Starting /dee2/code/volunteer_pipeline.sh SRR6941612 current disk space = 1551167180800 free memory = 1601076416 SRR6941612 SRAfilesize 90b5f32e8b8d280d0949f3cad643f14b SRR6941612.sra SRR6941612.sra file validated SRR6941612 is paired end SRR6941612 is conventional basespace SRR6941612 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941612_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.543 34.0 33.0 34.0 32.0 34.0 2 33.1535 34.0 33.0 34.0 32.0 34.0 3 33.26275 34.0 33.0 34.0 32.0 34.0 4 33.23725 34.0 33.0 34.0 32.0 34.0 5 33.3425 34.0 33.0 34.0 33.0 34.0 6 37.1155 38.0 37.0 38.0 36.0 38.0 7 37.3685 38.0 38.0 38.0 37.0 38.0 8 37.44125 38.0 38.0 38.0 37.0 38.0 9 37.52175 38.0 38.0 38.0 38.0 38.0 10-14 37.5122 38.0 38.0 38.0 38.0 38.0 15-19 37.46345 38.0 38.0 38.0 37.6 38.0 20-24 37.4327 38.0 38.0 38.0 37.8 38.0 25-29 37.3353 38.0 38.0 38.0 37.0 38.0 30-34 37.326350000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.32045 38.0 38.0 38.0 37.0 38.0 40-44 37.40565 38.0 38.0 38.0 37.2 38.0 45-49 37.409000000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.31405 38.0 38.0 38.0 37.0 38.0 55-59 37.31985 38.0 38.0 38.0 37.0 38.0 60-64 37.2719 38.0 38.0 38.0 36.8 38.0 65-69 36.998 38.0 38.0 38.0 35.8 38.0 70-74 37.04440000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.17105 38.0 38.0 38.0 36.0 38.0 80-84 37.10805 38.0 38.0 38.0 36.0 38.0 85-89 36.9212 38.0 38.0 38.0 35.6 38.0 90-94 36.8803 38.0 38.0 38.0 35.2 38.0 95-99 36.893699999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.79965 38.0 38.0 38.0 34.8 38.0 105-109 36.43945 38.0 38.0 38.0 34.0 38.0 110-114 36.30114999999999 38.0 38.0 38.0 33.6 38.0 115-119 36.332899999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.337 38.0 38.0 38.0 33.8 38.0 125-129 36.3103 38.0 38.0 38.0 33.8 38.0 130-134 36.162349999999996 38.0 37.8 38.0 33.4 38.0 135-139 35.95435 38.0 36.6 38.0 32.8 38.0 140-144 35.66995000000001 38.0 36.0 38.0 32.2 38.0 145-149 35.11300000000001 38.0 36.0 38.0 31.0 38.0 150-151 31.16725 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 8.0 23 3.0 24 9.0 25 6.0 26 10.0 27 13.0 28 34.0 29 22.0 30 38.0 31 50.0 32 63.0 33 81.0 34 127.0 35 188.0 36 515.0 37 2827.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.14614793959559 10.903506526746865 6.168415664192476 35.78192986946506 2 20.875 13.200000000000001 36.3 29.625 3 19.579894973743436 18.02950737684421 25.656414103525883 36.734183545886474 4 26.025 25.624999999999996 21.425 26.924999999999997 5 25.074999999999996 29.175 24.575 21.175 6 23.1 33.675 22.5 20.724999999999998 7 18.025 24.125 37.775 20.075000000000003 8 20.525 22.25 29.45 27.775 9 19.1 21.175 33.2 26.525 10-14 22.295 26.939999999999998 25.324999999999996 25.44 15-19 22.856142807140355 26.001300065003253 25.67128356417821 25.47127356367818 20-24 22.575 26.395000000000003 26.095000000000002 24.935 25-29 22.505 26.22 26.155 25.119999999999997 30-34 22.615 26.1 25.840000000000003 25.445 35-39 22.58225822582258 25.542554255425543 26.46264626462646 25.412541254125415 40-44 22.97 25.895000000000003 25.305 25.83 45-49 22.53 25.61 26.11 25.75 50-54 23.05 25.355 26.51 25.085 55-59 23.21 25.655 25.745 25.39 60-64 23.005 25.074999999999996 26.115 25.805 65-69 23.075000000000003 25.324999999999996 25.995 25.605 70-74 23.141157057852894 26.426321316065803 25.27626381319066 25.156257812890644 75-79 23.54 25.435000000000002 25.674999999999997 25.35 80-84 23.32233223322332 25.417541754175417 26.047604760476045 