Starting /dee2/code/volunteer_pipeline.sh SRR6941615 current disk space = 1551030513664 free memory = 1601208384 SRR6941615 SRAfilesize 698f36782fc3dd103157d54d2501ada5 SRR6941615.sra SRR6941615.sra file validated SRR6941615 is paired end SRR6941615 is conventional basespace SRR6941615 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941615_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1885 34.0 33.0 34.0 32.0 34.0 2 32.98825 34.0 33.0 34.0 32.0 34.0 3 33.05475 34.0 33.0 34.0 32.0 34.0 4 33.1365 34.0 33.0 34.0 32.0 34.0 5 33.22875 34.0 33.0 34.0 32.0 34.0 6 37.03075 38.0 37.0 38.0 36.0 38.0 7 37.32425 38.0 38.0 38.0 37.0 38.0 8 37.38475 38.0 38.0 38.0 37.0 38.0 9 37.43075 38.0 38.0 38.0 37.0 38.0 10-14 37.45795 38.0 38.0 38.0 37.0 38.0 15-19 37.47905 38.0 38.0 38.0 37.8 38.0 20-24 37.40735 38.0 38.0 38.0 37.4 38.0 25-29 37.27975 38.0 38.0 38.0 37.0 38.0 30-34 37.33584999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.32085 38.0 38.0 38.0 37.0 38.0 40-44 37.371599999999994 38.0 38.0 38.0 37.2 38.0 45-49 37.41369999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.35334999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.32215 38.0 38.0 38.0 37.0 38.0 60-64 37.26285 38.0 38.0 38.0 36.8 38.0 65-69 36.96045 38.0 38.0 38.0 35.8 38.0 70-74 37.014250000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.17555 38.0 38.0 38.0 36.0 38.0 80-84 37.05929999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.8602 38.0 38.0 38.0 35.2 38.0 90-94 36.8718 38.0 38.0 38.0 35.4 38.0 95-99 36.93195 38.0 38.0 38.0 35.2 38.0 100-104 36.7636 38.0 38.0 38.0 35.0 38.0 105-109 36.3952 38.0 38.0 38.0 33.8 38.0 110-114 36.27745 38.0 38.0 38.0 33.8 38.0 115-119 36.24715 38.0 38.0 38.0 33.6 38.0 120-124 36.3317 38.0 38.0 38.0 34.0 38.0 125-129 36.26305 38.0 38.0 38.0 33.8 38.0 130-134 36.19665 38.0 38.0 38.0 33.4 38.0 135-139 35.9837 38.0 36.8 38.0 33.0 38.0 140-144 35.64835 38.0 36.0 38.0 32.2 38.0 145-149 35.01135 38.0 36.0 38.0 30.4 38.0 150-151 31.078 35.5 30.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 2.0 13 2.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 0.0 20 1.0 21 5.0 22 3.0 23 3.0 24 6.0 25 8.0 26 17.0 27 14.0 28 16.0 29 34.0 30 28.0 31 47.0 32 66.0 33 82.0 34 131.0 35 213.0 36 483.0 37 2832.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.95389344262295 10.245901639344263 7.120901639344263 37.67930327868852 2 22.375 13.225000000000001 34.5 29.9 3 20.51025512756378 16.708354177088545 25.362681340670335 37.41870935467734 4 25.25 24.725 22.15 27.875 5 26.825 29.925 22.650000000000002 20.599999999999998 6 23.225 32.275 23.599999999999998 20.9 7 17.875 24.55 38.175 19.400000000000002 8 20.5 24.125 29.099999999999998 26.275 9 20.175 21.75 32.425 25.650000000000002 10-14 23.115 27.02 25.445 24.42 15-19 23.189999999999998 25.290000000000003 26.0 25.52 20-24 23.255 25.585 26.205000000000002 24.955 25-29 23.71 24.88 26.135 25.275 30-34 22.745 25.6 26.36 25.295 35-39 22.836141807090353 25.35626781339067 25.98629931496575 25.821291064553225 40-44 22.564999999999998 25.775 25.775 25.885 45-49 23.005 24.88 25.89 26.224999999999998 50-54 22.67 25.174999999999997 25.835 26.32 55-59 23.46 25.295 25.55 25.695 60-64 23.59 25.264999999999997 25.95 25.195 65-69 23.56 25.224999999999998 25.585 25.629999999999995 70-74 23.41 25.380000000000003 25.745 25.465 75-79 24.05 24.89 25.080000000000002 25.979999999999997 80-84 23.59617980899045 25.351267563378173 25.396269813490672 