Starting /dee2/code/volunteer_pipeline.sh SRR6941614 current disk space = 1551032602624 free memory = 1598481788 SRR6941614 SRAfilesize fb57d192046682918805c272648ee0f6 SRR6941614.sra SRR6941614.sra file validated SRR6941614 is paired end SRR6941614 is conventional basespace SRR6941614 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941614_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4805 34.0 33.0 34.0 32.0 34.0 2 33.01825 34.0 33.0 34.0 32.0 34.0 3 33.07875 34.0 33.0 34.0 32.0 34.0 4 33.18075 34.0 33.0 34.0 32.0 34.0 5 33.2805 34.0 33.0 34.0 33.0 34.0 6 37.0345 38.0 37.0 38.0 36.0 38.0 7 37.4145 38.0 38.0 38.0 37.0 38.0 8 37.4835 38.0 38.0 38.0 38.0 38.0 9 37.4715 38.0 38.0 38.0 38.0 38.0 10-14 37.48485 38.0 38.0 38.0 37.8 38.0 15-19 37.479600000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.4418 38.0 38.0 38.0 37.4 38.0 25-29 37.31575 38.0 38.0 38.0 37.0 38.0 30-34 37.33995 38.0 38.0 38.0 37.0 38.0 35-39 37.35745000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.404250000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.40495 38.0 38.0 38.0 37.2 38.0 50-54 37.35379999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.353649999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.2821 38.0 38.0 38.0 37.0 38.0 65-69 36.9709 38.0 38.0 38.0 36.0 38.0 70-74 37.040150000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.1579 38.0 38.0 38.0 36.0 38.0 80-84 37.08215 38.0 38.0 38.0 36.0 38.0 85-89 36.9339 38.0 38.0 38.0 35.6 38.0 90-94 36.96375 38.0 38.0 38.0 35.6 38.0 95-99 36.90865000000001 38.0 38.0 38.0 35.4 38.0 100-104 36.833549999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.491249999999994 38.0 38.0 38.0 34.2 38.0 110-114 36.30495 38.0 38.0 38.0 33.8 38.0 115-119 36.36115 38.0 38.0 38.0 34.0 38.0 120-124 36.31415 38.0 38.0 38.0 33.8 38.0 125-129 36.284299999999995 38.0 38.0 38.0 33.6 38.0 130-134 36.1334 38.0 38.0 38.0 33.6 38.0 135-139 35.98075 38.0 37.4 38.0 33.0 38.0 140-144 35.61385 38.0 36.0 38.0 32.4 38.0 145-149 35.0118 38.0 36.0 38.0 30.6 38.0 150-151 30.871625 35.5 29.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 0.0 19 1.0 20 3.0 21 1.0 22 3.0 23 5.0 24 4.0 25 12.0 26 7.0 27 16.0 28 23.0 29 29.0 30 37.0 31 40.0 32 64.0 33 88.0 34 120.0 35 233.0 36 482.0 37 2825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.512663085188024 10.130468150422104 6.804809414172423 38.55205935021745 2 22.975 13.25 36.3 27.474999999999998 3 20.690517888416313 16.18714035526645 25.168876657493122 37.95346509882412 4 23.3 25.424999999999997 21.9 29.375 5 26.1 29.049999999999997 24.55 20.3 6 23.65 31.724999999999998 22.725 21.9 7 17.9 24.45 38.375 19.275000000000002 8 20.375 22.35 29.75 27.525 9 20.3 21.65 32.2 25.85 10-14 22.655 26.334999999999997 25.64 25.369999999999997 15-19 22.991149557477875 25.191259562978146 26.18630931546577 25.631281564078208 20-24 23.345 25.21 25.615 25.83 25-29 23.43 25.485000000000003 25.745 25.34 30-34 22.84 24.81 25.885 26.465 35-39 23.512351235123514 24.977497749774976 25.84758475847585 25.662566256625663 40-44 22.8 25.619999999999997 25.66 