25.212521252125214 85-89 23.425 25.374999999999996 25.88 25.319999999999997 90-94 23.330000000000002 25.045 25.974999999999998 25.650000000000002 95-99 23.23 26.015 25.77 24.985 100-104 23.248136847896763 26.544290501675587 24.968739058670536 25.238833591757114 105-109 23.65 26.19 24.715 25.445 110-114 23.588689461546174 26.18068785721448 24.832046525619173 25.398576155620173 115-119 24.095481158985137 26.282339988990643 25.07631486763749 24.545863984386727 120-124 23.11771474310871 25.919255590574814 24.993746560608336 25.96928310570814 125-129 23.145 26.63 25.105 25.119999999999997 130-134 23.544999999999998 25.290000000000003 25.105 26.06 135-139 23.465 26.135 24.845 25.555 140-144 23.055 26.369999999999997 24.905 25.669999999999998 145-149 23.05 26.200000000000003 25.235000000000003 25.515 150-151 22.8625 26.3 24.587500000000002 26.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 3.5 28 4.0 29 5.0 30 9.0 31 13.5 32 18.0 33 23.5 34 30.0 35 40.0 36 52.5 37 70.5 38 92.5 39 108.0 40 116.0 41 143.0 42 182.5 43 190.5 44 197.5 45 221.0 46 232.5 47 226.0 48 204.0 49 172.0 50 160.0 51 145.5 52 122.0 53 118.5 54 109.0 55 108.0 56 92.0 57 72.0 58 75.0 59 67.0 60 62.5 61 64.5 62 55.5 63 50.0 64 51.0 65 47.0 66 43.0 67 41.0 68 38.0 69 27.5 70 18.5 71 18.0 72 16.5 73 13.5 74 9.5 75 8.0 76 5.5 77 1.5 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.27 115-119 0.08499999999999999 120-124 0.055 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.3 0.0 0.0 0.0 0.0 104-105 2.7125 0.0 0.0 0.0 0.0 106-107 3.1375 0.0 0.0 0.0 0.0 108-109 3.6875 0.0 0.0 0.0 0.0 110-111 4.1625 0.0 0.0 0.0 0.0 112-113 4.550000000000001 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.4125 0.0 0.0 0.0 0.0 118-119 6.025 0.0 0.0 0.0 0.0 120-121 6.6 0.0 0.0 0.0 0.0 122-123 7.0125 0.0 0.0 0.0 0.0 124-125 7.425000000000001 0.0 0.0 0.0 0.0 126-127 8.1125 0.0 0.0 0.0 0.0 128-129 8.9125 0.0 0.0 0.0 0.0 130-131 9.575 0.0 0.0 0.0 0.0 132-133 10.225 0.0 0.0 0.0 0.0 134-135 10.925 0.0 0.0 0.0 0.0 136-137 11.6 0.0 0.0 0.0 0.0 138-139 12.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6941612 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941612_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87275 33.0 33.0 34.0 32.0 34.0 2 33.001 34.0 33.0 34.0 32.0 34.0 3 33.02475 34.0 33.0 34.0 32.0 34.0 4 32.9925 34.0 33.0 34.0 32.0 34.0 5 33.04775 34.0 33.0 34.0 32.0 34.0 6 37.27725 38.0 38.0 38.0 37.0 38.0 7 37.20275 38.0 38.0 38.0 37.0 38.0 8 37.2005 38.0 38.0 38.0 37.0 38.0 9 37.187 38.0 38.0 38.0 37.0 38.0 10-14 37.135299999999994 38.0 38.0 38.0 36.8 38.0 15-19 37.15595 38.0 38.0 38.0 37.0 38.0 20-24 37.116200000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.10809999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.12835 38.0 38.0 38.0 36.8 38.0 35-39 37.033699999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.06825 38.0 38.0 38.0 36.4 38.0 45-49 37.05335 38.0 38.0 38.0 36.6 38.0 50-54 37.04655 38.0 38.0 38.0 36.4 38.0 55-59 36.93165 38.0 38.0 38.0 36.0 38.0 60-64 36.8459 38.0 38.0 38.0 35.8 38.0 65-69 36.747049999999994 38.0 38.0 38.0 35.2 38.0 70-74 36.82245 38.0 38.0 38.0 35.6 38.0 75-79 36.76965 38.0 38.0 38.0 35.0 38.0 80-84 36.657300000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.6831 38.0 38.0 38.0 35.0 38.0 90-94 36.62155 38.0 38.0 38.0 35.0 38.0 95-99 36.35515 38.0 38.0 38.0 34.0 38.0 100-104 36.2383 38.0 38.0 38.0 34.0 38.0 105-109 35.89005 38.0 37.8 38.0 32.0 38.0 110-114 35.311400000000006 38.0 36.2 38.0 