Starting /dee2/code/volunteer_pipeline.sh SRR6941617 current disk space = 1551018561536 free memory = 1595335184 SRR6941617 SRAfilesize 75a5725da929011e761f5c860935e5a1 SRR6941617.sra SRR6941617.sra file validated SRR6941617 is paired end SRR6941617 is conventional basespace SRR6941617 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941617_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.929 33.0 33.0 34.0 28.0 34.0 2 32.69975 34.0 33.0 34.0 30.0 34.0 3 32.902 34.0 33.0 34.0 32.0 34.0 4 33.192 34.0 33.0 34.0 32.0 34.0 5 33.2905 34.0 33.0 34.0 33.0 34.0 6 37.09525 38.0 37.0 38.0 36.0 38.0 7 37.342 38.0 38.0 38.0 37.0 38.0 8 37.4795 38.0 38.0 38.0 37.0 38.0 9 37.5725 38.0 38.0 38.0 38.0 38.0 10-14 37.50314999999999 38.0 38.0 38.0 37.6 38.0 15-19 37.5493 38.0 38.0 38.0 38.0 38.0 20-24 37.516200000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.514250000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.478300000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.4947 38.0 38.0 38.0 37.6 38.0 40-44 37.47615 38.0 38.0 38.0 38.0 38.0 45-49 37.42235 38.0 38.0 38.0 37.6 38.0 50-54 37.390100000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.394549999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.35145 38.0 38.0 38.0 37.0 38.0 65-69 37.26965 38.0 38.0 38.0 37.0 38.0 70-74 37.2236 38.0 38.0 38.0 36.2 38.0 75-79 37.246700000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.170100000000005 38.0 38.0 38.0 36.0 38.0 85-89 37.06715 38.0 38.0 38.0 36.0 38.0 90-94 37.0897 38.0 38.0 38.0 36.0 38.0 95-99 36.92235 38.0 38.0 38.0 35.4 38.0 100-104 36.9269 38.0 38.0 38.0 35.2 38.0 105-109 36.8303 38.0 38.0 38.0 35.0 38.0 110-114 36.586149999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.42165 38.0 38.0 38.0 34.0 38.0 120-124 36.43485 38.0 38.0 38.0 34.0 38.0 125-129 36.376250000000006 38.0 38.0 38.0 34.0 38.0 130-134 36.185 38.0 37.8 38.0 33.4 38.0 135-139 35.88045 38.0 36.4 38.0 32.6 38.0 140-144 35.71565 38.0 36.0 38.0 32.2 38.0 145-149 35.05085 38.0 35.8 38.0 31.0 38.0 150-151 31.0535 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 2.0 23 2.0 24 5.0 25 5.0 26 7.0 27 15.0 28 14.0 29 33.0 30 32.0 31 41.0 32 53.0 33 96.0 34 114.0 35 188.0 36 508.0 37 2876.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.230277185501066 10.23454157782516 8.368869936034114 38.16631130063966 2 23.030757689422355 11.852963240810203 35.63390847711928 29.48237059264816 3 20.325 16.400000000000002 25.025 38.25 4 25.85 23.925 21.9 28.325 5 26.5 28.025 23.375 22.1 6 22.275 32.574999999999996 23.525 21.625 7 17.325 24.725 38.775 19.175 8 20.125 24.875 28.599999999999998 26.400000000000002 9 20.575 22.525000000000002 33.025 23.875 10-14 22.74 26.44 25.724999999999998 25.095 15-19 22.689999999999998 25.515 26.16 25.635 20-24 22.52 26.215 25.955000000000002 25.31 25-29 22.400000000000002 26.19 26.105 25.305 30-34 23.26 24.91 26.105 25.724999999999998 35-39 22.82 25.525 26.185000000000002 25.47 40-44 23.305 25.4 25.825 25.47 45-49 22.935 25.715 25.545 25.805 50-54 23.47 25.874999999999996 25.105 25.55 55-59 22.564999999999998 25.695 25.27 26.47 60-64 23.095 25.83 25.705 25.369999999999997 65-69 23.265 25.46 25.490000000000002 25.785000000000004 70-74 22.67 25.3 26.07 25.96 75-79 23.445 25.435000000000002 25.03 26.090000000000003 80-84 23.1 25.885 