25.919999999999998 45-49 22.900000000000002 25.385 25.6 26.115 50-54 23.455000000000002 25.525 25.919999999999998 25.1 55-59 23.54 25.2 25.580000000000002 25.679999999999996 60-64 23.415 24.985 25.34 26.26 65-69 23.365 25.025 25.679999999999996 25.929999999999996 70-74 23.546177308865442 25.481274063703186 25.461273063653184 25.51127556377819 75-79 24.05 24.72 25.4 25.83 80-84 24.14241424142414 25.412541254125415 25.167516751675166 25.277527752775274 85-89 23.555 25.44 24.959999999999997 26.045 90-94 23.745 25.775 24.995 25.485000000000003 95-99 24.55 25.36 24.87 25.22 100-104 24.383657548632296 26.49397409611442 23.983597539630942 25.13877081562234 105-109 24.855 25.424999999999997 24.355 25.365 110-114 24.651698907487223 25.899569008720057 24.340984263806757 25.10774781998597 115-119 23.76163314320024 26.62363654558191 24.26198338837186 25.35274692284599 120-124 23.975789105097295 25.98169176129258 23.43054374468511 26.611975388925018 125-129 23.9 25.665 23.965 26.47 130-134 23.599999999999998 26.3 23.765 26.334999999999997 135-139 22.54 25.650000000000002 25.0 26.810000000000002 140-144 22.689999999999998 25.595000000000002 24.63 27.084999999999997 145-149 22.6 25.869999999999997 25.05 26.479999999999997 150-151 22.4625 25.8625 24.6125 27.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.5 28 4.0 29 6.0 30 10.5 31 17.5 32 19.5 33 19.0 34 23.0 35 28.5 36 40.5 37 58.5 38 77.0 39 97.5 40 124.5 41 158.5 42 170.5 43 184.5 44 215.5 45 208.5 46 191.5 47 196.0 48 192.0 49 170.5 50 155.0 51 144.5 52 125.5 53 106.0 54 91.5 55 92.5 56 100.0 57 98.0 58 98.5 59 88.5 60 72.5 61 71.5 62 72.0 63 66.5 64 63.0 65 59.5 66 51.5 67 42.0 68 34.5 69 30.5 70 26.0 71 25.5 72 20.0 73 14.5 74 13.5 75 8.0 76 3.5 77 2.5 78 2.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.22999999999999998 115-119 0.06999999999999999 120-124 0.045 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.025 68-69 0.2 0.0 0.0 0.0 0.025 70-71 0.25 0.0 0.0 0.0 0.025 72-73 0.325 0.0 0.0 0.0 0.025 74-75 0.475 0.0 0.0 0.0 0.025 76-77 0.625 0.0 0.0 0.0 0.025 78-79 0.8125 0.0 0.0 0.0 0.025 80-81 0.95 0.0 0.0 0.0 0.025 82-83 1.175 0.0 0.0 0.0 0.025 84-85 1.4375 0.0 0.0 0.0 0.025 86-87 1.775 0.0 0.0 0.0 0.025 88-89 2.2874999999999996 0.0 0.0 0.0 0.025 90-91 2.9 0.0 0.0 0.0 0.025 92-93 3.3 0.0 0.0 0.0 0.025 94-95 3.9875 0.0 0.0 0.0 0.025 96-97 4.9 0.0 0.0 0.0 0.025 98-99 5.775 0.0 0.0 0.0 0.025 100-101 6.5875 0.0 0.0 0.0 0.025 102-103 7.4625 0.0 0.0 0.0 0.025 104-105 8.3375 0.0 0.0 0.0 0.025 106-107 9.3375 0.0 0.0 0.0 0.025 108-109 10.475 0.0 0.0 0.0 0.025 110-111 11.45 0.0 0.0 0.0 0.025 112-113 12.2875 0.0 0.0 0.0 0.025 114-115 13.1875 0.0 0.0 0.0 0.025 116-117 14.3875 0.0 0.0 0.0 0.025 118-119 15.5 0.0 0.0 0.0 0.025 120-121 16.5625 0.0 0.0 0.0 0.025 122-123 17.8125 0.0 0.0 0.0 0.025 124-125 18.950000000000003 0.0 0.0 0.0 0.025 126-127 20.025 0.0 0.0 0.0 0.025 128-129 21.1125 0.0 0.0 0.0 0.025 130-131 22.5 0.0 0.0 0.0 0.025 132-133 23.725 0.0 0.0 0.0 0.025 134-135 24.8375 0.0 0.0 0.0 0.025 136-137 25.675 0.0 0.0 0.0 0.025 138-139 26.9625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAAGT 10 0.0068343505 144.975 9 TATCTCG 50 0.0013313607 17.397 140-144 >>END_MODULE SRR6941614 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941614_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9965 33.0 33.0 34.0 32.0 34.0 2 33.17725 34.0 33.0 34.0 33.0 34.0 3 33.21975 34.0 33.0 34.0 33.0 34.0 4 33.14825 34.0 33.0 34.0 33.0 34.0 5 33.156 34.0 33.0 34.0 33.0 34.0 6 37.36325 38.0 38.0 38.0 37.0 38.0 7 37.364 38.0 38.0 38.0 37.0 38.0 8 37.36475 38.0 38.0 38.0 37.0 38.0 9 37.34725 38.0 38.0 38.0 38.0 38.0 10-14 37.33109999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.31615000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.31229999999999 38.0 38.0 38.0 37.4 38.0 25-29 37.29665 38.0 38.0 38.0 37.0 38.0 30-34 37.29225 38.0 38.0 38.0 37.0 38.0 35-39 37.20245 38.0 38.0 38.0 37.0 38.0 40-44 37.263549999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.2768 38.0 38.0 38.0 37.0 38.0 50-54 37.230999999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.11535 38.0 38.0 38.0 37.0 38.0 60-64 37.06225 38.0 38.0 38.0 36.6 38.0 65-69 36.941050000000004 38.0 38.0 38.0 36.2 38.0 70-74 37.02325 38.0 38.0 38.0 36.2 38.0 75-79 36.942299999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.84525 38.0 38.0 38.0 35.8 38.0 85-89 36.88075 38.0 38.0 38.0 35.8 38.0 90-94 36.80820000000001 38.0 38.0 38.0 35.8 38.0 95-99 36.64035 38.0 38.0 38.0 35.0 38.0 100-104 36.5319 38.0 38.0 38.0 34.2 38.0 105-109 36.15140000000001 38.0 38.0 38.0 33.4 38.0 110-114 35.5141 38.0 37.0 38.0 30.0 38.0 115-119 35.61045 38.0 37.0 38.0 31.0 38.0 120-124 35.5461 38.0 36.4 38.0 30.8 38.0 125-129 35.419 38.0 36.0 38.0 30.8 38.0 130-134 35.32469999999999 38.0 36.0 38.0 31.0 38.0 135-139 34.68320000000001 38.0 35.4 38.0 28.0 38.0 140-144 33.8765 38.0 33.2 38.0 23.8 38.0 145-149 32.50619999999999 38.0 33.0 38.0 12.6 38.0 150-151 26.228875000000002 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 1.0 6 1.0 7 0.0 8 2.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 4.0 18 3.0 19 5.0 20 3.0 21 6.0 22 5.0 23 8.0 24 9.0 25 11.0 26 18.0 27 23.0 28 26.0 29 31.0 30 43.0 31 65.0 32 57.0 33 113.0 34 182.0 35 305.0 36 600.0 37 2463.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.25 19.375 9.525 31.85 2 28.775000000000002 24.175 28.799999999999997 18.25 3 21.45 26.625 27.700000000000003 24.224999999999998 4 26.424999999999997 32.025 19.525000000000002 22.025 5 26.75 32.875 20.1 20.275000000000002 6 22.0 35.6 21.15 21.25 7 22.45 18.9 34.699999999999996 23.95 8 22.825 23.775 25.025 28.375 9 24.349999999999998 22.425 27.875 25.35 10-14 25.895000000000003 25.355 24.104999999999997 24.645 15-19 25.540000000000003 25.195 24.85 24.415 20-24 25.319999999999997 25.580000000000002 24.555 24.545 25-29 25.66 25.445 24.45 24.445 30-34 25.39 25.074999999999996 25.119999999999997 24.415 35-39 25.88 25.34 24.59 24.19 40-44 25.75 25.775 24.12 24.355 45-49 25.22 25.674999999999997 24.725 24.38 50-54 25.755 25.064999999999998 25.05 24.13 55-59 25.635 25.245 24.69 24.43 60-64 25.765 25.424999999999997 24.635 24.175 65-69 