Starting /dee2/code/volunteer_pipeline.sh SRR6941616 current disk space = 1551031451648 free memory = 1601226208 SRR6941616 SRAfilesize 252282ee3f140d7f95844a4440313619 SRR6941616.sra SRR6941616.sra file validated SRR6941616 is paired end SRR6941616 is conventional basespace SRR6941616 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941616_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44225 34.0 33.0 34.0 32.0 34.0 2 33.01125 34.0 33.0 34.0 32.0 34.0 3 33.202 34.0 33.0 34.0 32.0 34.0 4 33.1585 34.0 33.0 34.0 32.0 34.0 5 33.30875 34.0 33.0 34.0 33.0 34.0 6 36.99575 38.0 37.0 38.0 35.0 38.0 7 37.3435 38.0 38.0 38.0 37.0 38.0 8 37.466 38.0 38.0 38.0 37.0 38.0 9 37.47575 38.0 38.0 38.0 37.0 38.0 10-14 37.476350000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.4821 38.0 38.0 38.0 37.6 38.0 20-24 37.4428 38.0 38.0 38.0 37.4 38.0 25-29 37.3368 38.0 38.0 38.0 37.0 38.0 30-34 37.31165 38.0 38.0 38.0 37.0 38.0 35-39 37.313649999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.38325 38.0 38.0 38.0 37.0 38.0 45-49 37.36665 38.0 38.0 38.0 37.0 38.0 50-54 37.31845 38.0 38.0 38.0 37.0 38.0 55-59 37.3339 38.0 38.0 38.0 37.0 38.0 60-64 37.23725 38.0 38.0 38.0 36.6 38.0 65-69 37.04755 38.0 38.0 38.0 35.8 38.0 70-74 37.071099999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.065549999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.89895 38.0 38.0 38.0 35.8 38.0 85-89 36.7516 38.0 38.0 38.0 35.0 38.0 90-94 36.822500000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.779999999999994 38.0 38.0 38.0 35.2 38.0 100-104 36.65535 38.0 38.0 38.0 34.8 38.0 105-109 36.34055 38.0 38.0 38.0 33.8 38.0 110-114 36.19785 38.0 38.0 38.0 33.8 38.0 115-119 36.19845 38.0 37.8 38.0 33.6 38.0 120-124 36.2144 38.0 38.0 38.0 33.6 38.0 125-129 36.0869 38.0 37.6 38.0 33.0 38.0 130-134 36.00675 38.0 37.8 38.0 33.0 38.0 135-139 35.73575 38.0 36.4 38.0 32.6 38.0 140-144 35.3874 38.0 36.0 38.0 31.0 38.0 145-149 34.80944999999999 38.0 35.6 38.0 28.6 38.0 150-151 30.873624999999997 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 1.0 18 5.0 19 13.0 20 1.0 21 4.0 22 3.0 23 6.0 24 4.0 25 5.0 26 8.0 27 14.0 28 25.0 29 37.0 30 31.0 31 54.0 32 67.0 33 98.0 34 112.0 35 233.0 36 505.0 37 2772.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.88700999231361 9.659236484755317 7.020240840379195 36.433512682551886 2 21.349999999999998 12.625 34.925 31.1 3 21.405351337834457 15.478869717429358 24.48112028007002 38.63465866466617 4 24.45 24.675 21.349999999999998 29.525000000000002 5 26.625 29.175 22.525000000000002 21.675 6 24.349999999999998 32.45 23.3 19.900000000000002 7 18.5 24.025 38.15 19.325 8 19.7 25.124999999999996 27.975 27.200000000000003 9 19.75 22.225 32.975 25.05 10-14 22.89 26.919999999999998 25.874999999999996 24.315 15-19 23.145 24.905 26.305 25.645 20-24 22.86 25.580000000000002 26.02 25.540000000000003 25-29 22.994999999999997 25.874999999999996 26.215 24.915000000000003 30-34 22.56 26.035000000000004 25.619999999999997 25.785000000000004 35-39 22.614522904580916 25.440088017603518 26.24024804960992 25.70514102820564 40-44 22.825 25.1 25.840000000000003 26.235000000000003 45-49 22.98 25.040000000000003 26.565 25.415 50-54 22.755 25.94 25.619999999999997 25.685000000000002 55-59 22.605 25.740000000000002 25.83 25.825 60-64 23.044999999999998 25.580000000000002 25.5 25.874999999999996 65-69 23.419999999999998 25.119999999999997 26.02 25.44 70-74 23.01 25.555 25.86 25.575 75-79 23.36 25.1 25.435000000000002 26.105 80-84 23.609721944388877 26.32026405281056 24.8999799959992 25.170034006801362 85-89 23.435 25.635 