Starting /dee2/code/volunteer_pipeline.sh SRR6941619 current disk space = 1551042404352 free memory = 1598505236 SRR6941619 SRAfilesize b204f394840a4db7364b300a0355a8d4 SRR6941619.sra SRR6941619.sra file validated SRR6941619 is paired end SRR6941619 is conventional basespace SRR6941619 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941619_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.785 33.0 33.0 34.0 31.0 34.0 2 32.60575 33.0 33.0 34.0 31.0 34.0 3 32.8915 34.0 33.0 34.0 32.0 34.0 4 32.93 34.0 33.0 34.0 32.0 34.0 5 33.0665 34.0 33.0 34.0 32.0 34.0 6 36.74575 38.0 37.0 38.0 34.0 38.0 7 37.20225 38.0 38.0 38.0 36.0 38.0 8 37.3435 38.0 38.0 38.0 37.0 38.0 9 37.406 38.0 38.0 38.0 37.0 38.0 10-14 37.39385 38.0 38.0 38.0 37.0 38.0 15-19 37.46625 38.0 38.0 38.0 37.4 38.0 20-24 37.4138 38.0 38.0 38.0 37.4 38.0 25-29 37.29485 38.0 38.0 38.0 37.0 38.0 30-34 37.277550000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.289 38.0 38.0 38.0 37.0 38.0 40-44 37.32685 38.0 38.0 38.0 37.0 38.0 45-49 37.326350000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2534 38.0 38.0 38.0 37.0 38.0 55-59 37.2557 38.0 38.0 38.0 37.0 38.0 60-64 37.2204 38.0 38.0 38.0 36.8 38.0 65-69 36.96875 38.0 38.0 38.0 35.8 38.0 70-74 37.0328 38.0 38.0 38.0 36.0 38.0 75-79 37.14675 38.0 38.0 38.0 36.0 38.0 80-84 37.04205 38.0 38.0 38.0 36.0 38.0 85-89 36.8705 38.0 38.0 38.0 35.2 38.0 90-94 36.83125 38.0 38.0 38.0 34.8 38.0 95-99 36.87395 38.0 38.0 38.0 35.2 38.0 100-104 36.731 38.0 38.0 38.0 35.0 38.0 105-109 36.42139999999999 38.0 37.8 38.0 34.0 38.0 110-114 36.22355 38.0 38.0 38.0 33.6 38.0 115-119 36.1764 38.0 38.0 38.0 33.4 38.0 120-124 36.247699999999995 38.0 38.0 38.0 33.8 38.0 125-129 36.22240000000001 38.0 38.0 38.0 33.4 38.0 130-134 36.15895 38.0 37.4 38.0 33.0 38.0 135-139 35.89335 38.0 36.2 38.0 32.8 38.0 140-144 35.621950000000005 38.0 36.0 38.0 31.8 38.0 145-149 35.0243 38.0 35.6 38.0 30.4 38.0 150-151 31.032624999999996 35.5 30.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 4.0 21 2.0 22 2.0 23 5.0 24 6.0 25 9.0 26 10.0 27 11.0 28 30.0 29 30.0 30 40.0 31 49.0 32 80.0 33 94.0 34 137.0 35 223.0 36 485.0 37 2777.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.563813429010764 9.226037929267042 5.66376217324449 34.5463864684777 2 20.849999999999998 11.65 36.775000000000006 30.725 3 18.8344172086043 15.107553776888444 25.387693846923458 40.670335167583794 4 25.6 23.875 21.95 28.575 5 25.825 28.9 23.35 21.925 6 23.05 31.825 24.125 21.0 7 17.349999999999998 24.2 39.025 19.425 8 20.375 22.575 28.999999999999996 28.050000000000004 9 20.599999999999998 22.075 31.874999999999996 25.45 10-14 23.875 26.125 25.124999999999996 24.875 15-19 22.965 24.825 26.334999999999997 25.874999999999996 20-24 23.275000000000002 24.54 26.135 26.05 25-29 23.215 25.335 25.540000000000003 25.91 30-34 23.43 25.080000000000002 25.71 25.779999999999998 35-39 23.65 24.665 25.46 26.224999999999998 40-44 23.549999999999997 25.14 25.5 25.81 45-49 23.315 25.124999999999996 25.540000000000003 26.02 50-54 24.025 24.485 25.39 26.1 55-59 23.53 24.94 25.34 26.19 60-64 23.425 25.374999999999996 25.7 25.5 65-69 23.28 25.195 25.580000000000002 25.945 70-74 23.505000000000003 25.224999999999998 25.395 25.874999999999996 75-79 24.19 24.94 25.3 25.569999999999997 80-84 23.585 24.795 26.240000000000002 25.380000000000003 85-89 24.305 24.349999999999998 25.46 25.885 90-94 24.27 25.014999999999997 