Starting /dee2/code/volunteer_pipeline.sh SRR6941618 current disk space = 1551018561536 free memory = 1595334764 SRR6941618 SRAfilesize e1b7accc8de75a26f47f7481409504d7 SRR6941618.sra SRR6941618.sra file validated SRR6941618 is paired end SRR6941618 is conventional basespace SRR6941618 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941618_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.107 34.0 33.0 34.0 32.0 34.0 2 32.892 34.0 33.0 34.0 32.0 34.0 3 33.05525 34.0 33.0 34.0 32.0 34.0 4 33.12375 34.0 33.0 34.0 32.0 34.0 5 33.232 34.0 33.0 34.0 32.0 34.0 6 36.98625 38.0 37.0 38.0 36.0 38.0 7 37.3515 38.0 38.0 38.0 37.0 38.0 8 37.41425 38.0 38.0 38.0 37.0 38.0 9 37.5275 38.0 38.0 38.0 38.0 38.0 10-14 37.4902 38.0 38.0 38.0 37.6 38.0 15-19 37.4504 38.0 38.0 38.0 37.2 38.0 20-24 37.42614999999999 38.0 38.0 38.0 37.4 38.0 25-29 37.342150000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.3057 38.0 38.0 38.0 37.0 38.0 35-39 37.3385 38.0 38.0 38.0 37.0 38.0 40-44 37.33735 38.0 38.0 38.0 37.0 38.0 45-49 37.406949999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.31925 38.0 38.0 38.0 37.0 38.0 55-59 37.296299999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.23675 38.0 38.0 38.0 36.8 38.0 65-69 37.0266 38.0 38.0 38.0 35.8 38.0 70-74 37.091150000000006 38.0 38.0 38.0 36.0 38.0 75-79 37.15715 38.0 38.0 38.0 36.0 38.0 80-84 37.0695 38.0 38.0 38.0 36.0 38.0 85-89 36.831849999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.857350000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.8837 38.0 38.0 38.0 35.2 38.0 100-104 36.7145 38.0 38.0 38.0 34.4 38.0 105-109 36.4694 38.0 37.8 38.0 34.0 38.0 110-114 36.317750000000004 38.0 38.0 38.0 33.8 38.0 115-119 36.303999999999995 38.0 37.8 38.0 33.8 38.0 120-124 36.2822 38.0 37.8 38.0 33.8 38.0 125-129 36.19285 38.0 37.6 38.0 33.4 38.0 130-134 36.09215 38.0 37.0 38.0 33.0 38.0 135-139 35.91330000000001 38.0 36.2 38.0 33.0 38.0 140-144 35.61335 38.0 36.0 38.0 32.2 38.0 145-149 35.044200000000004 38.0 35.6 38.0 30.6 38.0 150-151 30.954625 35.5 29.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.0 19 3.0 20 2.0 21 2.0 22 3.0 23 5.0 24 3.0 25 6.0 26 9.0 27 19.0 28 20.0 29 33.0 30 29.0 31 42.0 32 75.0 33 82.0 34 160.0 35 218.0 36 546.0 37 2738.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.29817339850784 10.059171597633137 6.277334705428352 40.36532029843067 2 21.025 11.799999999999999 37.9 29.275000000000002 3 19.504876219054765 13.203300825206302 26.231557889472366 41.06026506626657 4 25.424999999999997 21.9 22.5 30.175 5 25.8 28.175 24.45 21.575 6 22.025 33.324999999999996 23.400000000000002 21.25 7 17.8 24.224999999999998 37.95 20.025000000000002 8 19.975 23.275000000000002 30.625000000000004 26.125 9 19.225 20.825 34.325 25.624999999999996 10-14 22.884999999999998 26.515 25.775 24.825 15-19 22.355 25.055 26.93 25.66 20-24 22.075 25.605 26.195 26.125 25-29 22.49 25.169999999999998 26.515 25.825 30-34 22.68 25.35 26.165 25.805 35-39 22.48 25.919999999999998 25.919999999999998 25.679999999999996 40-44 23.115 25.419999999999998 26.16 25.305 45-49 23.21 25.590000000000003 25.569999999999997 25.629999999999995 50-54 22.735 25.595000000000002 25.740000000000002 25.929999999999996 55-59 23.32 25.96 25.155 25.564999999999998 60-64 22.755 25.180000000000003 26.105 25.96 65-69 23.25 25.485000000000003 25.965 25.3 70-74 23.47 25.319999999999997 25.655 25.555 