Starting /dee2/code/volunteer_pipeline.sh SRR6945012 current disk space = 1552307216384 free memory = 1494173368 SRR6945012 SRAfilesize 46a8922f29f62d6e1ed961a17a8ebc3f SRR6945012.sra SRR6945012.sra file validated SRR6945012 is paired end SRR6945012 is conventional basespace SRR6945012 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6945012_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.29525 33.0 33.0 33.0 33.0 33.0 2 32.00375 33.0 33.0 33.0 27.0 33.0 3 32.10875 33.0 33.0 33.0 33.0 33.0 4 32.34275 33.0 33.0 33.0 33.0 33.0 5 32.30825 33.0 33.0 33.0 33.0 33.0 6 35.81 37.0 37.0 37.0 33.0 37.0 7 35.89225 37.0 37.0 37.0 37.0 37.0 8 36.0825 37.0 37.0 37.0 37.0 37.0 9 36.08425 37.0 37.0 37.0 37.0 37.0 10-11 36.0105 37.0 37.0 37.0 37.0 37.0 12-13 36.003125 37.0 37.0 37.0 37.0 37.0 14-15 35.808875 37.0 37.0 37.0 37.0 37.0 16-17 35.774625 37.0 37.0 37.0 37.0 37.0 18-19 35.665499999999994 37.0 37.0 37.0 37.0 37.0 20-21 35.594 37.0 37.0 37.0 35.0 37.0 22-23 35.587374999999994 37.0 37.0 37.0 37.0 37.0 24-25 35.14625 37.0 37.0 37.0 33.0 37.0 26-27 35.311375 37.0 37.0 37.0 35.0 37.0 28-29 35.403499999999994 37.0 37.0 37.0 33.0 37.0 30-31 35.08275 37.0 37.0 37.0 33.0 37.0 32-33 35.286 37.0 37.0 37.0 35.0 37.0 34-35 34.6075 37.0 37.0 37.0 27.0 37.0 36-37 35.082375 37.0 37.0 37.0 30.0 37.0 38-39 35.139125 37.0 37.0 37.0 33.0 37.0 40-41 35.099625 37.0 37.0 37.0 33.0 37.0 42-43 35.4155 37.0 37.0 37.0 35.0 37.0 44-45 35.27225 37.0 37.0 37.0 33.0 37.0 46-47 35.39975 37.0 37.0 37.0 35.0 37.0 48-49 35.148875000000004 37.0 37.0 37.0 33.0 37.0 50-51 35.502250000000004 37.0 37.0 37.0 37.0 37.0 52-53 35.388374999999996 37.0 37.0 37.0 35.0 37.0 54-55 35.435 37.0 37.0 37.0 35.0 37.0 56-57 35.59725 37.0 37.0 37.0 37.0 37.0 58-59 35.373374999999996 37.0 37.0 37.0 35.0 37.0 60-61 35.240875 37.0 37.0 37.0 33.0 37.0 62-63 35.293875 37.0 37.0 37.0 33.0 37.0 64-65 35.370374999999996 37.0 37.0 37.0 33.0 37.0 66-67 35.3485 37.0 37.0 37.0 33.0 37.0 68-69 35.3935 37.0 37.0 37.0 33.0 37.0 70-71 35.369875 37.0 37.0 37.0 33.0 37.0 72-73 35.556625 37.0 37.0 37.0 37.0 37.0 74-75 35.453500000000005 37.0 37.0 37.0 35.0 37.0 76-77 35.486875 37.0 37.0 37.0 35.0 37.0 78-79 35.555875 37.0 37.0 37.0 37.0 37.0 80-81 35.454625 37.0 37.0 37.0 35.0 37.0 82-83 35.297625 37.0 37.0 37.0 33.0 37.0 84-85 35.195625 37.0 37.0 37.0 33.0 37.0 86-87 35.244625 37.0 37.0 37.0 33.0 37.0 88-89 35.167249999999996 37.0 37.0 37.0 33.0 37.0 90-91 35.184 37.0 37.0 37.0 33.0 37.0 92-93 35.2495 37.0 37.0 37.0 33.0 37.0 94-95 34.730000000000004 37.0 37.0 37.0 33.0 37.0 96-97 34.9715 37.0 37.0 37.0 33.0 37.0 98-99 34.453375 37.0 37.0 37.0 30.0 37.0 100-101 33.885125 37.0 37.0 37.0 30.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 9.0 4 6.0 5 6.0 6 9.0 7 3.0 8 3.0 9 2.0 10 3.0 11 1.0 12 3.0 13 2.0 14 3.0 15 1.0 16 0.0 17 2.0 18 0.0 19 2.0 20 3.0 21 7.0 22 10.0 23 4.0 24 14.0 25 19.0 26 18.0 27 29.0 28 35.0 29 27.0 30 41.0 31 56.0 32 74.0 33 90.0 34 150.0 35 308.0 36 3032.