25.074999999999996 25.64 95-99 23.955000000000002 24.88 25.324999999999996 25.840000000000003 100-104 24.028604290643596 25.308796319447918 25.20878131719758 25.453818072710906 105-109 24.175 25.974999999999998 24.52 25.330000000000002 110-114 23.767490847083607 25.798685992276443 24.71538191484026 25.71844124579969 115-119 24.1129072618988 25.329062609479003 24.92868224813573 25.629347880486463 120-124 24.167083541770886 25.86293146573287 24.072036018009005 25.897948974487246 125-129 23.73 25.674999999999997 24.42 26.174999999999997 130-134 23.77 25.330000000000002 24.575 26.325 135-139 23.48 25.295 24.775 26.450000000000003 140-144 23.97 25.330000000000002 24.654999999999998 26.045 145-149 23.630000000000003 25.395 24.93 26.045 150-151 23.9375 25.575 24.212500000000002 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 2.0 27 5.0 28 7.0 29 6.0 30 6.5 31 12.0 32 14.5 33 18.5 34 24.0 35 29.0 36 43.5 37 55.0 38 72.5 39 94.5 40 116.0 41 133.0 42 166.0 43 200.0 44 204.0 45 202.0 46 199.5 47 182.0 48 165.0 49 171.0 50 171.0 51 146.5 52 135.0 53 137.0 54 110.0 55 93.0 56 88.5 57 86.5 58 90.5 59 86.5 60 86.0 61 82.0 62 77.0 63 68.0 64 61.5 65 56.0 66 42.0 67 41.0 68 42.0 69 32.5 70 24.0 71 21.5 72 23.5 73 19.0 74 11.5 75 12.0 76 10.0 77 5.0 78 3.5 79 2.0 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.305 115-119 0.095 120-124 0.05 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.8 0.0 0.0 0.0 0.0 98-99 2.1125 0.0 0.0 0.0 0.0 100-101 2.4875 0.0 0.0 0.0 0.0 102-103 2.925 0.0 0.0 0.0 0.0 104-105 3.2125 0.0 0.0 0.0 0.0 106-107 3.625 0.0 0.0 0.0 0.0 108-109 3.9625000000000004 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 4.8125 0.0 0.0 0.0 0.0 114-115 5.300000000000001 0.0 0.0 0.0 0.0 116-117 5.9 0.0 0.0 0.0 0.0 118-119 6.625 0.0 0.0 0.0 0.0 120-121 7.1875 0.0 0.0 0.0 0.0 122-123 7.7875 0.0 0.0 0.0 0.0 124-125 8.65 0.0 0.0 0.0 0.0 126-127 9.3875 0.0 0.0 0.0 0.0 128-129 10.025 0.0 0.0 0.0 0.0 130-131 10.6125 0.0 0.0 0.0 0.0 132-133 11.3875 0.0 0.0 0.0 0.0 134-135 12.425 0.0 0.0 0.0 0.0 136-137 13.4375 0.0 0.0 0.0 0.0 138-139 14.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGTAA 10 0.00686971 144.72499 145 CAATCCA 10 0.00686971 144.72499 4 >>END_MODULE SRR6941619 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6941619_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9045 33.0 33.0 34.0 32.0 34.0 2 33.01 34.0 33.0 34.0 32.0 34.0 3 33.07675 34.0 33.0 34.0 32.0 34.0 4 33.00375 34.0 33.0 34.0 32.0 34.0 5 33.0195 34.0 33.0 34.0 32.0 34.0 6 37.13675 38.0 38.0 38.0 37.0 38.0 7 37.2345 38.0 38.0 38.0 37.0 38.0 8 37.1905 38.0 38.0 38.0 37.0 38.0 9 37.0925 38.0 38.0 38.0 37.0 38.0 10-14 37.0908 38.0 38.0 38.0 36.8 38.0 15-19 37.063649999999996 38.0 38.0 38.0 36.4 38.0 20-24 37.08425 38.0 38.0 38.0 36.8 38.0 25-29 37.04145 38.0 38.0 38.0 36.4 38.0 30-34 37.063300000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.0 38.0 38.0 38.0 36.2 38.0 40-44 37.00749999999999 38.0 38.0 38.0 36.2 38.0 45-49 37.01585 38.0 38.0 38.0 36.2 38.0 50-54 37.000800000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.893600000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.83655 38.0 38.0 38.0 35.8 38.0 65-69 36.67555 38.0 38.0 38.0 35.0 38.0 70-74 36.7838 38.0 38.0 38.0 35.4 38.0 75-79 36.692699999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.63805 38.0 38.0 38.0 35.0 38.0 85-89 36.588800000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.4443 