75-79 23.599999999999998 25.0 25.335 26.064999999999998 80-84 23.61 25.045 26.185000000000002 25.16 85-89 23.555 25.4 25.130000000000003 25.915 90-94 22.955000000000002 25.335 26.005 25.705 95-99 23.075000000000003 25.324999999999996 25.735000000000003 25.865 100-104 23.75975195039008 25.35507101420284 25.08001600320064 25.805161032206442 105-109 23.98 25.145 24.98 25.895000000000003 110-114 23.436873747494992 25.38076152304609 25.130260521042086 26.052104208416832 115-119 23.971985992996498 25.672836418209105 25.137568784392194 25.217608804402204 120-124 23.21696508952686 25.727718315494645 24.892467740322097 26.162848854656396 125-129 23.95 25.564999999999998 24.884999999999998 25.6 130-134 23.5 25.72 24.775 26.005 135-139 23.47 25.35 25.045 26.135 140-144 23.03 25.569999999999997 25.679999999999996 25.72 145-149 23.09 25.564999999999998 24.985 26.36 150-151 23.175 25.4875 25.0375 26.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 0.0 27 1.5 28 2.0 29 2.5 30 7.0 31 11.0 32 16.5 33 18.0 34 20.0 35 38.0 36 57.0 37 71.0 38 87.5 39 111.0 40 140.5 41 169.0 42 182.5 43 184.5 44 194.5 45 207.0 46 207.5 47 201.5 48 187.5 49 163.5 50 156.0 51 152.5 52 141.0 53 127.0 54 108.5 55 88.0 56 76.0 57 75.0 58 72.5 59 73.5 60 75.5 61 71.0 62 62.0 63 66.0 64 61.5 65 54.0 66 52.0 67 41.5 68 35.0 69 28.0 70 25.5 71 19.0 72 14.5 73 14.0 74 9.5 75 5.5 76 3.5 77 3.0 78 3.0 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.2 115-119 0.05 120-124 0.03 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.5028916268544128 1.0 3 0.0 0.0 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.47500000000000003 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.575 0.0 0.0 0.0 0.0 106-107 2.9625 0.0 0.0 0.0 0.0 108-109 3.2874999999999996 0.0 0.0 0.0 0.0 110-111 3.7125000000000004 0.0 0.0 0.0 0.0 112-113 4.262499999999999 0.0 0.0 0.0 0.0 114-115 4.7625 0.0 0.0 0.0 0.0 116-117 5.2375 0.0 0.0 0.0 0.0 118-119 5.775 0.0 0.0 0.0 0.0 120-121 6.199999999999999 0.0 0.0 0.0 0.0 122-123 6.775 0.0 0.0 0.0 0.0 124-125 7.4875 0.0 0.0 0.0 0.0 126-127 8.15 0.0 0.0 0.0 0.0 128-129 8.7875 0.0 0.0 0.0 0.0 130-131 9.4625 0.0 0.0 0.0 0.0 132-133 10.1125 0.0 0.0 0.0 0.0 134-135 10.6375 0.0 0.0 0.0 0.0 136-137 11.3875 0.0 0.0 0.0 0.0 138-139 11.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTGG 10 0.0068803662 144.65 8 CGAGTTG 10 0.0068803662 144.65 7 AGTTGGT 10 0.0068803662 144.65 9 ATCGAGT 10 0.0068803662 144.65 5 TCGAGTT 10 0.0068803662 144.65 6 >>END_MODULE SRR6941618 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941618_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8965 33.0 33.0 34.0 32.0 34.0 2 33.02775 34.0 33.0 34.0 32.0 34.0 3 33.05825 34.0 33.0 34.0 32.0 34.0 4 33.023 34.0 33.0 34.0 32.0 34.0 5 32.9655 34.0 33.0 34.0 32.0 34.0 6 37.21925 38.0 38.0 38.0 37.0 38.0 7 37.235 38.0 38.0 38.0 37.0 38.0 8 37.15775 38.0 38.0 38.0 37.0 38.0 9 37.23 38.0 38.0 38.0 37.0 38.0 10-14 37.183 38.0 38.0 38.0 37.0 38.0 15-19 37.138400000000004 38.0 38.0 38.0 36.6 38.0 20-24 37.112049999999996 38.0 38.0 38.0 36.4 38.0 25-29 37.1002 38.0 38.0 38.0 36.0 38.0 30-34 37.1095 38.0 38.0 38.0 36.8 38.0 35-39 37.03235 38.0 38.0 38.0 36.2 38.0 40-44 37.087650000000004 38.0 38.0 38.0 36.4 38.0 45-49 37.05160000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.00015 38.0 38.0 38.0 36.0 38.0 55-59 36.94545 38.0 38.0 38.0 35.8 38.0 60-64 36.8859 38.0 38.0 38.0 35.8 