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.28778467908902 9.08385093167702 5.8229813664596275 42.80538302277433 2 23.65 9.4 35.375 31.574999999999996 3 21.4 11.375 22.775000000000002 44.45 4 27.474999999999998 18.075 20.724999999999998 33.725 5 29.175 24.45 22.3 24.075 6 23.200000000000003 29.525000000000002 22.425 24.85 7 19.1 25.0 37.175000000000004 18.725 8 19.1 23.325000000000003 32.225 25.35 9 19.85 21.975 34.225 23.95 10-11 22.7125 29.825000000000003 25.687500000000004 21.775 12-13 23.3625 24.9 26.637499999999996 25.1 14-15 22.7625 25.624999999999996 26.25 25.362499999999997 16-17 23.674999999999997 26.387500000000003 24.8 25.137500000000003 18-19 23.474999999999998 25.662499999999998 25.087500000000002 25.775 20-21 22.2625 26.525 25.5625 25.650000000000002 22-23 23.45 25.937500000000004 25.1 25.5125 24-25 23.3 25.8 25.7875 25.112499999999997 26-27 23.7375 25.2375 25.4625 25.5625 28-29 23.974999999999998 26.025 24.6625 25.337500000000002 30-31 23.4375 26.3125 24.462500000000002 25.7875 32-33 24.125 25.3125 24.7375 25.825 34-35 24.175 24.7875 24.825 26.2125 36-37 23.5875 25.5625 24.975 25.874999999999996 38-39 23.25 25.374999999999996 25.3125 26.0625 40-41 22.900000000000002 25.6125 25.337500000000002 26.150000000000002 42-43 24.675 25.0125 24.1375 26.174999999999997 44-45 22.8125 25.7375 25.275 26.174999999999997 46-47 24.025 25.137500000000003 25.25 25.587500000000002 48-49 23.9 25.374999999999996 24.4 26.325 50-51 22.8875 25.650000000000002 24.95 26.5125 52-53 23.7625 25.9625 24.2625 26.0125 54-55 23.2375 25.275 24.4875 27.0 56-57 23.6125 24.625 25.112499999999997 26.650000000000002 58-59 24.4375 25.15 24.0375 26.375 60-61 23.825 25.387500000000003 24.575 26.2125 62-63 23.575 25.7375 24.275 26.4125 64-65 23.7625 25.162499999999998 25.5 25.575 66-67 22.787499999999998 25.074999999999996 24.75 27.3875 68-69 23.125 25.374999999999996 25.4625 26.0375 70-71 23.75 26.075 25.0375 25.137500000000003 72-73 24.3625 25.7125 24.0625 25.8625 74-75 23.4625 25.587500000000002 24.7875 26.1625 76-77 24.3 25.0125 25.112499999999997 25.575 78-79 24.474999999999998 24.6125 24.55 26.3625 80-81 23.8375 24.6 24.575 26.987499999999997 82-83 23.7875 25.937500000000004 24.1625 26.1125 84-85 24.45 24.6875 24.099999999999998 26.7625 86-87 23.95 25.775 24.4 25.874999999999996 88-89 24.0 25.224999999999998 24.3 26.474999999999998 90-91 23.7 25.75 24.6875 25.8625 92-93 24.0375 25.5375 25.1 25.324999999999996 94-95 23.962500000000002 25.7375 25.3 25.0 96-97 24.3 25.687500000000004 23.5625 26.450000000000003 98-99 24.0125 24.7875 24.9 26.3 100-101 24.675 24.8625 24.425 26.0375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.5 29 2.5 30 7.0 31 9.0 32 7.5 33 13.5 34 20.0 35 37.0 36 57.0 37 65.0 38 78.5 39 83.0 40 101.5 41 125.5 42 147.5 43 190.5 44 204.0 45 186.5 46 196.0 47 203.5 48 197.5 49 180.0 50 163.5 51 147.0 52 131.0 53 120.5 54 101.5 55 109.0 56 106.5 57 93.0 58 83.0 59 73.5 60 75.5 61 70.0 62 62.0 63 61.0 64 64.5 65 64.5 66 57.5 67 59.0 68 51.5 69 41.0 70 34.5 71 25.0 72 22.5 73 16.5 74 11.5 75 13.0 76 8.0 77 4.5 78 4.0 79 2.0 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06636386575826 98.15 2 0.9336361342417362 1.8499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.36250000000000004 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.5125 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.7875 