25.415 25.6 85-89 23.195 25.55 25.555 25.7 90-94 23.305 25.230000000000004 25.174999999999997 26.290000000000003 95-99 23.225 25.650000000000002 25.53 25.595000000000002 100-104 23.535 25.979999999999997 24.73 25.755 105-109 23.015 25.45 25.775 25.759999999999998 110-114 23.190871784606145 26.138524672204984 25.457912120908816 25.212691422280052 115-119 23.361723446893787 25.876753507014026 25.120240480961925 25.641282565130258 120-124 23.655 26.0 24.81 25.535000000000004 125-129 23.395 25.814999999999998 25.165 25.624999999999996 130-134 23.415 25.740000000000002 25.380000000000003 25.465 135-139 23.985 25.740000000000002 25.045 25.230000000000004 140-144 24.03 25.230000000000004 25.174999999999997 25.564999999999998 145-149 23.565 25.814999999999998 25.005 25.615 150-151 23.8625 25.8125 24.6625 25.662499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 4.5 28 5.0 29 6.0 30 8.0 31 10.5 32 21.0 33 30.5 34 34.0 35 35.5 36 47.5 37 76.0 38 94.5 39 117.5 40 136.0 41 149.5 42 163.5 43 179.0 44 191.5 45 191.5 46 215.0 47 206.5 48 173.5 49 173.0 50 165.0 51 151.0 52 130.0 53 115.0 54 111.0 55 96.5 56 91.5 57 86.0 58 72.0 59 67.5 60 69.5 61 59.0 62 55.5 63 56.5 64 49.0 65 53.5 66 60.5 67 48.5 68 37.0 69 37.0 70 34.0 71 21.5 72 14.5 73 17.0 74 12.0 75 6.0 76 4.5 77 2.0 78 1.5 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.2 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.09 115-119 0.2 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.05 0.0 0.0 0.0 0.0 92-93 1.2000000000000002 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.7625000000000002 0.0 0.0 0.0 0.0 100-101 1.8875000000000002 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.525 0.0 0.0 0.0 0.0 112-113 3.8625 0.0 0.0 0.0 0.0 114-115 4.362500000000001 0.0 0.0 0.0 0.0 116-117 4.8125 0.0 0.0 0.0 0.0 118-119 5.25 0.0 0.0 0.0 0.0 120-121 5.7375 0.0 0.0 0.0 0.0 122-123 6.15 0.0 0.0 0.0 0.0 124-125 6.6375 0.0 0.0 0.0 0.0 126-127 7.1875 0.0 0.0 0.0 0.0 128-129 7.762499999999999 0.0 0.0 0.0 0.0 130-131 8.5 0.0 0.0 0.0 0.0 132-133 8.975 0.0 0.0 0.0 0.0 134-135 9.6625 0.0 0.0 0.0 0.0 136-137 10.25 0.0 0.0 0.0 0.0 138-139 10.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCAGC 10 0.0068396386 144.9375 6 TTGGAGT 10 0.0068396386 144.9375 2 TTCCATC 40 0.007674091 18.117188 140-144 >>END_MODULE SRR6941617 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941617_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1685 34.0 33.0 34.0 33.0 34.0 2 33.25125 34.0 33.0 34.0 33.0 34.0 3 33.29425 34.0 33.0 34.0 33.0 34.0 4 33.254 34.0 33.0 34.0 33.0 34.0 5 33.21075 34.0 33.0 34.0 33.0 34.0 6 37.2645 38.0 38.0 38.0 37.0 38.0 7 37.4405 38.0 38.0 38.0 37.0 38.0 8 37.3995 38.0 38.0 38.0 38.0 38.0 9 37.462 38.0 38.0 38.0 38.0 38.0 10-14 37.426249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.4092 38.0 38.0 38.0 38.0 38.0 20-24 37.39145 38.0 38.0 38.0 38.0 38.0 25-29 37.32525 38.0 38.0 38.0 37.4 38.0 30-34 37.3085 38.0 38.0 38.0 37.2 38.0 35-39 37.3183 38.0 38.0 38.0 37.6 38.0 40-44 37.2889 38.0 38.0 38.0 37.2 38.0 45-49 37.34325 38.0 38.0 38.0 37.6 38.0 50-54 37.245400000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.22165 38.0 38.0 38.0 37.0 38.0 60-64 37.1923 38.0 38.0 38.0 37.0 38.0 65-69 37.0742 38.0 38.0 38.0 36.6 38.0 70-74 37.110299999999995 38.0 38.0 38.0 36.6 38.0 75-79 