29.2 38.0 115-119 35.415150000000004 38.0 36.2 38.0 29.8 38.0 120-124 35.166549999999994 38.0 35.8 38.0 28.8 38.0 125-129 35.1671 38.0 36.0 38.0 28.6 38.0 130-134 35.078149999999994 38.0 36.0 38.0 28.6 38.0 135-139 34.733599999999996 38.0 35.2 38.0 28.6 38.0 140-144 34.022099999999995 38.0 33.2 38.0 24.2 38.0 145-149 32.78325 38.0 33.0 38.0 14.4 38.0 150-151 27.130375 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 1.0 11 0.0 12 0.0 13 4.0 14 2.0 15 1.0 16 4.0 17 2.0 18 2.0 19 11.0 20 4.0 21 6.0 22 6.0 23 7.0 24 12.0 25 23.0 26 29.0 27 26.0 28 22.0 29 39.0 30 54.0 31 62.0 32 83.0 33 112.0 34 178.0 35 270.0 36 592.0 37 2435.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.1 18.075 9.700000000000001 28.125 2 28.575 24.3 27.950000000000003 19.175 3 22.375 24.525 29.525000000000002 23.575 4 26.174999999999997 30.75 21.625 21.45 5 26.25 33.375 20.849999999999998 19.525000000000002 6 22.85 35.15 21.475 20.525 7 22.6 19.45 34.8 23.150000000000002 8 23.775 22.675 25.85 27.700000000000003 9 23.1 23.275000000000002 26.700000000000003 26.924999999999997 10-14 26.029999999999998 26.68 23.43 23.86 15-19 25.6 25.305 24.535 24.560000000000002 20-24 25.929999999999996 25.740000000000002 24.529999999999998 23.799999999999997 25-29 25.085 25.445 25.845000000000002 23.625 30-34 25.155 25.83 24.785 24.23 35-39 24.945 25.619999999999997 25.264999999999997 24.169999999999998 40-44 25.045 25.374999999999996 25.25 24.33 45-49 25.314999999999998 25.535000000000004 25.240000000000002 23.91 50-54 25.28 25.480000000000004 25.195 24.044999999999998 55-59 26.375 25.16 25.259999999999998 23.205000000000002 60-64 25.580000000000002 25.205 25.465 23.75 65-69 25.705 26.169999999999998 24.6 23.525 70-74 25.595000000000002 26.11 25.16 23.135 75-79 25.564999999999998 24.69 25.745 24.0 80-84 25.6588488273241 25.948892333850075 24.59868980347052 23.793569035355304 85-89 25.745 26.185000000000002 24.88 23.189999999999998 90-94 25.15 25.240000000000002 25.525 24.085 95-99 25.406270313515677 25.766288314415718 25.146257312865643 23.68118405920296 100-104 26.105 26.14 24.67 23.085 105-109 25.72 25.485000000000003 25.430000000000003 23.365 110-114 26.235000000000003 25.919999999999998 24.67 23.175 115-119 26.57 26.755000000000003 24.385 22.29 120-124 26.715 25.900000000000002 24.834999999999997 22.55 125-129 26.995 26.125 24.54 22.34 130-134 27.346367318365917 25.371268563428174 25.151257562878143 22.13110655532777 135-139 27.341367068353417 26.056302815140757 25.191259562978146 21.411070553527676 140-144 27.183154946483945 25.812743823146945 25.042512753826145 21.96158847654296 145-149 27.734707147501624 25.764017406092133 25.018756564797677 21.482518881608563 150-151 28.3875 24.875 24.975 21.762500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 0.5 25 1.0 26 3.0 27 3.0 28 5.0 29 8.5 30 9.0 31 12.5 32 17.0 33 21.5 34 29.5 35 35.5 36 41.0 37 60.0 38 86.5 39 110.0 40 129.0 41 143.5 42 161.0 43 182.0 44 182.0 45 187.0 46 195.0 47 200.5 48 189.0 49 170.0 50 163.5 51 146.5 52 122.0 53 106.5 54 108.0 55 105.0 56 106.5 57 100.5 58 81.0 59 78.5 60 83.0 61 75.5 62 68.0 63 66.0 64 63.5 65 55.5 66 50.5 67 43.0 68 41.5 69 37.0 70 27.5 71 21.5 72 16.0 73 13.0 74 9.0 75 6.5 76 5.5 77 4.0 78 3.0 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.03 145-149 0.034999999999999996 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19151086407277 98.15 2 0.6568974229408793 1.3 3 0.07579585649317837 0.22499999999999998 4 0.05053057099545225 0.2 