0.0 0.0 0.0 0.0 82-83 1.0 0.0 0.0 0.0 0.0 84-85 1.1124999999999998 0.0 0.0 0.0 0.0 86-87 1.3875000000000002 0.0 0.0 0.0 0.0 88-89 1.6124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6945012 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6945012_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.513 33.0 33.0 33.0 33.0 33.0 2 31.5855 33.0 33.0 33.0 33.0 33.0 3 31.53025 33.0 33.0 33.0 33.0 33.0 4 31.58575 33.0 33.0 33.0 33.0 33.0 5 31.73675 33.0 33.0 33.0 33.0 33.0 6 35.143 37.0 37.0 37.0 33.0 37.0 7 35.22025 37.0 37.0 37.0 33.0 37.0 8 35.18525 37.0 37.0 37.0 33.0 37.0 9 35.26275 37.0 37.0 37.0 33.0 37.0 10-11 35.418875 37.0 37.0 37.0 33.0 37.0 12-13 35.5115 37.0 37.0 37.0 37.0 37.0 14-15 35.341875 37.0 37.0 37.0 35.0 37.0 16-17 35.277125 37.0 37.0 37.0 35.0 37.0 18-19 35.51875 37.0 37.0 37.0 37.0 37.0 20-21 35.531 37.0 37.0 37.0 37.0 37.0 22-23 35.483625 37.0 37.0 37.0 37.0 37.0 24-25 35.491875 37.0 37.0 37.0 37.0 37.0 26-27 35.449375 37.0 37.0 37.0 37.0 37.0 28-29 35.1305 37.0 37.0 37.0 33.0 37.0 30-31 35.342749999999995 37.0 37.0 37.0 35.0 37.0 32-33 35.19025 37.0 37.0 37.0 33.0 37.0 34-35 35.069874999999996 37.0 37.0 37.0 33.0 37.0 36-37 35.082625 37.0 37.0 37.0 33.0 37.0 38-39 35.218875 37.0 37.0 37.0 35.0 37.0 40-41 35.10025 37.0 37.0 37.0 33.0 37.0 42-43 35.230374999999995 37.0 37.0 37.0 33.0 37.0 44-45 35.300125 37.0 37.0 37.0 35.0 37.0 46-47 35.29775 37.0 37.0 37.0 37.0 37.0 48-49 35.268249999999995 37.0 37.0 37.0 35.0 37.0 50-51 35.25425 37.0 37.0 37.0 35.0 37.0 52-53 35.238375000000005 37.0 37.0 37.0 35.0 37.0 54-55 35.25175 37.0 37.0 37.0 35.0 37.0 56-57 35.224625 37.0 37.0 37.0 33.0 37.0 58-59 34.997875 37.0 37.0 37.0 33.0 37.0 60-61 34.977875 37.0 37.0 37.0 33.0 37.0 62-63 35.078625 37.0 37.0 37.0 33.0 37.0 64-65 34.977625 37.0 37.0 37.0 33.0 37.0 66-67 34.95675 37.0 37.0 37.0 33.0 37.0 68-69 34.96275 37.0 37.0 37.0 33.0 37.0 70-71 34.83475 37.0 37.0 37.0 33.0 37.0 72-73 34.490375 37.0 37.0 37.0 27.0 37.0 74-75 34.74 37.0 37.0 37.0 33.0 37.0 76-77 34.622875 37.0 37.0 37.0 30.0 37.0 78-79 34.62875 37.0 37.0 37.0 30.0 37.0 80-81 34.73025 37.0 37.0 37.0 33.0 37.0 82-83 34.74275 37.0 37.0 37.0 33.0 37.0 84-85 34.784 37.0 37.0 37.0 33.0 37.0 86-87 34.908125 37.0 37.0 37.0 33.0 37.0 88-89 34.730875 37.0 37.0 37.0 33.0 37.0 90-91 34.506874999999994 37.0 37.0 37.0 33.0 37.0 92-93 34.424125000000004 37.0 37.0 37.0 30.0 37.0 94-95 34.390249999999995 37.0 37.0 37.0 33.0 37.0 96-97 34.217875 37.0 37.0 37.0 33.0 37.0 98-99 34.044875000000005 37.0 37.0 37.0 30.0 37.0 100-101 32.649875 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 67.0 3 4.0 4 5.0 5 3.0 6 4.0 7 3.0 8 6.0 9 3.0 10 5.0 11 3.0 12 1.0 13 2.0 14 2.0 15 5.0 16 7.0 17 2.0 18 4.0 19 3.0 20 4.0 21 7.0 22 12.0 23 12.0 24 16.0 25 24.0 26 14.0 27 26.0 28 35.0 29 26.0 30 44.0 31 58.0 32 72.0 33 83.0 34 146.0 35 285.0 36 3007.