25.656282814140706 85-89 23.7 25.355 25.835 25.11 90-94 23.82 25.669999999999998 24.915000000000003 25.595000000000002 95-99 23.505000000000003 25.535000000000004 25.115 25.845000000000002 100-104 23.61090272568142 26.051512878219558 24.996249062265566 25.34133533383346 105-109 23.880000000000003 26.345000000000002 24.33 25.445 110-114 23.56097071801043 26.343762535098275 24.272964300040112 25.822302446851182 115-119 24.483259096141335 25.98969020569541 23.93774085381112 25.589309844352137 120-124 23.257791785482016 26.184401420781427 24.25834208814848 26.299464705588072 125-129 23.78 26.57 24.09 25.56 130-134 23.77 26.035000000000004 24.095 26.1 135-139 23.525 26.295 24.07 26.11 140-144 22.650000000000002 25.96 24.705 26.685 145-149 22.830000000000002 25.715 24.825 26.63 150-151 22.4375 25.637500000000003 24.3 27.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 1.0 26 1.0 27 1.0 28 3.0 29 5.5 30 8.0 31 13.5 32 22.0 33 27.0 34 32.0 35 38.0 36 46.5 37 59.5 38 79.5 39 110.5 40 122.5 41 145.5 42 175.5 43 193.5 44 207.5 45 205.5 46 192.0 47 181.0 48 191.5 49 189.5 50 161.0 51 137.0 52 127.0 53 118.0 54 114.0 55 102.0 56 93.5 57 86.5 58 79.0 59 77.0 60 63.5 61 59.5 62 66.5 63 68.5 64 63.5 65 51.5 66 45.5 67 43.0 68 35.0 69 34.0 70 33.5 71 25.5 72 16.0 73 11.0 74 8.5 75 5.5 76 6.5 77 6.5 78 2.5 79 1.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.27999999999999997 115-119 0.095 120-124 0.055 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.0625 0.0 0.0 0.0 0.0 88-89 1.2875 0.0 0.0 0.0 0.0 90-91 1.6625 0.0 0.0 0.0 0.0 92-93 1.8875000000000002 0.0 0.0 0.0 0.0 94-95 2.4000000000000004 0.0 0.0 0.0 0.0 96-97 2.975 0.0 0.0 0.0 0.0 98-99 3.6875 0.0 0.0 0.0 0.0 100-101 4.475 0.0 0.0 0.0 0.0 102-103 5.15 0.0 0.0 0.0 0.0 104-105 5.9 0.0 0.0 0.0 0.0 106-107 6.699999999999999 0.0 0.0 0.0 0.0 108-109 7.6125 0.0 0.0 0.0 0.0 110-111 8.7125 0.0 0.0 0.0 0.0 112-113 9.774999999999999 0.0 0.0 0.0 0.0 114-115 11.0 0.0 0.0 0.0 0.0 116-117 12.2 0.0 0.0 0.0 0.0 118-119 13.3625 0.0 0.0 0.0 0.0 120-121 14.725000000000001 0.0 0.0 0.0 0.0 122-123 16.0125 0.0 0.0 0.0 0.0 124-125 17.25 0.0 0.0 0.0 0.0 126-127 18.862499999999997 0.0 0.0 0.0 0.0 128-129 20.15 0.0 0.0 0.0 0.0 130-131 21.3625 0.0 0.0 0.0 0.0 132-133 22.325000000000003 0.0 0.0 0.0 0.0 134-135 23.4875 0.0 0.0 0.0 0.0 136-137 24.5 0.0 0.0 0.0 0.0 138-139 25.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTCTT 10 0.006830828 145.0 6 >>END_MODULE SRR6941615 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941615_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01125 33.0 33.0 34.0 32.0 34.0 2 33.0885 34.0 33.0 34.0 32.0 34.0 3 33.13925 34.0 33.0 34.0 33.0 34.0 4 33.1095 34.0 33.0 34.0 32.0 34.0 5 33.12175 34.0 33.0 34.0 33.0 34.0 6 37.27575 38.0 38.0 38.0 37.0 38.0 7 37.29775 38.0 38.0 38.0 37.0 38.0 8 37.31125 38.0 38.0 38.0 37.0 38.0 9 37.19925 38.0 38.0 38.0 37.0 38.0 10-14 37.20225000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.1957 38.0 38.0 38.0 37.0 38.0 20-24 37.16974999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.19325 38.0 38.0 38.0 37.0 38.0 30-34 37.1495 38.0 38.0 38.0 37.0 38.0 35-39 37.155199999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.1169 38.0 38.0 38.0 37.0 38.0 45-49 37.0981 38.0 38.0 38.0 36.8 38.0 50-54 37.09575 38.0 38.0 38.0 37.0 38.0 55-59 37.029700000000005 38.0 38.0 38.0 36.6 38.0 60-64 36.9581 38.0 38.0 38.0 36.0 38.0 65-69 36.8512 38.0 38.0 38.0 35.6 38.0 70-74 36.9103 