25.695 25.235000000000003 90-94 23.35 25.215 25.564999999999998 25.869999999999997 95-99 23.665 25.41 25.215 25.71 100-104 23.53176588294147 25.722861430715362 25.097548774387196 25.64782391195598 105-109 23.805 25.47 25.080000000000002 25.645 110-114 23.400732527218906 25.402639104911945 25.934473935076014 25.26215443279314 115-119 23.401592149401694 25.524458018324736 25.194011916086716 25.87993791618685 120-124 23.51381104883907 25.90572457966373 24.89991993594876 25.68054443554844 125-129 23.11 26.150000000000002 24.93 25.81 130-134 23.79 26.125 24.63 25.455 135-139 23.630000000000003 25.645 24.94 25.785000000000004 140-144 23.169999999999998 25.874999999999996 25.380000000000003 25.575 145-149 23.34 25.8 24.84 26.02 150-151 24.099999999999998 25.7875 24.9 25.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 1.5 26 1.0 27 3.5 28 6.5 29 6.5 30 6.0 31 10.5 32 14.0 33 19.5 34 34.5 35 48.0 36 47.0 37 55.5 38 85.5 39 118.0 40 128.5 41 139.5 42 181.0 43 205.0 44 207.0 45 200.0 46 199.5 47 208.0 48 199.0 49 168.5 50 158.5 51 165.0 52 137.5 53 112.0 54 99.0 55 89.0 56 85.0 57 81.0 58 75.5 59 75.0 60 71.0 61 64.5 62 55.0 63 46.0 64 50.5 65 51.0 66 45.0 67 42.0 68 40.0 69 34.0 70 26.0 71 19.0 72 21.0 73 18.5 74 15.0 75 13.0 76 6.5 77 3.5 78 2.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.345 115-119 0.135 120-124 0.08 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52128999748048 98.75 2 0.4283194759385236 0.8500000000000001 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02519526329050139 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 13 0.325 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.425 0.0 0.0 0.0 0.0 96-97 1.6375000000000002 0.0 0.0 0.0 0.0 98-99 2.0 0.0 0.0 0.0 0.0 100-101 2.4000000000000004 0.0 0.0 0.0 0.0 102-103 2.8 0.0 0.0 0.0 0.0 104-105 3.2874999999999996 0.0 0.0 0.0 0.0 106-107 3.75 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.5125 0.0 0.0 0.0 0.0 112-113 4.9875 0.0 0.0 0.0 0.0 114-115 5.4625 0.0 0.0 0.0 0.0 116-117 6.05 0.0 0.0 0.0 0.0 118-119 6.7875 0.0 0.0 0.0 0.0 120-121 7.6 0.0 0.0 0.0 0.0 122-123 8.325 0.0 0.0 0.0 0.0 124-125 8.8875 0.0 0.0 0.0 0.0 126-127 9.2625 0.0 0.0 0.0 0.0 128-129 9.7375 0.0 0.0 0.0 0.0 130-131 10.25 0.0 0.0 0.0 0.0 132-133 10.95 0.0 0.0 0.0 0.0 134-135 11.4875 0.0 0.0 0.0 0.0 136-137 12.087499999999999 0.0 0.0 0.0 0.0 138-139 12.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCGA 10 0.0068449317 144.90001 4 TTATTGC 10 0.0068449317 144.90001 6 CCCATCC 10 0.0068449317 144.90001 3 TGTCGAG 10 0.0068449317 144.90001 5 >>END_MODULE SRR6941616 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941616_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94025 33.0 33.0 34.0 32.0 34.0 2 33.0715 34.0 33.0 34.0 32.0 34.0 3 33.13775 34.0 33.0 34.0 33.0 34.0 4 33.02625 34.0 33.0 34.0 32.0 34.0 5 33.06875 34.0 33.0 34.0 33.0 34.0 6 37.214 38.0 38.0 38.0 37.0 38.0 7 37.27125 38.0 38.0 38.0 37.0 38.0 8 37.25875 38.0 38.0 38.0 37.0 38.0 9 37.24925 38.0 38.0 38.0 37.0 38.0 10-14 37.20845 38.0 38.0 38.0 37.0 38.0 15-19 37.14705 38.0 38.0 38.0 37.0 38.0 20-24 37.17425 38.0 38.0 38.0 37.0 38.0 25-29 37.12545 38.0 38.0 38.0 37.0 38.0 30-34 37.15215 38.0 38.0 38.0 37.0 38.0 35-39 37.09665 38.0 38.0 38.0 36.8 38.0 40-44 37.13565 38.0 38.0 38.0 37.0 38.0 45-49 37.12070000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.070499999999996 38.0 38.0 38.0 36.8 38.0 55-59 36.964749999999995 38.0 38.0 38.0 36.2 38.0 60-64 36.9673 38.0 38.0 38.0 36.0 38.0 65-69 36.83725 38.0 38.0 38.0 35.6 38.0 70-74 36.884750000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.88779999999999 