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.9277566539924 19.44233206590621 9.809885931558936 37.82002534854246 2 29.609929078014186 22.365754812563324 30.192502532928067 17.831813576494426 3 20.9873417721519 26.784810126582276 29.240506329113924 22.987341772151897 4 25.164556962025316 28.455696202531644 22.253164556962023 24.126582278481013 5 28.434100683025548 31.52036428029345 19.7318492284341 20.313685808246902 6 23.45088161209068 36.85138539042821 20.327455919395465 19.370277078085643 7 22.527749747729565 19.80322906155399 34.510595358224016 23.158425832492433 8 24.608783442705704 22.31196365471984 25.239777889954567 27.83947501261989 9 24.96217851739788 22.16338880484115 28.139183055975792 24.735249621785176 10-11 26.077640534408875 27.3380388202672 23.040080665490294 23.544239979833627 12-13 25.557937208422643 23.36401462615055 24.460975917286596 26.61707224814021 14-15 26.311806256306763 24.533299697275478 24.192734611503532 24.962159434914227 16-17 27.5031525851198 23.85876418663304 23.165195460277427 25.472887767969738 18-19 26.31114473020676 24.987392839132628 24.28139183055976 24.420070600100857 20-21 25.775144945802875 25.283589614318124 23.758507688429546 25.182757751449458 22-23 26.1226034308779 24.785570131180627 24.028758829465186 25.063067608476285 24-25 25.365607665153806 24.77307110438729 24.357034795763994 25.504286434694905 26-27 26.456494325346785 25.031525851197983 24.451450189155107 24.060529634300128 28-29 26.5666372462489 24.133148404993065 24.48619341823225 24.814020930525786 30-31 25.971241170534814 24.646821392532793 24.86125126135217 24.520686175580224 32-33 26.232194630026473 24.27833102231186 24.694314887180134 24.795159460481532 34-35 26.427940991047787 24.120539654520236 23.590972134661456 25.86054721977052 36-37 26.45242596093258 25.356017643352235 24.940138626339003 23.251417769376182 38-39 26.100113478754256 25.040978439036692 24.73836842768882 24.120539654520236 40-41 27.116935483870968 23.550907258064516 24.344758064516128 24.987399193548388 42-43 25.93572778827977 25.973534971644614 25.166981726528043 22.923755513547576 44-45 26.26873189774588 24.03979347689208 25.22352348570709 24.467951139654957 46-47 27.137640095705827 24.253872308273515 23.976829114721067 24.631658481299585 48-49 25.87509443465122 25.723998992697055 24.842608914631075 23.55829765802065 50-51 26.344966612070053 25.488219730376716 23.837722061232203 24.329091596321028 52-53 26.455760020166373 23.720695739853795 24.65339047138896 25.170153768590875 54-55 25.939470365699872 24.224464060529634 25.472887767969738 24.363177805800756 56-57 26.531383917317875 25.157549785732293 23.77111167128813 24.539954625661707 58-59 25.83858764186633 24.224464060529634 24.993694829760404 24.943253467843633 60-61 25.765788478507503 25.286776755325853 25.29938232698853 23.648052439178116 62-63 26.838790931989926 24.34508816120907 24.848866498740556 23.967254408060455 64-65 26.35688200478529 24.858330185115225 24.568694119128573 24.21609369097091 66-67 25.680100755667507 25.06297229219144 24.962216624685137 24.29471032745592 68-69 26.01963746223565 25.478348439073518 24.584592145015105 23.91742195367573 70-71 26.123630869948382 23.85748457761551 25.355659070880023 24.663225481556086 72-73 25.472411186696903 25.459813555051653 24.414210128495842 24.653565129755606 74-75 27.30250724455084 24.555877535592792 24.61887362983495 23.52274159002142 76-77 25.77800176389064 24.97165175759103 24.7196673806224 24.53067909789593 