38.0 65-69 36.79445 38.0 38.0 38.0 35.4 38.0 70-74 36.79815 38.0 38.0 38.0 35.2 38.0 75-79 36.761 38.0 38.0 38.0 35.2 38.0 80-84 36.63135 38.0 38.0 38.0 35.0 38.0 85-89 36.68925 38.0 38.0 38.0 35.0 38.0 90-94 36.57205 38.0 38.0 38.0 34.6 38.0 95-99 36.4259 38.0 38.0 38.0 34.0 38.0 100-104 36.24715 38.0 38.0 38.0 34.0 38.0 105-109 35.919650000000004 38.0 37.4 38.0 32.4 38.0 110-114 35.3445 38.0 36.2 38.0 29.2 38.0 115-119 35.3468 38.0 36.0 38.0 29.4 38.0 120-124 35.19805 38.0 35.8 38.0 28.6 38.0 125-129 35.199149999999996 38.0 36.0 38.0 29.0 38.0 130-134 35.07135 38.0 36.0 38.0 29.4 38.0 135-139 34.617149999999995 38.0 35.2 38.0 27.8 38.0 140-144 34.049099999999996 38.0 33.4 38.0 24.8 38.0 145-149 32.897149999999996 38.0 33.0 38.0 15.2 38.0 150-151 27.2695 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 2.0 11 0.0 12 2.0 13 3.0 14 1.0 15 1.0 16 0.0 17 4.0 18 4.0 19 6.0 20 6.0 21 10.0 22 7.0 23 10.0 24 11.0 25 11.0 26 24.0 27 30.0 28 33.0 29 39.0 30 45.0 31 69.0 32 87.0 33 115.0 34 182.0 35 259.0 36 636.0 37 2393.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.574999999999996 18.224999999999998 8.924999999999999 33.275 2 27.650000000000002 25.224999999999998 28.525 18.6 3 21.275 26.55 30.025000000000002 22.15 4 26.575 29.7 21.675 22.05 5 27.05 33.525 19.85 19.575 6 23.225 36.5 20.424999999999997 19.85 7 22.275 20.0 34.699999999999996 23.025000000000002 8 23.799999999999997 24.025 25.05 27.125 9 23.3 23.225 28.000000000000004 25.474999999999998 10-14 25.96 26.325 23.419999999999998 24.295 15-19 25.645 25.165 24.39 24.8 20-24 25.130000000000003 25.6 24.69 24.58 25-29 25.900000000000002 25.480000000000004 24.355 24.265 30-34 25.014999999999997 25.88 25.035 24.07 35-39 25.224999999999998 25.64 25.05 24.085 40-44 26.02 24.845 24.825 24.310000000000002 45-49 25.71 25.7 24.73 23.86 50-54 25.81 25.89 24.675 23.625 55-59 25.655 25.28 24.565 24.5 60-64 26.055 25.41 24.915000000000003 23.62 65-69 26.169999999999998 25.759999999999998 24.52 23.549999999999997 70-74 26.165 25.55 25.014999999999997 23.27 75-79 25.779999999999998 25.345000000000002 24.7 24.175 80-84 25.85 25.259999999999998 25.085 23.805 85-89 25.94 25.569999999999997 24.905 23.585 90-94 25.75 25.569999999999997 25.15 23.53 95-99 25.869999999999997 25.64 25.535000000000004 22.955000000000002 100-104 26.395000000000003 25.77 24.36 23.474999999999998 105-109 26.715 25.69 24.685000000000002 22.91 110-114 27.060000000000002 25.590000000000003 24.465 22.884999999999998 115-119 26.935 25.19 24.84 23.035 120-124 26.345000000000002 26.075 24.9 22.68 125-129 27.675 25.795 24.295 22.235 130-134 27.825 26.195 23.755000000000003 22.225 135-139 27.61 26.290000000000003 24.365000000000002 21.735 140-144 27.98 25.874999999999996 24.54 21.605 145-149 27.625 26.400000000000002 23.855 22.12 150-151 27.6625 26.875 23.525 21.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 0.5 24 0.0 25 0.0 26 2.0 27 3.0 28 3.5 29 7.0 30 11.0 31 14.0 32 16.5 33 19.5 34 24.5 35 30.0 36 39.0 37 59.0 38 86.5 39 103.5 40 122.0 41 143.5 42 158.0 43 176.5 44 188.5 45 187.0 46 194.5 47 184.0 48 175.5 49 172.5 50 144.0 51 135.0 52 134.5 53 123.0 54 116.0 55 112.5 56 104.5 57 101.0 58 97.0 59 96.0 60 93.0 61 82.5 62 69.5 63 60.5 64 54.5 65 54.0 66 56.0 67 52.5 68 41.5 69 32.5 70 24.0 71 17.5 72 20.5 73 17.0 74 11.5 75 9.0 76 6.0 77 3.0 78 2.