38.0 38.0 38.0 36.0 38.0 75-79 36.857150000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.74155 38.0 38.0 38.0 35.0 38.0 85-89 36.7753 38.0 38.0 38.0 35.4 38.0 90-94 36.7106 38.0 38.0 38.0 35.0 38.0 95-99 36.4763 38.0 38.0 38.0 34.2 38.0 100-104 36.3642 38.0 38.0 38.0 34.0 38.0 105-109 36.025999999999996 38.0 38.0 38.0 33.2 38.0 110-114 35.46815 38.0 36.8 38.0 30.2 38.0 115-119 35.46365 38.0 36.2 38.0 31.0 38.0 120-124 35.25625 38.0 36.0 38.0 29.8 38.0 125-129 35.216300000000004 38.0 35.8 38.0 29.6 38.0 130-134 35.1866 38.0 36.0 38.0 30.2 38.0 135-139 34.732150000000004 38.0 34.8 38.0 28.6 38.0 140-144 34.1214 38.0 33.2 38.0 25.2 38.0 145-149 32.9618 38.0 33.0 38.0 17.0 38.0 150-151 27.258625000000002 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 2.0 11 1.0 12 0.0 13 0.0 14 3.0 15 4.0 16 0.0 17 3.0 18 2.0 19 4.0 20 7.0 21 4.0 22 10.0 23 5.0 24 15.0 25 10.0 26 19.0 27 28.0 28 30.0 29 34.0 30 49.0 31 68.0 32 73.0 33 90.0 34 137.0 35 282.0 36 634.0 37 2470.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5 19.45 9.875 29.175 2 28.875 24.575 28.449999999999996 18.099999999999998 3 22.275 26.724999999999998 27.175 23.825 4 27.0 31.35 20.674999999999997 20.974999999999998 5 26.8 33.800000000000004 19.8 19.6 6 23.25 36.775000000000006 19.575 20.4 7 22.2 19.475 35.199999999999996 23.125 8 22.85 23.45 24.775 28.925 9 23.625 23.425 27.500000000000004 25.45 10-14 25.39 26.05 23.78 24.779999999999998 15-19 24.805 25.629999999999995 24.79 24.775 20-24 25.66 25.39 25.019999999999996 23.93 25-29 25.745 25.735000000000003 24.245 24.275 30-34 25.46 25.485000000000003 24.695 24.36 35-39 26.045 25.324999999999996 24.52 24.11 40-44 26.11 24.985 24.58 24.325 45-49 25.39 25.679999999999996 24.705 24.224999999999998 50-54 25.555 24.975 25.6 23.87 55-59 26.055 24.990000000000002 25.11 23.845 60-64 25.46 25.72 24.79 24.03 65-69 25.91 26.25 24.325 23.515 70-74 26.02 26.340000000000003 24.485 23.155 75-79 25.97 25.6 24.915000000000003 23.515 80-84 26.326316315815788 25.36126806340317 24.71623581179059 23.59617980899045 85-89 25.585 26.305 24.895 23.215 90-94 25.52 25.95 25.174999999999997 23.355 95-99 26.51 26.02 24.88 22.59 100-104 26.640000000000004 26.005 24.104999999999997 23.25 105-109 26.195 25.869999999999997 24.9 23.035 110-114 26.590000000000003 26.83 24.315 22.264999999999997 115-119 27.42 26.14 24.34 22.1 120-124 28.244999999999997 26.85 23.335 21.57 125-129 28.605000000000004 26.105 23.785 21.505 130-134 29.49 26.05 23.105 21.355 135-139 29.455 25.97 23.635 20.94 140-144 29.707970797079707 26.147614761476145 23.687368736873687 20.457045704570458 145-149 29.75446316947542 26.568985347802172 23.793569035355304 19.882982447367105 150-151 30.75 26.2125 23.45 19.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 1.5 25 1.5 26 2.5 27 2.0 28 3.5 29 10.5 30 12.0 31 12.0 32 18.0 33 22.5 34 27.5 35 36.5 36 51.5 37 58.5 38 68.5 39 100.0 40 122.5 41 144.5 42 174.5 43 193.0 44 187.0 45 180.5 46 189.0 47 185.0 48 172.5 49 156.5 50 153.5 51 164.0 52 145.5 53 112.5 54 102.5 55 102.5 56 88.5 57 82.0 58 81.0 59 77.5 60 73.5 61 73.0 62 80.5 63 69.5 64 59.0 65 60.0 66 62.5 67 61.5 68 48.5 69 33.5 70 31.5 71 26.5 72 16.0 73 13.0 74 14.0 75 11.0 76 8.0 77 6.0 78 2.0 79 1.