78-79 26.4198463669563 24.89610880241783 24.807958695378414 23.87608613524745 80-81 26.209677419354836 25.201612903225808 24.495967741935484 24.092741935483872 82-83 26.77085959163096 24.338290899924374 24.77943029997479 24.111419208469876 84-85 26.36420919974795 25.028355387523632 24.801512287334592 23.805923125393825 86-87 27.458396369137674 24.646999495713565 24.319213313161875 23.57539082198689 88-89 26.788413098236774 24.924433249370274 24.29471032745592 23.992443324937028 90-91 26.545775091298324 24.908701674852036 24.39239390504974 24.1531293287999 92-93 27.70780856423174 24.39546599496222 24.596977329974813 23.299748110831235 94-95 27.309388783868936 24.259609325771898 24.56206679269061 23.868935097668555 96-97 26.60179451535448 26.41223303424744 23.859471755339314 23.126500695058763 98-99 26.111041168324313 26.476142515422385 24.58768727181166 22.825129044441645 100-101 26.337655797557595 25.103865038398588 24.62545637668387 23.93302278735994 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 28.0 1 14.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 0.5 28 1.5 29 4.5 30 7.5 31 7.5 32 8.0 33 15.0 34 21.0 35 26.0 36 35.0 37 52.5 38 74.5 39 101.0 40 118.0 41 129.5 42 152.0 43 176.0 44 190.5 45 184.5 46 180.5 47 173.5 48 156.5 49 155.0 50 152.5 51 138.0 52 132.0 53 135.5 54 119.5 55 109.0 56 100.0 57 91.0 58 95.0 59 92.5 60 80.0 61 71.0 62 71.5 63 72.0 64 76.0 65 70.0 66 59.5 67 53.0 68 47.0 69 45.5 70 47.5 71 37.0 72 24.5 73 22.0 74 19.5 75 10.5 76 5.5 77 4.5 78 4.5 79 4.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 1.3 3 1.25 4 1.25 5 1.175 6 0.75 7 0.8999999999999999 8 0.95 9 0.8500000000000001 10-11 0.8250000000000001 12-13 0.8625 14-15 0.8999999999999999 16-17 0.8750000000000001 18-19 0.8500000000000001 20-21 0.8250000000000001 22-23 0.8999999999999999 24-25 0.8500000000000001 26-27 0.8750000000000001 28-29 0.8625 30-31 0.8999999999999999 32-33 0.8375 34-35 0.8625 36-37 0.8125 38-39 0.8625 40-41 0.8 42-43 0.8125 44-45 0.7374999999999999 46-47 0.7374999999999999 48-49 0.7250000000000001 50-51 0.7875 52-53 0.8250000000000001 54-55 0.8750000000000001 56-57 0.8250000000000001 58-59 0.8750000000000001 60-61 0.8375 62-63 0.75 64-65 0.7374999999999999 66-67 0.75 68-69 0.7000000000000001 70-71 0.7125 72-73 0.775 74-75 0.7875 76-77 0.7875 78-79 0.7374999999999999 80-81 0.8 82-83 0.8250000000000001 84-85 0.8125 86-87 0.8500000000000001 88-89 0.75 90-91 0.7374999999999999 92-93 0.75 94-95 0.8125 96-97 1.0875 98-99 0.7125 100-101 0.7125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54499494438828 98.45 2 0.4297269969666329 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02527805864509606 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 28 0.7000000000000001 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0 82-83 0.975 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.35 0.0 0.0 0.0 0.0 88-89 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759786 spots for SRR6945012.sra Written 2759786 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra Read 2759773 spots for SRR6945012.sra Written 2759773 spots for SRR6945012.sra SRR ids: ['SRR6945012.