25.485000000000003 24.759999999999998 24.95 24.805 70-74 26.029999999999998 25.195 24.815 23.96 75-79 25.985000000000003 25.005 25.009999999999998 24.0 80-84 25.70385557833675 25.263789568435264 25.13877081562234 23.893584037605642 85-89 26.655 25.729999999999997 24.115000000000002 23.5 90-94 26.505000000000003 25.25 24.73 23.515 95-99 26.471323566178306 26.111305565278265 24.286214310715536 23.131156557827893 100-104 27.134999999999998 25.75 24.525 22.59 105-109 27.855 25.96 24.065 22.12 110-114 27.125 26.229999999999997 24.610000000000003 22.035 115-119 28.115000000000002 26.640000000000004 23.59 21.654999999999998 120-124 28.410000000000004 26.97 23.73 20.89 125-129 29.049999999999997 26.674999999999997 23.965 20.31 130-134 28.72143607180359 27.341367068353417 24.031201560078003 19.90599529976499 135-139 29.086454322716136 26.711335566778338 24.381219060953047 19.82099104955248 140-144 29.017254313578395 27.206801700425103 24.956239059764943 18.81970492623156 145-149 28.960136047616665 26.94943230130546 25.408893112589404 18.68153853848847 150-151 30.162499999999998 26.924999999999997 25.1 17.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 1.0 26 3.5 27 3.5 28 5.0 29 6.5 30 7.5 31 11.0 32 14.0 33 16.5 34 22.5 35 33.0 36 39.5 37 56.5 38 82.5 39 98.0 40 111.0 41 133.0 42 160.5 43 168.0 44 184.0 45 196.5 46 183.5 47 185.5 48 182.0 49 170.5 50 160.5 51 143.5 52 126.5 53 123.5 54 116.5 55 107.0 56 105.0 57 90.0 58 86.0 59 89.5 60 85.5 61 88.5 62 77.5 63 74.0 64 75.0 65 61.5 66 59.5 67 53.5 68 43.0 69 38.0 70 27.5 71 22.5 72 24.0 73 16.0 74 8.5 75 6.5 76 6.0 77 4.0 78 1.0 79 1.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.025 145-149 0.034999999999999996 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16603487490522 98.1 2 0.6317917614354309 1.25 3 0.1516300227445034 0.44999999999999996 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.625 0.0 0.0 0.0 0.0 78-79 0.7875000000000001 0.0 0.0 0.0 0.0 80-81 0.8999999999999999 0.0 0.0 0.0 0.0 82-83 1.1375000000000002 0.0 0.0 0.0 0.0 84-85 1.4125 0.0 0.0 0.0 0.0 86-87 1.775 0.0 0.0 0.0 0.0 88-89 2.2874999999999996 0.0 0.0 0.0 0.0 90-91 2.9 0.0 0.0 0.0 0.0 92-93 3.3125 0.0 0.0 0.0 0.0 94-95 4.0125 0.0 0.0 0.0 0.0 96-97 4.975 0.0 0.0 0.0 0.0 98-99 5.85 0.0 0.0 0.0 0.0 100-101 6.6875 0.0 0.0 0.0 0.0 102-103 7.625 0.0 0.0 0.0 0.0 104-105 8.4875 0.0 0.0 0.0 0.0 106-107 9.575 0.0 0.0 0.0 0.0 108-109 10.7375 0.0 0.0 0.0 0.0 110-111 11.7 0.0 0.0 0.0 0.0 112-113 12.575 0.0 0.0 0.0 0.0 114-115 13.5125 0.0 0.0 0.0 0.0 116-117 14.675 0.0 0.0 0.0 0.0 118-119 15.75 0.0 0.0 0.0 0.0 120-121 16.7875 0.0 0.0 0.0 0.0 122-123 18.05 0.0 0.0 0.0 0.0 124-125 19.200000000000003 0.0 0.0 0.0 0.0 126-127 20.275 0.0 0.0 0.0 0.0 128-129 21.425 0.0 0.0 0.0 0.0 130-131 22.825000000000003 0.0 0.0 0.0 0.0 132-133 24.05 0.0 0.0 0.0 0.0 134-135 25.1625 0.0 0.0 0.0 0.0 136-137 26.05 0.0 0.0 0.0 0.0 138-139 27.