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36820823856458 98.3 2 0.37907505686125853 0.75 3 0.1263583522870862 0.375 4 0.0758150113722517 0.3 5 0.025271670457417232 0.125 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTACGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0499999999999998 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.9125 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.6625 0.0 0.0 0.0 0.0 116-117 5.1125 0.0 0.0 0.0 0.0 118-119 5.625 0.0 0.0 0.0 0.0 120-121 6.050000000000001 0.0 0.0 0.0 0.0 122-123 6.625 0.0 0.0 0.0 0.0 124-125 7.2875 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.5625 0.0 0.0 0.0 0.0 130-131 9.25 0.0 0.0 0.0 0.0 132-133 9.8875 0.0 0.0 0.0 0.0 134-135 10.412500000000001 0.0 0.0 0.0 0.0 136-137 11.2 0.0 0.0 0.0 0.0 138-139 11.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173148 spots for SRR6941618.sra Written 1173148 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra Read 1173145 spots for SRR6941618.sra Written 1173145 spots for SRR6941618.sra SRR ids: ['SRR6941618.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ue1b8tl SRR6941618.sra spots: 23462903 blocks: [[1, 1173145], [1173146, 2346290], [2346291, 3519435], [3519436, 4692580], [4692581, 5865725], [5865726, 7038870], [7038871, 8212015], [8212016, 9385160], [9385161, 10558305], [10558306, 11731450], [11731451, 12904595], [12904596, 14077740], [14077741, 15250885], [15250886, 16424030], [16424031, 17597175], [17597176, 18770320], [18770321, 19943465], [19943466, 21116610], [21116611, 22289755], [22289756, 23462903]] SRR6941618 file size 7929107 SRR6941618 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941618 SRR6941618_1.fastq SRR6941618_2.fastq Input file: SRR6941618_1.fastq Paired file: SRR6941618_2.fastq trimmed: SRR6941618-trimmed-pair1.fastq, SRR6941618-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:23:43 2024 >> started Fri Dec 6 13:24:15 2024 >> done (32.512s) 23462903 read pairs processed; of these: 12269 ( 0.05%) short read pairs filtered out after trimming by size control 9081 ( 0.04%) empty read pairs filtered out after trimming by size control 23441553 (99.91%) read pairs available; of these: 12347620 (52.67%) trimmed read pairs available after processing 11093933 (47.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 14 0.00% 21 14 0.00% 22 16 0.00% 23 10 0.00% 24 11 0.00% 25 13 0.00% 26 20 0.00% 27 20 0.00% 28 13 0.00% 29 13 0.00% 30 13 0.00% 31 14 0.00% 32 19 0.00% 33 17 0.00% 34 21 0.00% 35 21 0.00% 36 26 0.00% 37 32 0.00% 38 31 0.00% 39 39 0.00% 40 50 0.00% 41 48 0.00% 42 35 0.00% 43 56 0.00% 44 60 0.00% 45 62 0.00% 46 63 0.00% 47 70 0.00% 48 76 0.00% 49 127 0.00% 50 164 0.00% 51 139 0.00% 52 159 0.00% 53 186 0.00% 54 224 0.00% 55 260 0.00% 56 267 0.00% 57 323 0.00% 58 362 0.00% 59 427 0.00% 60 501 0.00% 61 555 0.00% 62 662 0.00% 63 795 0.00% 64 901 0.00% 65 958 0.00% 66 1113 0.00% 67 1198 0.01% 68 1438 0.01% 69 1668 0.01% 70 1980 0.01% 71 2286 0.01% 72 2559 0.01% 73 2942 0.01% 74 3247 0.01% 75 3690 0.02% 76 4144 0.02% 77 4641 0.02% 78 5224 0.02% 79 5923 0.03% 80 6577 0.03% 81 7716 0.03% 82 8498 0.04% 83 9464 0.04% 84 11165 0.05% 85 12477 0.05% 86 13667 0.06% 87 14511 0.06% 88 16123 0.07% 89 16957 0.07% 90 18290 0.08% 91 19932 0.09% 92 21269 0.09% 93 23164 0.10% 94 25085 0.11% 95 26889 0.11% 96 28558 0.12% 97 30247 0.13% 98 31915 0.14% 99 32746 0.14% 100 35107 0.15% 101 36705 0.16% 102 38787 0.17% 103 40774 