37.066050000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.9106 38.0 38.0 38.0 35.8 38.0 85-89 36.8818 38.0 38.0 38.0 36.0 38.0 90-94 36.8457 38.0 38.0 38.0 35.6 38.0 95-99 36.811949999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.6667 38.0 38.0 38.0 35.0 38.0 105-109 36.39875 38.0 38.0 38.0 34.2 38.0 110-114 36.03955 38.0 37.8 38.0 33.2 38.0 115-119 35.715250000000005 38.0 37.2 38.0 30.8 38.0 120-124 35.8111 38.0 37.2 38.0 32.2 38.0 125-129 35.880900000000004 38.0 37.4 38.0 33.0 38.0 130-134 35.6901 38.0 36.8 38.0 31.4 38.0 135-139 35.408699999999996 38.0 36.2 38.0 31.0 38.0 140-144 35.0259 38.0 35.8 38.0 30.2 38.0 145-149 33.86735 38.0 34.8 38.0 23.2 38.0 150-151 28.19625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 3.0 16 2.0 17 0.0 18 4.0 19 2.0 20 2.0 21 4.0 22 3.0 23 9.0 24 6.0 25 8.0 26 21.0 27 15.0 28 23.0 29 29.0 30 43.0 31 42.0 32 65.0 33 90.0 34 147.0 35 242.0 36 475.0 37 2751.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 18.725 11.075 30.3 2 28.375 24.099999999999998 26.825 20.7 3 22.425 26.424999999999997 27.975 23.175 4 26.224999999999998 31.125000000000004 20.150000000000002 22.5 5 27.375 32.725 20.775 19.125 6 23.549999999999997 35.175 20.5 20.775 7 23.150000000000002 18.75 35.4 22.7 8 23.3 24.05 25.05 27.6 9 23.625 22.725 27.775 25.874999999999996 10-14 25.169999999999998 26.6 23.705000000000002 24.525 15-19 25.71 25.44 24.705 24.145 20-24 25.430000000000003 25.580000000000002 24.6 24.39 25-29 25.88 25.369999999999997 24.685000000000002 24.065 30-34 25.335 25.775 24.86 24.03 35-39 24.73 25.855 25.330000000000002 24.085 40-44 25.814999999999998 24.84 25.045 24.3 45-49 25.590000000000003 26.39 24.169999999999998 23.849999999999998 50-54 25.790000000000003 25.590000000000003 25.119999999999997 23.5 55-59 25.275 25.724999999999998 24.93 24.07 60-64 25.615 25.22 25.490000000000002 23.674999999999997 65-69 25.82 25.319999999999997 25.19 23.669999999999998 70-74 25.935000000000002 25.72 24.855 23.49 75-79 26.13 25.505 24.985 23.380000000000003 80-84 25.919999999999998 25.46 24.884999999999998 23.735 85-89 26.05 25.86 24.715 23.375 90-94 25.945 25.724999999999998 24.845 23.485 95-99 25.55 26.32 25.045 23.085 100-104 26.119999999999997 25.790000000000003 24.884999999999998 23.205000000000002 105-109 26.265 25.34 25.275 23.119999999999997 110-114 26.43 26.11 24.36 23.1 115-119 26.8 26.1 23.985 23.115 120-124 26.619999999999997 26.025 24.725 22.63 125-129 26.72 26.06 24.57 22.650000000000002 130-134 26.77 26.0 24.685000000000002 22.545 135-139 27.279999999999998 26.02 24.52 22.18 140-144 27.555000000000003 25.590000000000003 24.86 21.995 145-149 27.389999999999997 25.990000000000002 24.705 21.915000000000003 150-151 27.55 26.75 23.6125 22.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 4.0 27 3.5 28 5.5 29 9.0 30 10.0 31 12.0 32 16.5 33 21.0 34 28.5 35 41.5 36 50.5 37 60.5 38 82.0 39 101.5 40 129.0 41 145.0 42 164.5 43 179.0 44 189.5 45 206.0 46 180.0 47 170.0 48 179.5 49 178.5 50 163.5 51 140.0 52 128.5 53 116.5 54 102.5 55 100.0 56 97.5 57 80.5 58 76.0 59 81.0 60 74.0 61 76.0 62 82.5 63 68.0 64 57.5 65 55.0 66 51.0 67 54.0 68 47.5 69 34.0 70 28.0 71 27.0 72 28.0 73 24.5 74 12.0 75 8.0 76 8.0 77 3.