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCAGT 10 0.006830828 145.0 6 GTATCTT 10 0.006830828 145.0 1 TCAGTAT 10 0.006830828 145.0 3 TATCTTC 10 0.006830828 145.0 2 GTAGATC 30 0.0014437955 24.166668 140-144 TGTAGAT 35 0.0035366106 20.714287 140-144 GTGTAGA 45 6.5511256E-4 19.333332 140-144 >>END_MODULE Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409569 spots for SRR6941614.sra Written 1409569 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra Read 1409563 spots for SRR6941614.sra Written 1409563 spots for SRR6941614.sra SRR ids: ['SRR6941614.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p4nyr70z SRR6941614.sra spots: 28191266 blocks: [[1, 1409563], [1409564, 2819126], [2819127, 4228689], [4228690, 5638252], [5638253, 7047815], [7047816, 8457378], [8457379, 9866941], [9866942, 11276504], [11276505, 12686067], [12686068, 14095630], [14095631, 15505193], [15505194, 16914756], [16914757, 18324319], [18324320, 19733882], [19733883, 21143445], [21143446, 22553008], [22553009, 23962571], [23962572, 25372134], [25372135, 26781697], [26781698, 28191266]] SRR6941614 file size 9531394 SRR6941614 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941614 SRR6941614_1.fastq SRR6941614_2.fastq Input file: SRR6941614_1.fastq Paired file: SRR6941614_2.fastq trimmed: SRR6941614-trimmed-pair1.fastq, SRR6941614-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:16:33 2024 >> started Fri Dec 6 13:17:01 2024 >> done (28.138s) 28191266 read pairs processed; of these: 14397 ( 0.05%) short read pairs filtered out after trimming by size control 13039 ( 0.05%) empty read pairs filtered out after trimming by size control 28163830 (99.90%) read pairs available; of these: 17441218 (61.93%) trimmed read pairs available after processing 10722612 (38.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 26 0.00% 20 18 0.00% 21 16 0.00% 22 29 0.00% 23 30 0.00% 24 24 0.00% 25 16 0.00% 26 21 0.00% 27 42 0.00% 28 27 0.00% 29 45 0.00% 30 45 0.00% 31 48 0.00% 32 52 0.00% 33 62 0.00% 34 77 0.00% 35 70 0.00% 36 84 0.00% 37 93 0.00% 38 114 0.00% 39 132 0.00% 40 176 0.00% 41 202 0.00% 42 224 0.00% 43 247 0.00% 44 245 0.00% 45 303 0.00% 46 341 0.00% 47 402 0.00% 48 433 0.00% 49 602 0.00% 50 678 0.00% 51 792 0.00% 52 903 0.00% 53 1072 0.00% 54 1172 0.00% 55 1245 0.00% 56 1414 0.01% 57 1638 0.01% 58 1907 0.01% 59 2174 0.01% 60 2664 0.01% 61 3267 0.01% 62 3713 0.01% 63 4278 0.02% 64 4722 0.02% 65 5100 0.02% 66 5795 0.02% 67 6548 0.02% 68 7332 0.03% 69 8662 0.03% 70 10120 0.04% 71 11657 0.04% 72 13724 0.05% 73 16114 0.06% 74 17064 0.06% 75 18865 0.07% 76 20778 0.07% 77 22581 0.08% 78 24872 0.09% 79 28127 0.10% 80 31234 0.11% 81 35326 0.13% 82 40180 0.14% 83 44850 0.16% 84 49881 0.18% 85 53918 0.19% 86 57259 0.20% 87 59919 0.21% 88 64701 0.23% 89 67895 0.24% 90 73571 0.26% 91 79636 0.28% 92 86105 0.31% 93 93974 0.33% 94 100042 0.36% 95 104474 0.37% 96 107600 0.38% 97 111477 0.40% 98 114296 0.41% 99 118057 0.42% 100 122727 0.44% 101 127883 0.45% 102 133043 0.47% 103 140177 0.50% 104 144744 0.51% 105 148462 0.53% 106 152363 0.54% 107 151351 0.54% 108 152928 0.54% 109 155374 0.55% 110 155993 0.55% 111 159819 0.57% 112 165872 0.59% 113 169725 0.60% 114 173610 0.62% 115 178099 0.63% 116 177005 0.63% 117 177461 0.63% 118 