38.0 38.0 38.0 35.8 38.0 80-84 36.67665000000001 38.0 38.0 38.0 35.2 38.0 85-89 36.674499999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.57585 38.0 38.0 38.0 35.0 38.0 95-99 36.4172 38.0 38.0 38.0 34.2 38.0 100-104 36.314750000000004 38.0 38.0 38.0 34.0 38.0 105-109 35.9945 38.0 38.0 38.0 33.4 38.0 110-114 35.467600000000004 38.0 36.8 38.0 30.2 38.0 115-119 35.5212 38.0 37.0 38.0 31.0 38.0 120-124 35.3707 38.0 36.4 38.0 30.0 38.0 125-129 35.470800000000004 38.0 36.2 38.0 31.2 38.0 130-134 35.50935 38.0 36.0 38.0 31.4 38.0 135-139 35.0104 38.0 36.0 38.0 30.2 38.0 140-144 34.49865 38.0 35.2 38.0 27.2 38.0 145-149 33.6654 38.0 33.2 38.0 21.8 38.0 150-151 27.912625000000002 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 0.0 5 2.0 6 0.0 7 2.0 8 1.0 9 0.0 10 2.0 11 2.0 12 3.0 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 2.0 19 5.0 20 14.0 21 5.0 22 5.0 23 8.0 24 7.0 25 10.0 26 15.0 27 30.0 28 36.0 29 47.0 30 38.0 31 51.0 32 76.0 33 104.0 34 141.0 35 240.0 36 559.0 37 2580.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.55 18.3 11.225 28.925 2 28.025 25.8 26.400000000000002 19.775000000000002 3 22.5 25.174999999999997 29.15 23.175 4 27.0 31.2 19.825 21.975 5 28.199999999999996 31.574999999999996 21.275 18.95 6 23.799999999999997 35.6 20.325 20.275000000000002 7 22.475 21.4 34.35 21.775 8 23.25 23.175 25.424999999999997 28.15 9 22.3 22.725 28.299999999999997 26.674999999999997 10-14 25.94 26.35 23.585 24.125 15-19 25.7 25.365 24.8 24.135 20-24 25.569999999999997 25.4 24.825 24.205 25-29 25.235000000000003 25.629999999999995 24.59 24.545 30-34 25.5 25.645 24.725 24.13 35-39 25.295 25.974999999999998 24.14 24.59 40-44 25.374999999999996 25.86 24.59 24.175 45-49 25.4 26.44 24.12 24.04 50-54 25.650000000000002 25.86 24.94 23.549999999999997 55-59 26.090000000000003 25.44 24.725 23.745 60-64 25.895000000000003 25.4 25.19 23.515 65-69 25.435000000000002 25.5 25.729999999999997 23.335 70-74 26.11 25.39 24.77 23.73 75-79 25.88 25.669999999999998 25.180000000000003 23.27 80-84 26.04281284385316 25.852755826748027 24.41732519755927 23.687106131839553 85-89 25.82 25.95 24.73 23.5 90-94 26.305 25.645 24.740000000000002 23.31 95-99 26.15261526152615 25.902590259025903 24.382438243824385 23.562356235623565 100-104 26.14 25.355 24.7 23.805 105-109 26.314999999999998 26.26 24.11 23.315 110-114 26.474999999999998 25.985000000000003 24.610000000000003 22.93 115-119 27.21 26.529999999999998 24.01 22.25 120-124 27.105 26.44 24.25 22.205 125-129 27.27 26.284999999999997 24.015 22.43 130-134 27.38773877387739 26.167616761676165 24.547454745474546 21.897189718971894 135-139 27.679151872780917 26.078911836775514 24.423663549532428 21.818272740911137 140-144 27.61742784252914 26.501925866639986 24.691110999949977 21.189535290880894 145-149 28.216162121591193 26.26469852389292 23.9279459594696 21.591193395046286 150-151 28.212500000000002 26.2875 23.7625 21.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 2.0 28 3.5 29 6.0 30 12.0 31 14.0 32 18.0 33 19.0 34 22.0 35 40.0 36 54.0 37 66.5 38 77.0 39 89.0 40 118.5 41 152.5 42 169.5 43 180.5 44 185.0 45 187.0 46 193.0 47 201.0 48 187.5 49 165.0 50 155.5 51 145.5 52 141.5 53 125.5 54 100.5 55 88.0 56 90.0 57 95.5 58 97.5 59 78.0 60 65.5 61 73.5 62 73.0 63 63.0 64 52.0 65 51.0 66 49.0 67 48.5 68 48.0 69 43.0 70 35.5 71 28.0 72 26.0 73 19.5 74 13.0 75 10.5 76 7.0 77 4.5 78 2.