38.0 38.0 38.0 34.0 38.0 95-99 36.309749999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.1887 38.0 38.0 38.0 34.0 38.0 105-109 35.81805 38.0 37.8 38.0 32.2 38.0 110-114 35.20385 38.0 36.0 38.0 28.6 38.0 115-119 35.31055 38.0 36.0 38.0 29.6 38.0 120-124 35.161 38.0 35.8 38.0 28.8 38.0 125-129 35.14645 38.0 36.0 38.0 28.8 38.0 130-134 35.141 38.0 36.0 38.0 29.6 38.0 135-139 34.7236 38.0 35.4 38.0 28.4 38.0 140-144 34.204750000000004 38.0 33.6 38.0 25.2 38.0 145-149 33.0967 38.0 33.0 38.0 18.8 38.0 150-151 27.264875 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 2.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 2.0 11 0.0 12 2.0 13 0.0 14 3.0 15 1.0 16 5.0 17 1.0 18 5.0 19 5.0 20 10.0 21 8.0 22 4.0 23 13.0 24 9.0 25 17.0 26 23.0 27 18.0 28 43.0 29 38.0 30 55.0 31 52.0 32 74.0 33 122.0 34 176.0 35 252.0 36 587.0 37 2458.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.325 17.25 7.5249999999999995 28.9 2 27.925 24.525 28.7 18.85 3 21.6 25.374999999999996 28.475 24.55 4 26.650000000000002 30.875000000000004 18.975 23.5 5 26.0 33.5 19.35 21.15 6 22.7 36.199999999999996 20.825 20.275000000000002 7 23.375 19.525000000000002 33.975 23.125 8 22.725 22.95 25.85 28.475 9 23.7 21.675 27.725 26.900000000000002 10-14 25.77 26.235000000000003 23.66 24.335 15-19 25.585 25.31 24.865000000000002 24.240000000000002 20-24 25.905 25.8 23.919999999999998 24.375 25-29 25.715 25.435000000000002 24.465 24.385 30-34 25.69 25.36 24.285 24.665 35-39 25.629999999999995 25.580000000000002 24.125 24.665 40-44 25.86 24.91 24.7 24.529999999999998 45-49 25.215 25.845000000000002 24.52 24.42 50-54 26.174999999999997 25.045 24.97 23.810000000000002 55-59 26.145000000000003 25.124999999999996 24.33 24.4 60-64 26.029999999999998 24.83 24.715 24.425 65-69 25.52 25.650000000000002 24.355 24.474999999999998 70-74 25.485000000000003 24.805 24.709999999999997 25.0 75-79 25.41 25.230000000000004 24.884999999999998 24.474999999999998 80-84 25.525 24.975 24.715 24.785 85-89 26.22 24.965 23.810000000000002 25.005 90-94 26.1 25.4 24.15 24.349999999999998 95-99 25.869999999999997 25.124999999999996 24.81 24.195 100-104 26.5 25.255 24.09 24.154999999999998 105-109 26.355 25.595000000000002 24.240000000000002 23.810000000000002 110-114 26.93 25.885 24.085 23.1 115-119 27.250000000000004 25.46 24.295 22.994999999999997 120-124 27.534999999999997 25.6 24.34 22.525000000000002 125-129 27.810000000000002 25.575 23.94 22.675 130-134 28.035 25.490000000000002 23.74 22.735 135-139 27.52 25.505 24.875 22.1 140-144 27.985 26.314999999999998 23.94 21.759999999999998 145-149 28.09 25.679999999999996 23.835 22.395 150-151 28.625 25.35 24.125 21.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 3.0 27 4.5 28 5.0 29 6.0 30 10.0 31 10.0 32 10.5 33 17.5 34 24.0 35 33.5 36 40.5 37 48.5 38 66.0 39 86.0 40 109.5 41 138.5 42 159.5 43 168.0 44 178.5 45 180.0 46 185.0 47 186.0 48 183.0 49 172.0 50 162.0 51 153.5 52 134.0 53 116.0 54 101.5 55 99.5 56 93.5 57 100.0 58 102.0 59 101.0 60 100.5 61 86.0 62 76.5 63 69.0 64 68.0 65 67.5 66 59.0 67 46.5 68 44.5 69 49.5 70 37.5 71 24.5 72 22.0 73 17.0 74 13.0 75 11.0 76 6.5 77 3.5 78 2.0 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98631525595539 97.65 2 0.8616320324379118 1.7000000000000002 3 0.05068423720223011 0.15 4 0.05068423720223011 0.2 5 0.025342118601115054 0.125 6 0.0 0.0 7 0.025342118601115054 