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4783484390735146 0.95 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.7125 0.0 0.0 0.0 0.0 84-85 0.8625 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.2625000000000002 0.0 0.0 0.0 0.0 90-91 1.6375000000000002 0.0 0.0 0.0 0.0 92-93 1.8624999999999998 0.0 0.0 0.0 0.0 94-95 2.3499999999999996 0.0 0.0 0.0 0.0 96-97 2.8875 0.0 0.0 0.0 0.0 98-99 3.575 0.0 0.0 0.0 0.0 100-101 4.324999999999999 0.0 0.0 0.0 0.0 102-103 5.05 0.0 0.0 0.0 0.0 104-105 5.775 0.0 0.0 0.0 0.0 106-107 6.525 0.0 0.0 0.0 0.0 108-109 7.4375 0.0 0.0 0.0 0.0 110-111 8.524999999999999 0.0 0.0 0.0 0.0 112-113 9.5625 0.0 0.0 0.0 0.0 114-115 10.75 0.0 0.0 0.0 0.0 116-117 11.9375 0.0 0.0 0.0 0.0 118-119 13.075 0.0 0.0 0.0 0.0 120-121 14.475000000000001 0.0 0.0 0.0 0.0 122-123 15.75 0.0 0.0 0.0 0.0 124-125 17.0375 0.0 0.0 0.0 0.0 126-127 18.674999999999997 0.0 0.0 0.0 0.0 128-129 19.9375 0.0 0.0 0.0 0.0 130-131 21.15 0.0 0.0 0.0 0.0 132-133 22.125 0.0 0.0 0.0 0.0 134-135 23.2375 0.0 0.0 0.0 0.0 136-137 24.225 0.0 0.0 0.0 0.0 138-139 25.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148383 spots for SRR6941615.sra Written 1148383 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra Read 1148382 spots for SRR6941615.sra Written 1148382 spots for SRR6941615.sra SRR ids: ['SRR6941615.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c_epmf97 SRR6941615.sra spots: 22967641 blocks: [[1, 1148382], [1148383, 2296764], [2296765, 3445146], [3445147, 4593528], [4593529, 5741910], [5741911, 6890292], [6890293, 8038674], [8038675, 9187056], [9187057, 10335438], [10335439, 11483820], [11483821, 12632202], [12632203, 13780584], [13780585, 14928966], [14928967, 16077348], [16077349, 17225730], [17225731, 18374112], [18374113, 19522494], [19522495, 20670876], [20670877, 21819258], [21819259, 22967641]] SRR6941615 file size 7761279 SRR6941615 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941615 SRR6941615_1.fastq SRR6941615_2.fastq Input file: SRR6941615_1.fastq Paired file: SRR6941615_2.fastq trimmed: SRR6941615-trimmed-pair1.fastq, SRR6941615-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:15:47 2024 >> started Fri Dec 6 13:16:21 2024 >> done (34.262s) 22967641 read pairs processed; of these: 13464 ( 0.06%) short read pairs filtered out after trimming by size control 11851 ( 0.05%) empty read pairs filtered out after trimming by size control 22942326 (99.89%) read pairs available; of these: 14200389 (61.90%) trimmed read pairs available after processing 8741937 (38.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 6 0.00% 20 7 0.00% 21 14 0.00% 22 7 0.00% 23 15 0.00% 24 18 0.00% 25 22 0.00% 26 15 0.00% 27 24 0.00% 28 19 0.00% 29 17 0.00% 30 27 0.00% 31 22 0.00% 32 35 0.00% 33 31 0.00% 34 54 0.00% 35 51 0.00% 36 55 0.00% 37 66 0.00% 38 70 0.00% 39 67 0.00% 40 117 0.00% 41 118 0.00% 42 128 0.00% 43 131 0.00% 44 159 0.00% 45 196 0.00% 46 191 0.00% 47 236 0.00% 48 275 0.00% 49 343 0.00% 50 364 0.00% 51 468 0.00% 52 552 0.00% 53 592 0.00% 54 662 0.00% 55 730 0.00% 56 797 0.00% 57 991 0.00% 58 999 0.00% 59 1189 0.01% 60 1530 0.01% 61 1803 0.01% 62 2196 0.01% 63 2342 0.01% 64 2623 0.01% 65 3019 0.01% 66 3342 0.01% 67 3688 0.02% 68 4242 0.02% 69 4914 0.02% 70 5893 0.03% 71 6652 0.03% 72 7704 0.03% 73 8929 0.04% 74 9947 0.04% 75 11110 0.05% 76 12069 0.05% 77 13369 0.06% 78 14885 0.06% 79 16688 0.07% 80 18653 0.08% 81 21249 0.09% 82 24339 0.11% 83 27463 0.12% 84 30895 0.13% 85 34331 0.15% 86 36511 0.16% 87 39006 0.17% 88 42467 0.19% 89 45115 0.20% 90 48584 0.21% 91 53374 0.23% 92 58125 0.25% 93 62777 0.27% 94 67833 0.30% 95 71771 0.31% 96 75849 0.33% 97 78909 0.34% 98 80943 0.35% 