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39561823218332 98.675 2 0.528834046839587 1.05 3 0.02518257365902795 0.075 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.525 0.0 0.0 0.0 0.0 106-107 2.9125 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.4125 0.0 0.0 0.0 0.0 116-117 4.8625 0.0 0.0 0.0 0.0 118-119 5.3 0.0 0.0 0.0 0.0 120-121 5.7625 0.0 0.0 0.0 0.0 122-123 6.1625 0.0 0.0 0.0 0.0 124-125 6.65 0.0 0.0 0.0 0.0 126-127 7.2125 0.0 0.0 0.0 0.0 128-129 7.7875 0.0 0.0 0.0 0.0 130-131 8.525 0.0 0.0 0.0 0.0 132-133 8.9875 0.0 0.0 0.0 0.0 134-135 9.6375 0.0 0.0 0.0 0.0 136-137 10.2375 0.0 0.0 0.0 0.0 138-139 10.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAAAA 10 0.006830828 145.0 5 ATGTGTA 35 0.0033124194 62.14286 145 >>END_MODULE Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra Read 1266398 spots for SRR6941617.sra Written 1266398 spots for SRR6941617.sra Read 1266384 spots for SRR6941617.sra Written 1266384 spots for SRR6941617.sra SRR ids: ['SRR6941617.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ng13df0 SRR6941617.sra spots: 25327694 blocks: [[1, 1266384], [1266385, 2532768], [2532769, 3799152], [3799153, 5065536], [5065537, 6331920], [6331921, 7598304], [7598305, 8864688], [8864689, 10131072], [10131073, 11397456], [11397457, 12663840], [12663841, 13930224], [13930225, 15196608], [15196609, 16462992], [16462993, 17729376], [17729377, 18995760], [18995761, 20262144], [20262145, 21528528], [21528529, 22794912], [22794913, 24061296], [24061297, 25327694]] SRR6941617 file size 8561024 SRR6941617 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941617 SRR6941617_1.fastq SRR6941617_2.fastq Input file: SRR6941617_1.fastq Paired file: SRR6941617_2.fastq trimmed: SRR6941617-trimmed-pair1.fastq, SRR6941617-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:19:44 2024 >> started Fri Dec 6 13:20:09 2024 >> done (25.306s) 25327694 read pairs processed; of these: 13768 ( 0.05%) short read pairs filtered out after trimming by size control 13767 ( 0.05%) empty read pairs filtered out after trimming by size control 25300159 (99.89%) read pairs available; of these: 12553761 (49.62%) trimmed read pairs available after processing 12746398 (50.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 9 0.00% 21 11 0.00% 22 9 0.00% 23 12 0.00% 24 14 0.00% 25 16 0.00% 26 12 0.00% 27 13 0.00% 28 10 0.00% 29 25 0.00% 30 12 0.00% 31 21 0.00% 32 22 0.00% 33 21 0.00% 34 19 0.00% 35 19 0.00% 36 22 0.00% 37 26 0.00% 38 23 0.00% 39 38 0.00% 40 50 0.00% 41 45 0.00% 42 54 0.00% 43 68 0.00% 44 68 0.00% 45 71 0.00% 46 75 0.00% 47 74 0.00% 48 97 0.00% 49 106 0.00% 50 151 0.00% 51 159 0.00% 52 188 0.00% 53 201 0.00% 54 255 0.00% 55 283 0.00% 56 322 0.00% 57 385 0.00% 58 409 0.00% 59 503 0.00% 60 576 0.00% 61 677 0.00% 62 790 0.00% 63 901 0.00% 64 987 0.00% 65 1158 0.00% 66 1286 0.01% 67 1471 0.01% 68 1711 0.01% 69 1989 0.01% 70 2303 0.01% 71 2562 0.01% 72 3014 0.01% 73 3580 0.01% 74 3854 0.02% 75 4525 0.02% 76 5058 0.02% 77 5587 0.02% 78 6096 0.02% 79 7005 0.03% 80 7638 0.03% 81 8714 0.03% 82 9767 0.04% 83 10927 0.04% 84 12979 0.05% 85 14441 0.06% 86 15496 0.06% 87 16584 0.07% 88 17910 0.07% 89 18871 0.07% 90 20333 0.08% 91 21890 0.09% 92 23730 0.09% 93 25059 0.10% 94 27572 0.11% 95 29144 0.12% 96 30463 0.12% 97 32255 0.13% 98 33291 0.13% 99 35180 0.14% 100 36804 0.15% 101 37686 0.15% 102 39866 0.16% 103 42389 0.17% 104 43486 0.17% 105 45910 0.18% 106 