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.825 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.5 0.0 0.0 0.0 0.0 102-103 2.95 0.0 0.0 0.0 0.0 104-105 3.2625 0.0 0.0 0.0 0.0 106-107 3.6624999999999996 0.0 0.0 0.0 0.0 108-109 3.9875 0.0 0.0 0.0 0.0 110-111 4.425 0.0 0.0 0.0 0.0 112-113 4.8875 0.0 0.0 0.0 0.0 114-115 5.375 0.0 0.0 0.0 0.0 116-117 5.987500000000001 0.0 0.0 0.0 0.0 118-119 6.75 0.0 0.0 0.0 0.0 120-121 7.3125 0.0 0.0 0.0 0.0 122-123 7.8875 0.0 0.0 0.0 0.0 124-125 8.725 0.0 0.0 0.0 0.0 126-127 9.425 0.0 0.0 0.0 0.0 128-129 10.0875 0.0 0.0 0.0 0.0 130-131 10.6875 0.0 0.0 0.0 0.0 132-133 11.4125 0.0 0.0 0.0 0.0 134-135 12.4125 0.0 0.0 0.0 0.0 136-137 13.3625 0.0 0.0 0.0 0.0 138-139 14.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTGGG 10 0.006830828 145.0 145 >>END_MODULE Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127666 spots for SRR6941619.sra Written 1127666 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra Read 1127656 spots for SRR6941619.sra Written 1127656 spots for SRR6941619.sra SRR ids: ['SRR6941619.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_027x8_b1 SRR6941619.sra spots: 22553130 blocks: [[1, 1127656], [1127657, 2255312], [2255313, 3382968], [3382969, 4510624], [4510625, 5638280], [5638281, 6765936], [6765937, 7893592], [7893593, 9021248], [9021249, 10148904], [10148905, 11276560], [11276561, 12404216], [12404217, 13531872], [13531873, 14659528], [14659529, 15787184], [15787185, 16914840], [16914841, 18042496], [18042497, 19170152], [19170153, 20297808], [20297809, 21425464], [21425465, 22553130]] SRR6941619 file size 7620815 SRR6941619 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6941619 SRR6941619_1.fastq SRR6941619_2.fastq Input file: SRR6941619_1.fastq Paired file: SRR6941619_2.fastq trimmed: SRR6941619-trimmed-pair1.fastq, SRR6941619-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:27:12 2024 >> started Fri Dec 6 13:27:39 2024 >> done (27.029s) 22553130 read pairs processed; of these: 15479 ( 0.07%) short read pairs filtered out after trimming by size control 11889 ( 0.05%) empty read pairs filtered out after trimming by size control 22525762 (99.88%) read pairs available; of these: 12244982 (54.36%) trimmed read pairs available after processing 10280780 (45.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 15 0.00% 20 16 0.00% 21 20 0.00% 22 19 0.00% 23 20 0.00% 24 21 0.00% 25 16 0.00% 26 23 0.00% 27 24 0.00% 28 25 0.00% 29 17 0.00% 30 23 0.00% 31 34 0.00% 32 19 0.00% 33 18 0.00% 34 28 0.00% 35 19 0.00% 36 28 0.00% 37 30 0.00% 38 30 0.00% 39 34 0.00% 40 39 0.00% 41 71 0.00% 42 46 0.00% 43 57 0.00% 44 59 0.00% 45 82 0.00% 46 69 0.00% 47 83 0.00% 48 98 0.00% 49 96 0.00% 50 143 0.00% 51 158 0.00% 52 177 0.00% 53 189 0.00% 54 223 0.00% 55 262 0.00% 56 268 0.00% 57 311 0.00% 58 395 0.00% 59 439 0.00% 60 504 0.00% 61 655 0.00% 62 720 0.00% 63 815 0.00% 64 901 0.00% 65 967 0.00% 66 1155 0.01% 67 1342 0.01% 68 1590 0.01% 69 1793 0.01% 70 2192 0.01% 71 2392 0.01% 72 2867 0.01% 73 3305 0.01% 74 3625 0.02% 75 4142 0.02% 76 4661 0.02% 77 5150 0.02% 78 5877 0.03% 79 6620 0.03% 80 7366 0.03% 81 8322 0.04% 82 9488 0.04% 83 10919 0.05% 84 12849 0.06% 85 14214 0.06% 86 15628 0.07% 87 16736 0.07% 88 18111 0.08% 89 19369 0.09% 90 21221 0.09% 91 22951 0.10% 92 24737 0.11% 93 26748 0.12% 94 29438 0.13% 95 31135 0.14% 96 32441 0.14% 97 34930 0.16% 98 36415 0.16% 99 38494 0.17% 