175448 0.62% 119 173500 0.62% 120 174478 0.62% 121 175825 0.62% 122 176584 0.63% 123 182258 0.65% 124 186422 0.66% 125 186783 0.66% 126 186525 0.66% 127 186907 0.66% 128 184481 0.66% 129 185036 0.66% 130 184287 0.65% 131 182641 0.65% 132 186597 0.66% 133 190495 0.68% 134 192255 0.68% 135 197713 0.70% 136 198902 0.71% 137 197970 0.70% 138 199415 0.71% 139 205707 0.73% 140 208211 0.74% 141 214514 0.76% 142 226005 0.80% 143 238022 0.85% 144 260994 0.93% 145 289037 1.03% 146 330980 1.18% 147 405058 1.44% 148 546632 1.94% 149 987717 3.51% 150 5089551 18.07% 151 10722612 38.07% 28163830 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=78.23 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.6 sequence=TGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCATCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGCTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.44 prefix-fanout=1.9 sequence=AGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=42.73 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6941614 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:17:54 Started mapping on | Dec 06 13:17:54 Finished on | Dec 06 13:20:52 Mapping speed, Million of reads per hour | 569.61 Number of input reads | 28163830 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 26827271 Uniquely mapped reads % | 95.25% Average mapped length | 277.09 Number of splices: Total | 26845914 Number of splices: Annotated (sjdb) | 25180670 Number of splices: GT/AG | 26438839 Number of splices: GC/AG | 309166 Number of splices: AT/AC | 11208 Number of splices: Non-canonical | 86701 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436454 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 46464 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 909517 909517 909517 N_multimapping 436454 436454 436454 N_noFeature 1123566 25878677 1476482 N_ambiguous 690387 3860 94789 UnstrandedReadsAssigned:25013318 PositiveStrandReadsAssigned:944734 NegativeStrandReadsAssigned:25256000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=124 echo kmer=119 SRR6941614 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941614-trimmed-pair1.fastq SRR6941614-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,163,830 reads, 25,312,928 reads pseudoaligned [quant] estimated average fragment length: 203.534 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52973 SRR6941614.ke.tsv 35125 SRR6941614.se.tsv 88098 total ==> SRR6941614.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.013 0 0 PNS24247 1044 841.466 75.6262 5.49867 PNS24249 1928 1725.47 95.8765 3.3996 PNS24246 1044 841.466 75.6262 5.49867 PNS24248 1044 841.466 75.6262 5.49867 PNS24244 1471 1268.47 49.245 2.37523 PNS24243 293 127.625 0 0 KQK14069 1603 1400.47 3576.83 156.26 KQK14071 474 283.757 118.348 25.5174 ==> SRR6941614.se.tsv <== BRADI_1g14170v3 4341 BRADI_1g53295v3 1023 BRADI_1g59795v3 182 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 715 BRADI_1g74790v3 176 BRADI_1g09890v3 0 BRADI_1g77505v3 287 BRADI_1g48960v3 0 SRR6941614 completed mapping pipeline successfully