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTACGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.3 0.0 0.0 0.0 0.0 104-105 2.7125 0.0 0.0 0.0 0.0 106-107 3.1375 0.0 0.0 0.0 0.0 108-109 3.7 0.0 0.0 0.0 0.0 110-111 4.15 0.0 0.0 0.0 0.0 112-113 4.5375 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.4375 0.0 0.0 0.0 0.0 118-119 6.050000000000001 0.0 0.0 0.0 0.0 120-121 6.625 0.0 0.0 0.0 0.0 122-123 7.0375 0.0 0.0 0.0 0.0 124-125 7.4875 0.0 0.0 0.0 0.0 126-127 8.1375 0.0 0.0 0.0 0.0 128-129 8.925 0.0 0.0 0.0 0.0 130-131 9.6 0.0 0.0 0.0 0.0 132-133 10.225 0.0 0.0 0.0 0.0 134-135 10.8625 0.0 0.0 0.0 0.0 136-137 11.4875 0.0 0.0 0.0 0.0 138-139 12.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCAAG 10 0.006830828 145.0 4 >>END_MODULE Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104612 spots for SRR6941612.sra Written 1104612 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra Read 1104611 spots for SRR6941612.sra Written 1104611 spots for SRR6941612.sra SRR ids: ['SRR6941612.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vpkm1wlo SRR6941612.sra spots: 22092221 blocks: [[1, 1104611], [1104612, 2209222], [2209223, 3313833], [3313834, 4418444], [4418445, 5523055], [5523056, 6627666], [6627667, 7732277], [7732278, 8836888], [8836889, 9941499], [9941500, 11046110], [11046111, 12150721], [12150722, 13255332], [13255333, 14359943], [14359944, 15464554], [15464555, 16569165], [16569166, 17673776], [17673777, 18778387], [18778388, 19882998], [19882999, 20987609], [20987610, 22092221]] SRR6941612 file size 7464628 SRR6941612 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941612 SRR6941612_1.fastq SRR6941612_2.fastq Input file: SRR6941612_1.fastq Paired file: SRR6941612_2.fastq trimmed: SRR6941612-trimmed-pair1.fastq, SRR6941612-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:12:04 2024 >> started Fri Dec 6 13:12:29 2024 >> done (24.746s) 22092221 read pairs processed; of these: 16071 ( 0.07%) short read pairs filtered out after trimming by size control 13217 ( 0.06%) empty read pairs filtered out after trimming by size control 22062933 (99.87%) read pairs available; of these: 11654463 (52.82%) trimmed read pairs available after processing 10408470 (47.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 12 0.00% 20 8 0.00% 21 13 0.00% 22 14 0.00% 23 12 0.00% 24 15 0.00% 25 18 0.00% 26 11 0.00% 27 18 0.00% 28 19 0.00% 29 16 0.00% 30 17 0.00% 31 24 0.00% 32 14 0.00% 33 11 0.00% 34 13 0.00% 35 27 0.00% 36 27 0.00% 37 29 0.00% 38 30 0.00% 39 33 0.00% 40 49 0.00% 41 55 0.00% 42 66 0.00% 43 73 0.00% 44 78 0.00% 45 65 0.00% 46 83 0.00% 47 98 0.00% 48 131 0.00% 49 122 0.00% 50 160 0.00% 51 177 0.00% 52 211 0.00% 53 236 0.00% 54 267 0.00% 55 298 0.00% 56 319 0.00% 57 333 0.00% 58 444 0.00% 59 513 0.00% 60 583 0.00% 61 661 0.00% 62 796 0.00% 63 943 0.00% 64 1035 0.00% 65 1138 0.01% 66 1286 0.01% 67 1450 0.01% 68 1645 0.01% 69 1830 0.01% 70 2269 0.01% 71 2626 0.01% 72 3057 0.01% 73 3484 0.02% 74 3904 0.02% 75 4291 0.02% 76 4752 0.02% 77 5149 0.02% 78 5797 0.03% 79 6612 0.03% 80 7323 0.03% 81 8365 0.04% 82 9796 0.04% 83 10839 0.05% 84 12554 0.06% 85 13955 0.06% 86 14796 0.07% 87 15672 0.07% 88 16791 0.08% 89 17768 0.08% 90 18969 0.09% 91 20796 0.09% 92 22641 0.10% 93 24821 0.11% 94 26644 0.12% 95 27953 0.13% 96 29751 0.13% 97 30606 0.14% 98 31553 0.14% 99 33092 0.15% 100 34918 0.16% 101 37045 0.17% 102 39041 0.18% 103 41454 0.19% 104 43174 0.20% 105 45255 0.21% 106 46582 0.21% 107 