100 41108 0.18% 101 43074 0.19% 102 45602 0.20% 103 48340 0.21% 104 51249 0.23% 105 53114 0.24% 106 55480 0.25% 107 56098 0.25% 108 58241 0.26% 109 61077 0.27% 110 63497 0.28% 111 65630 0.29% 112 68446 0.30% 113 71885 0.32% 114 73608 0.33% 115 77505 0.34% 116 78360 0.35% 117 80601 0.36% 118 81139 0.36% 119 82193 0.36% 120 84751 0.38% 121 86174 0.38% 122 88593 0.39% 123 92878 0.41% 124 96451 0.43% 125 97560 0.43% 126 99295 0.44% 127 101778 0.45% 128 101642 0.45% 129 105049 0.47% 130 107558 0.48% 131 108857 0.48% 132 113328 0.50% 133 117785 0.52% 134 121159 0.54% 135 127077 0.56% 136 129536 0.58% 137 133515 0.59% 138 137792 0.61% 139 146758 0.65% 140 151974 0.67% 141 160857 0.71% 142 175301 0.78% 143 189565 0.84% 144 215698 0.96% 145 246301 1.09% 146 292945 1.30% 147 372487 1.65% 148 525512 2.33% 149 983897 4.37% 150 4990125 22.15% 151 10280780 45.64% 22525762 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=17 prefix-density=1.03 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=16.74 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=1.9 sequence=CAAGTTCATCATGATTAATGGACTAACAGTTACAAGGGTTGCACTTGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=12 prefix-density=0.68 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=36.26 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6941619 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:28:23 Started mapping on | Dec 06 13:28:23 Finished on | Dec 06 13:31:39 Mapping speed, Million of reads per hour | 413.74 Number of input reads | 22525762 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 21230495 Uniquely mapped reads % | 94.25% Average mapped length | 288.30 Number of splices: Total | 22569515 Number of splices: Annotated (sjdb) | 21185420 Number of splices: GT/AG | 22241204 Number of splices: GC/AG | 255974 Number of splices: AT/AC | 8695 Number of splices: Non-canonical | 63642 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.03% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353866 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 40099 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 951990 951990 951990 N_multimapping 353866 353866 353866 N_noFeature 832044 20478346 1069844 N_ambiguous 594053 2949 80127 UnstrandedReadsAssigned:19804398 PositiveStrandReadsAssigned:749200 NegativeStrandReadsAssigned:20080524 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR6941619 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6941619-trimmed-pair1.fastq SRR6941619-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,525,762 reads, 20,095,846 reads pseudoaligned [quant] estimated average fragment length: 228.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 SRR6941619.ke.tsv 35125 SRR6941619.se.tsv 88098 total ==> SRR6941619.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.31 5.23892e-05 5.4755e-06 PNS24247 1044 816.77 59.5576 5.40575 PNS24249 1928 1700.77 38.7093 1.68728 PNS24246 1044 816.77 59.5576 5.40575 PNS24248 1044 816.77 59.5576 5.40575 PNS24244 1471 1243.77 55.6177 3.31506 PNS24243 293 108.353 0 0 KQK14069 1603 1375.77 3030.63 163.307 KQK14071 474 260.482 44.5422 12.6769 ==> SRR6941619.se.tsv <== BRADI_1g14170v3 3477 BRADI_1g53295v3 794 BRADI_1g59795v3 128 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 510 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 204 BRADI_1g48960v3 0 SRR6941619 completed mapping pipeline successfully