0.17% 104 42681 0.18% 105 44684 0.19% 106 47114 0.20% 107 48335 0.21% 108 49440 0.21% 109 51872 0.22% 110 53210 0.23% 111 54979 0.23% 112 57053 0.24% 113 59631 0.25% 114 60624 0.26% 115 64444 0.27% 116 66278 0.28% 117 67817 0.29% 118 69577 0.30% 119 70589 0.30% 120 72846 0.31% 121 73993 0.32% 122 76014 0.32% 123 78992 0.34% 124 82643 0.35% 125 84323 0.36% 126 86061 0.37% 127 88976 0.38% 128 90440 0.39% 129 92816 0.40% 130 95397 0.41% 131 97197 0.41% 132 101807 0.43% 133 105941 0.45% 134 109211 0.47% 135 113655 0.48% 136 118287 0.50% 137 123353 0.53% 138 129026 0.55% 139 138612 0.59% 140 146078 0.62% 141 156428 0.67% 142 171899 0.73% 143 188926 0.81% 144 217805 0.93% 145 252139 1.08% 146 304998 1.30% 147 396672 1.69% 148 568327 2.42% 149 1079823 4.61% 150 5420007 23.12% 151 11093933 47.33% 23441553 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=27 prefix-density=0.47 prefix-fanout=2.5 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=111.29 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=17.4 sequence=CCTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.21 fanout-score-rank=20 prefix-density=0.29 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=127.25 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=16.4 sequence=AAGAAGAAGGTCGCGGGCGCCTCTGCGGAGATCCTGGACTCCGCCTCCGCCTACGCCAAGCTGGAGGACAAGCCGGTGGGGCAGTACATGGAGAAGGCCGAGGTGTAC SRR6941618 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:24:58 Started mapping on | Dec 06 13:24:58 Finished on | Dec 06 13:28:05 Mapping speed, Million of reads per hour | 451.28 Number of input reads | 23441553 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 22151935 Uniquely mapped reads % | 94.50% Average mapped length | 290.08 Number of splices: Total | 23637791 Number of splices: Annotated (sjdb) | 22146046 Number of splices: GT/AG | 23270301 Number of splices: GC/AG | 283335 Number of splices: AT/AC | 11383 Number of splices: Non-canonical | 72772 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413985 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 39512 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 884523 884523 884523 N_multimapping 413985 413985 413985 N_noFeature 1047199 21412253 1293980 N_ambiguous 578776 3479 85651 UnstrandedReadsAssigned:20525960 PositiveStrandReadsAssigned:736203 NegativeStrandReadsAssigned:20772304 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6941618 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941618-trimmed-pair1.fastq SRR6941618-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,441,553 reads, 20,821,998 reads pseudoaligned [quant] estimated average fragment length: 241.483 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR6941618.ke.tsv 35125 SRR6941618.se.tsv 88098 total ==> SRR6941618.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.241 0 0 PNS24247 1044 803.517 129 11.4411 PNS24249 1928 1687.52 78.2693 3.30534 PNS24246 1044 803.517 129 11.4411 PNS24248 1044 803.517 129 11.4411 PNS24244 1471 1230.52 104.73 6.06533 PNS24243 293 102.546 0 0 KQK14069 1603 1362.52 15697.3 821.025 KQK14071 474 250.264 323.236 92.0438 ==> SRR6941618.se.tsv <== BRADI_1g14170v3 18426 BRADI_1g53295v3 799 BRADI_1g59795v3 1040 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 515 BRADI_1g74790v3 42 BRADI_1g09890v3 0 BRADI_1g77505v3 436 BRADI_1g48960v3 0 SRR6941618 completed mapping pipeline successfully