99 84047 0.37% 100 89574 0.39% 101 92622 0.40% 102 98035 0.43% 103 102467 0.45% 104 107715 0.47% 105 111334 0.49% 106 114519 0.50% 107 115090 0.50% 108 116508 0.51% 109 119223 0.52% 110 121811 0.53% 111 125318 0.55% 112 129328 0.56% 113 133838 0.58% 114 137016 0.60% 115 140935 0.61% 116 141859 0.62% 117 141947 0.62% 118 142723 0.62% 119 141900 0.62% 120 143202 0.62% 121 144120 0.63% 122 146662 0.64% 123 149791 0.65% 124 153343 0.67% 125 152771 0.67% 126 155011 0.68% 127 155296 0.68% 128 153741 0.67% 129 155202 0.68% 130 153781 0.67% 131 154419 0.67% 132 157140 0.68% 133 160690 0.70% 134 162545 0.71% 135 165424 0.72% 136 168929 0.74% 137 170078 0.74% 138 171487 0.75% 139 177098 0.77% 140 179495 0.78% 141 186479 0.81% 142 195406 0.85% 143 206619 0.90% 144 226882 0.99% 145 252607 1.10% 146 291109 1.27% 147 355074 1.55% 148 478729 2.09% 149 860272 3.75% 150 4244144 18.50% 151 8741937 38.10% 22942326 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.6 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=147.16 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=22.0 sequence=CTTCTTCTCCTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=1.9 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=157.74 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=21.9 sequence=CGCCGCCGCCGT SRR6941615 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:17:35 Started mapping on | Dec 06 13:17:36 Finished on | Dec 06 13:21:00 Mapping speed, Million of reads per hour | 404.86 Number of input reads | 22942326 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 21509800 Uniquely mapped reads % | 93.76% Average mapped length | 278.89 Number of splices: Total | 21305223 Number of splices: Annotated (sjdb) | 19873242 Number of splices: GT/AG | 20961125 Number of splices: GC/AG | 257352 Number of splices: AT/AC | 10912 Number of splices: Non-canonical | 75834 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.51 Insertion rate per base | 0.03% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404440 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 37313 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1037042 1037042 1037042 N_multimapping 404440 404440 404440 N_noFeature 1064661 20809777 1339076 N_ambiguous 501989 3318 75660 UnstrandedReadsAssigned:19943150 PositiveStrandReadsAssigned:696705 NegativeStrandReadsAssigned:20095064 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=127 echo kmer=123 SRR6941615 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941615-trimmed-pair1.fastq SRR6941615-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,942,326 reads, 20,209,795 reads pseudoaligned [quant] estimated average fragment length: 204.665 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR6941615.ke.tsv 35125 SRR6941615.se.tsv 88098 total ==> SRR6941615.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.69 0 0 PNS24247 1044 840.335 164.654 14.7735 PNS24249 1928 1724.33 134.833 5.89572 PNS24246 1044 840.335 164.654 14.7735 PNS24248 1044 840.335 164.654 14.7735 PNS24244 1471 1267.33 79.2043 4.71215 PNS24243 293 124.901 0 0 KQK14069 1603 1399.33 20871.2 1124.57 KQK14071 474 281.733 750.472 200.844 ==> SRR6941615.se.tsv <== BRADI_1g14170v3 25598 BRADI_1g53295v3 1155 BRADI_1g59795v3 1179 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 495 BRADI_1g74790v3 43 BRADI_1g09890v3 0 BRADI_1g77505v3 528 BRADI_1g48960v3 0 SRR6941615 completed mapping pipeline successfully