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.015 140-144 0.045 145-149 0.075 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44374209860936 98.32499999999999 2 0.404551201011378 0.8 3 0.05056890012642225 0.15 4 0.025284450063211124 0.1 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.025284450063211124 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 13 0.325 Illumina Single End PCR Primer 1 (97% over 34bp) CATACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 7 0.17500000000000002 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.3624999999999998 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.9249999999999998 0.0 0.0 0.0 0.0 100-101 2.3499999999999996 0.0 0.0 0.0 0.0 102-103 2.7750000000000004 0.0 0.0 0.0 0.0 104-105 3.25 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.075 0.0 0.0 0.0 0.0 110-111 4.4375 0.0 0.0 0.0 0.0 112-113 4.9125 0.0 0.0 0.0 0.0 114-115 5.300000000000001 0.0 0.0 0.0 0.0 116-117 5.8875 0.0 0.0 0.0 0.0 118-119 6.625 0.0 0.0 0.0 0.0 120-121 7.4125 0.0 0.0 0.0 0.0 122-123 8.100000000000001 0.0 0.0 0.0 0.0 124-125 8.65 0.0 0.0 0.0 0.0 126-127 9.0375 0.0 0.0 0.0 0.0 128-129 9.475 0.0 0.0 0.0 0.0 130-131 9.9875 0.0 0.0 0.0 0.0 132-133 10.7 0.0 0.0 0.0 0.0 134-135 11.2625 0.0 0.0 0.0 0.0 136-137 11.9 0.0 0.0 0.0 0.0 138-139 12.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226868 spots for SRR6941616.sra Written 1226868 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra Read 1226860 spots for SRR6941616.sra Written 1226860 spots for SRR6941616.sra SRR ids: ['SRR6941616.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fr4rhx62 SRR6941616.sra spots: 24537208 blocks: [[1, 1226860], [1226861, 2453720], [2453721, 3680580], [3680581, 4907440], [4907441, 6134300], [6134301, 7361160], [7361161, 8588020], [8588021, 9814880], [9814881, 11041740], [11041741, 12268600], [12268601, 13495460], [13495461, 14722320], [14722321, 15949180], [15949181, 17176040], [17176041, 18402900], [18402901, 19629760], [19629761, 20856620], [20856621, 22083480], [22083481, 23310340], [23310341, 24537208]] SRR6941616 file size 8293154 SRR6941616 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941616 SRR6941616_1.fastq SRR6941616_2.fastq Input file: SRR6941616_1.fastq Paired file: SRR6941616_2.fastq trimmed: SRR6941616-trimmed-pair1.fastq, SRR6941616-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:18:55 2024 >> started Fri Dec 6 13:19:31 2024 >> done (35.666s) 24537208 read pairs processed; of these: 19226 ( 0.08%) short read pairs filtered out after trimming by size control 98718 ( 0.40%) empty read pairs filtered out after trimming by size control 24419264 (99.52%) read pairs available; of these: 12743135 (52.18%) trimmed read pairs available after processing 11676129 (47.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 12 0.00% 20 19 0.00% 21 20 0.00% 22 10 0.00% 23 20 0.00% 24 21 0.00% 25 20 0.00% 26 20 0.00% 27 10 0.00% 28 22 0.00% 29 27 0.00% 30 26 0.00% 31 24 0.00% 32 22 0.00% 33 25 0.00% 34 26 0.00% 35 29 0.00% 36 30 0.00% 37 43 0.00% 38 46 0.00% 39 44 0.00% 40 61 0.00% 41 69 0.00% 42 84 0.00% 43 63 0.00% 44 98 0.00% 45 124 0.00% 46 152 0.00% 47 138 0.00% 48 156 0.00% 49 219 0.00% 50 225 0.00% 51 246 0.00% 52 314 0.00% 53 325 0.00% 54 386 0.00% 55 438 0.00% 56 458 0.00% 57 587 0.00% 58 637 0.00% 59 724 0.00% 60 906 0.00% 61 982 0.00% 62 1080 0.00% 63 1374 0.01% 64 1534 0.01% 65 1669 0.01% 66 1903 0.01% 67 2243 0.01% 68 2586 0.01% 69 2829 0.01% 70 3317 0.01% 71 3767 0.02% 72 4544 0.02% 73 5009 0.02% 74 5570 0.02% 75 6251 0.03% 76 6952 0.03% 77 7902 0.03% 78 8411 0.03% 79 9455 0.04% 80 10616 0.04% 81 11874 0.05% 82 13154 0.05% 83 14693 0.06% 84 17013 0.07% 85 18663 0.08% 86 20118 0.08% 87 21813 0.09% 88 23147 