47790 0.19% 107 48846 0.19% 108 50477 0.20% 109 52230 0.21% 110 53996 0.21% 111 55377 0.22% 112 57371 0.23% 113 59593 0.24% 114 61969 0.24% 115 64882 0.26% 116 66399 0.26% 117 67846 0.27% 118 70123 0.28% 119 70019 0.28% 120 71529 0.28% 121 72438 0.29% 122 74868 0.30% 123 77465 0.31% 124 80018 0.32% 125 82610 0.33% 126 84063 0.33% 127 86679 0.34% 128 87190 0.34% 129 90260 0.36% 130 92205 0.36% 131 93503 0.37% 132 96562 0.38% 133 101004 0.40% 134 103233 0.41% 135 107646 0.43% 136 112159 0.44% 137 115807 0.46% 138 121013 0.48% 139 129143 0.51% 140 135414 0.54% 141 144444 0.57% 142 158293 0.63% 143 171877 0.68% 144 194502 0.77% 145 226626 0.90% 146 275415 1.09% 147 362686 1.43% 148 538563 2.13% 149 1056922 4.18% 150 5865259 23.18% 151 12746398 50.38% 25300159 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=20 prefix-density=0.62 prefix-fanout=3.1 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=206.62 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=24.5 sequence=CCTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=2.7 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=173.78 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=18.9 sequence=AAGAAGAAGGTCGCGGGCGCCTCTGCGGAGATCCTGGACTCCGCCTCCGCCTACGCCAAGCTGGAGGACAAGCCGGTGGGGCAGTACATGGAGAAGGCCGAGGTGTAC SRR6941617 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:20:56 Started mapping on | Dec 06 13:20:56 Finished on | Dec 06 13:24:21 Mapping speed, Million of reads per hour | 444.30 Number of input reads | 25300159 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 23921107 Uniquely mapped reads % | 94.55% Average mapped length | 290.73 Number of splices: Total | 25373903 Number of splices: Annotated (sjdb) | 23789892 Number of splices: GT/AG | 24978970 Number of splices: GC/AG | 300340 Number of splices: AT/AC | 13259 Number of splices: Non-canonical | 81334 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 444337 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 33101 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 944190 944190 944190 N_multimapping 444337 444337 444337 N_noFeature 1104917 23144053 1372756 N_ambiguous 601186 4059 91770 UnstrandedReadsAssigned:22215004 PositiveStrandReadsAssigned:772995 NegativeStrandReadsAssigned:22456581 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6941617 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941617-trimmed-pair1.fastq SRR6941617-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,300,159 reads, 22,486,187 reads pseudoaligned [quant] estimated average fragment length: 247.343 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6941617.ke.tsv 35125 SRR6941617.se.tsv 88098 total ==> SRR6941617.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.043 0 0 PNS24247 1044 797.657 119.183 9.73369 PNS24249 1928 1681.66 100.939 3.91023 PNS24246 1044 797.657 119.183 9.73369 PNS24248 1044 797.657 119.183 9.73369 PNS24244 1471 1224.66 142.511 7.58077 PNS24243 293 100.858 0 0 KQK14069 1603 1356.66 17707.4 850.282 KQK14071 474 245.419 384.656 102.104 ==> SRR6941617.se.tsv <== BRADI_1g14170v3 20607 BRADI_1g53295v3 912 BRADI_1g59795v3 1122 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 938 BRADI_1g74790v3 38 BRADI_1g09890v3 2 BRADI_1g77505v3 519 BRADI_1g48960v3 0 SRR6941617 completed mapping pipeline successfully