, 13127400], [13127401, 14137200], [14137201, 15147000], [15147001, 16156800], [16156801, 17166600], [17166601, 18176400], [18176401, 19186200], [19186201, 20196015]] SRR6941602 file size 6822066 SRR6941602 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941602 SRR6941602_1.fastq SRR6941602_2.fastq Input file: SRR6941602_1.fastq Paired file: SRR6941602_2.fastq trimmed: SRR6941602-trimmed-pair1.fastq, SRR6941602-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:50:23 2024 >> started Fri Dec 6 12:54:17 2024 >> done (234.566s) 20196015 read pairs processed; of these: 9487 ( 0.05%) short read pairs filtered out after trimming by size control 7202 ( 0.04%) empty read pairs filtered out after trimming by size control 20179326 (99.92%) read pairs available; of these: 10727136 (53.16%) trimmed read pairs available after processing 9452190 (46.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 6 0.00% 21 15 0.00% 22 14 0.00% 23 19 0.00% 24 14 0.00% 25 12 0.00% 26 11 0.00% 27 10 0.00% 28 21 0.00% 29 17 0.00% 30 16 0.00% 31 18 0.00% 32 15 0.00% 33 20 0.00% 34 29 0.00% 35 23 0.00% 36 23 0.00% 37 25 0.00% 38 26 0.00% 39 33 0.00% 40 43 0.00% 41 44 0.00% 42 30 0.00% 43 62 0.00% 44 50 0.00% 45 66 0.00% 46 87 0.00% 47 95 0.00% 48 100 0.00% 49 129 0.00% 50 125 0.00% 51 163 0.00% 52 207 0.00% 53 208 0.00% 54 213 0.00% 55 271 0.00% 56 339 0.00% 57 379 0.00% 58 396 0.00% 59 514 0.00% 60 598 0.00% 61 664 0.00% 62 774 0.00% 63 914 0.00% 64 1145 0.01% 65 1205 0.01% 66 1415 0.01% 67 1651 0.01% 68 1790 0.01% 69 2007 0.01% 70 2521 0.01% 71 2842 0.01% 72 3267 0.02% 73 3759 0.02% 74 4227 0.02% 75 4747 0.02% 76 5366 0.03% 77 6023 0.03% 78 6609 0.03% 79 7547 0.04% 80 8543 0.04% 81 9632 0.05% 82 10794 0.05% 83 11920 0.06% 84 13939 0.07% 85 15640 0.08% 86 16615 0.08% 87 17770 0.09% 88 19543 0.10% 89 20942 0.10% 90 22349 0.11% 91 24630 0.12% 92 26133 0.13% 93 27960 0.14% 94 30361 0.15% 95 32632 0.16% 96 34080 0.17% 97 35939 0.18% 98 37509 0.19% 99 39059 0.19% 100 41427 0.21% 101 43117 0.21% 102 45375 0.22% 103 47562 0.24% 104 49027 0.24% 105 51354 0.25% 106 53551 0.27% 107 54252 0.27% 108 56550 0.28% 109 59036 0.29% 110 60211 0.30% 111 61732 0.31% 112 63961 0.32% 113 65795 0.33% 114 68511 0.34% 115 71044 0.35% 116 72288 0.36% 117 74911 0.37% 118 76263 0.38% 119 75988 0.38% 120 77976 0.39% 121 79160 0.39% 122 80316 0.40% 123 83480 0.41% 124 85930 0.43% 125 89023 0.44% 126 89660 0.44% 127 90660 0.45% 128 91877 0.46% 129 94363 0.47% 130 95642 0.47% 131 97203 0.48% 132 99913 0.50% 133 103231 0.51% 134 105472 0.52% 135 109144 0.54% 136 111685 0.55% 137 114913 0.57% 138 117187 0.58% 139 123948 0.61% 140 128462 0.64% 141 135191 0.67% 142 145795 0.72% 143 156630 0.78% 144 173093 0.86% 145 196657 0.97% 146 232093 1.15% 147 297360 1.47% 148 426667 2.11% 149 809780 4.01% 150 4373702 21.67% 151 9452190 46.84% 20179326 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=22 prefix-density=0.74 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=164.57 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=17.1 sequence=CGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=18 prefix-density=0.42 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=44.18 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=4.2 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6941602 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:59:21 Started mapping on | Dec 06 12:59:22 Finished on | Dec 06 13:24:07 Mapping speed, Million of reads per hour | 48.92 Number of input reads | 20179326 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 19508557 Uniquely mapped reads % | 96.68% Average mapped length | 288.38 Number of splices: Total | 20984102 Number of splices: Annotated (sjdb) | 19679740 Number of splices: GT/AG | 20715209 Number of splices: GC/AG | 242695 Number of splices: AT/AC | 7957 Number of splices: Non-canonical | 18241 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196692 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 31698 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 480436 480436 480436 N_multimapping 196692 196692 196692 N_noFeature 735447 18925553 949376 N_ambiguous 436530 2385 68842 UnstrandedReadsAssigned:18336580 PositiveStrandReadsAssigned:580619 NegativeStrandReadsAssigned:18490339 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR6941602 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941602-trimmed-pair1.fastq SRR6941602-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,179,326 reads, 18,554,766 reads pseudoaligned [quant] estimated average fragment length: 228.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,284 rounds 52973 SRR6941602.ke.tsv 35125 SRR6941602.se.tsv 88098 total ==> SRR6941602.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.156 0 0 PNS24247 1044 816.678 55.9571 5.56747 PNS24249 1928 1700.68 68.7814 3.28626 PNS24246 1044 816.678 55.9571 5.56747 PNS24248 1044 816.678 55.9571 5.56747 PNS24244 1471 1243.68 14.3474 0.937388 PNS24243 293 110.154 0 0 KQK14069 1603 1375.68 4543.83 268.385 KQK14071 474 260.813 94.9224 29.5728 ==> SRR6941602.se.tsv <== BRADI_1g14170v3 5157 BRADI_1g53295v3 300 BRADI_1g59795v3 233 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 262 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 203 BRADI_1g48960v3 0 SRR6941602 completed mapping pipeline successfully