0.09% 89 24389 0.10% 90 25805 0.11% 91 27831 0.11% 92 29892 0.12% 93 31918 0.13% 94 33636 0.14% 95 35595 0.15% 96 37208 0.15% 97 39064 0.16% 98 40358 0.17% 99 41353 0.17% 100 44212 0.18% 101 45257 0.19% 102 47851 0.20% 103 49328 0.20% 104 50541 0.21% 105 53028 0.22% 106 55179 0.23% 107 56209 0.23% 108 57455 0.24% 109 60091 0.25% 110 61560 0.25% 111 63575 0.26% 112 65309 0.27% 113 67565 0.28% 114 69320 0.28% 115 72529 0.30% 116 73288 0.30% 117 74798 0.31% 118 76787 0.31% 119 77497 0.32% 120 79263 0.32% 121 81085 0.33% 122 82843 0.34% 123 84986 0.35% 124 88271 0.36% 125 90037 0.37% 126 91612 0.38% 127 93907 0.38% 128 96191 0.39% 129 98569 0.40% 130 100667 0.41% 131 102777 0.42% 132 105726 0.43% 133 109496 0.45% 134 112671 0.46% 135 117960 0.48% 136 121841 0.50% 137 125724 0.51% 138 131410 0.54% 139 140142 0.57% 140 145975 0.60% 141 156535 0.64% 142 170116 0.70% 143 186518 0.76% 144 212522 0.87% 145 245168 1.00% 146 295484 1.21% 147 379049 1.55% 148 539765 2.21% 149 1031495 4.22% 150 5501498 22.53% 151 11676129 47.82% 24419264 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=2.4 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=166.93 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=22.5 sequence=CCTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=30 prefix-density=0.30 prefix-fanout=2.5 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=122.77 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=16.2 sequence=CCGCCGCCGCCG SRR6941616 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:20:22 Started mapping on | Dec 06 13:20:22 Finished on | Dec 06 13:23:31 Mapping speed, Million of reads per hour | 465.13 Number of input reads | 24419264 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 23034063 Uniquely mapped reads % | 94.33% Average mapped length | 288.83 Number of splices: Total | 24125692 Number of splices: Annotated (sjdb) | 22609200 Number of splices: GT/AG | 23744434 Number of splices: GC/AG | 291603 Number of splices: AT/AC | 12183 Number of splices: Non-canonical | 77472 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.53 Insertion rate per base | 0.03% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424401 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 30533 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 973771 973771 973771 N_multimapping 424401 424401 424401 N_noFeature 1060826 22295301 1309214 N_ambiguous 580894 3765 89938 UnstrandedReadsAssigned:21392343 PositiveStrandReadsAssigned:734997 NegativeStrandReadsAssigned:21634911 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6941616 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941616-trimmed-pair1.fastq SRR6941616-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,419,264 reads, 21,701,425 reads pseudoaligned [quant] estimated average fragment length: 240.201 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6941616.ke.tsv 35125 SRR6941616.se.tsv 88098 total ==> SRR6941616.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.36 0 0 PNS24247 1044 804.799 136.299 11.3556 PNS24249 1928 1688.8 123.761 4.91372 PNS24246 1044 804.799 136.299 11.3556 PNS24248 1044 804.799 136.299 11.3556 PNS24244 1471 1231.8 132.341 7.20376 PNS24243 293 104.759 0 0 KQK14069 1603 1363.8 21002.6 1032.59 KQK14071 474 251.197 606.349 161.85 ==> SRR6941616.se.tsv <== BRADI_1g14170v3 24801 BRADI_1g53295v3 1088 BRADI_1g59795v3 1200 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 510 BRADI_1g74790v3 52 BRADI_1g09890v3 0 BRADI_1g77505v3 593 BRADI_1g48960v3 1 SRR6941616 completed mapping pipeline successfully