46978 0.21% 108 48332 0.22% 109 50389 0.23% 110 51429 0.23% 111 53571 0.24% 112 55899 0.25% 113 58588 0.27% 114 61179 0.28% 115 62902 0.29% 116 64811 0.29% 117 65885 0.30% 118 66406 0.30% 119 66975 0.30% 120 68359 0.31% 121 70510 0.32% 122 72221 0.33% 123 75571 0.34% 124 79979 0.36% 125 80788 0.37% 126 82915 0.38% 127 84820 0.38% 128 85633 0.39% 129 88192 0.40% 130 89480 0.41% 131 91551 0.41% 132 95224 0.43% 133 99979 0.45% 134 103664 0.47% 135 108801 0.49% 136 113338 0.51% 137 116962 0.53% 138 121867 0.55% 139 130500 0.59% 140 136230 0.62% 141 145694 0.66% 142 160025 0.73% 143 176436 0.80% 144 203214 0.92% 145 235711 1.07% 146 284793 1.29% 147 368607 1.67% 148 525151 2.38% 149 999225 4.53% 150 5066045 22.96% 151 10408470 47.18% 22062933 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=31 prefix-density=0.41 prefix-fanout=2.4 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=127.45 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=11.5 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGTAACCGGAACCGAGGACTAGTGAGGGGGAGGAGAAGCCAACCCACC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.5 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=140.90 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=17.6 sequence=AAGAAGAAGGTCGCGGGCGCCTCTGCGGAGATCCTGGACTCCGCCTCCGCCTACGCCAAGCTGGAGGACAAGCCGGTGGGGCAGTACATGGAGAAGGCCGAGGTGTAC SRR6941612 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:13:22 Started mapping on | Dec 06 13:13:22 Finished on | Dec 06 13:16:38 Mapping speed, Million of reads per hour | 405.24 Number of input reads | 22062933 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 20799176 Uniquely mapped reads % | 94.27% Average mapped length | 289.51 Number of splices: Total | 22119100 Number of splices: Annotated (sjdb) | 20742683 Number of splices: GT/AG | 21770695 Number of splices: GC/AG | 268235 Number of splices: AT/AC | 11119 Number of splices: Non-canonical | 69051 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.51 Insertion rate per base | 0.03% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383859 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 30539 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 890949 890949 890949 N_multimapping 383859 383859 383859 N_noFeature 1010603 20110251 1274201 N_ambiguous 504620 3280 78852 UnstrandedReadsAssigned:19283953 PositiveStrandReadsAssigned:685645 NegativeStrandReadsAssigned:19446123 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6941612 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941612-trimmed-pair1.fastq SRR6941612-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,062,933 reads, 19,509,074 reads pseudoaligned [quant] estimated average fragment length: 238.03 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR6941612.ke.tsv 35125 SRR6941612.se.tsv 88098 total ==> SRR6941612.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.359 0 0 PNS24247 1044 806.97 133.857 12.7789 PNS24249 1928 1690.97 82.1446 3.74242 PNS24246 1044 806.97 133.857 12.7789 PNS24248 1044 806.97 133.857 12.7789 PNS24244 1471 1233.97 117.285 7.32229 PNS24243 293 103.016 0 0 KQK14069 1603 1365.97 15583.3 878.878 KQK14071 474 251.072 342.014 104.943 ==> SRR6941612.se.tsv <== BRADI_1g14170v3 18462 BRADI_1g53295v3 1177 BRADI_1g59795v3 1089 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 415 BRADI_1g74790v3 59 BRADI_1g09890v3 0 BRADI_1g77505v3 491 BRADI_1g48960v3 0 SRR6941612 completed mapping pipeline successfully