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_45n3tyzr SRR6945012.sra spots: 55195473 blocks: [[1, 2759773], [2759774, 5519546], [5519547, 8279319], [8279320, 11039092], [11039093, 13798865], [13798866, 16558638], [16558639, 19318411], [19318412, 22078184], [22078185, 24837957], [24837958, 27597730], [27597731, 30357503], [30357504, 33117276], [33117277, 35877049], [35877050, 38636822], [38636823, 41396595], [41396596, 44156368], [44156369, 46916141], [46916142, 49675914], [49675915, 52435687], [52435688, 55195473]] SRR6945012 file size 13292051 SRR6945012 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6945012 SRR6945012_1.fastq SRR6945012_2.fastq Input file: SRR6945012_1.fastq Paired file: SRR6945012_2.fastq trimmed: SRR6945012-trimmed-pair1.fastq, SRR6945012-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:01:51 2024 >> started Fri Dec 6 10:09:58 2024 >> done (487.359s) 55195473 read pairs processed; of these: 471188 ( 0.85%) short read pairs filtered out after trimming by size control 987393 ( 1.79%) empty read pairs filtered out after trimming by size control 53736892 (97.36%) read pairs available; of these: 10900189 (20.28%) trimmed read pairs available after processing 42836703 (79.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 192 0.00% 19 381 0.00% 20 509 0.00% 21 681 0.00% 22 771 0.00% 23 852 0.00% 24 910 0.00% 25 1025 0.00% 26 1074 0.00% 27 1232 0.00% 28 1316 0.00% 29 1451 0.00% 30 1596 0.00% 31 1587 0.00% 32 1621 0.00% 33 1705 0.00% 34 1771 0.00% 35 1927 0.00% 36 2019 0.00% 37 2178 0.00% 38 2363 0.00% 39 2622 0.00% 40 2690 0.01% 41 2874 0.01% 42 3034 0.01% 43 3064 0.01% 44 3313 0.01% 45 3325 0.01% 46 3823 0.01% 47 4192 0.01% 48 4601 0.01% 49 5073 0.01% 50 5732 0.01% 51 6313 0.01% 52 7086 0.01% 53 7667 0.01% 54 8243 0.02% 55 9070 0.02% 56 9882 0.02% 57 11572 0.02% 58 14026 0.03% 59 26050 0.05% 60 30325 0.06% 61 28884 0.05% 62 29436 0.05% 63 30310 0.06% 64 30121 0.06% 65 32125 0.06% 66 31690 0.06% 67 32953 0.06% 68 35166 0.07% 69 37714 0.07% 70 38909 0.07% 71 41213 0.08% 72 42568 0.08% 73 44952 0.08% 74 47033 0.09% 75 50088 0.09% 76 54659 0.10% 77 56476 0.11% 78 60465 0.11% 79 65423 0.12% 80 70276 0.13% 81 75503 0.14% 82 82935 0.15% 83 89455 0.17% 84 98085 0.18% 85 107718 0.20% 86 119052 0.22% 87 126271 0.23% 88 135600 0.25% 89 147353 0.27% 90 162247 0.30% 91 178904 0.33% 92 198673 0.37% 93 222357 0.41% 94 254355 0.47% 95 294068 0.55% 96 350525 0.65% 97 449278 0.84% 98 627234 1.17% 99 1045858 1.95% 100 5072519 9.44% 101 42836703 79.72% 53736892 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=49.57 fanout-score-rank=7 prefix-density=0.46 prefix-fanout=10.6 sequence=CGCCGCCGCCGCGCCGACCTCCTCCGCGATCTTGTGCCTGTGCGCGTTTTCCGGGTCCTTCTTTGCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=293.78 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=22.9 sequence=AGCAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGGGTGTGGGAGATGAAGAGCACCTCGTAAATCACCCCAGCAAGGCCACCGCC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=109.35 fanout-score-rank=5 prefix-density=0.73 prefix-fanout=17.6 sequence=CGCCGCCGCCGCTGGCGCCTTCGCCCTCTACGAGAAGCACGAGGCAAAGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=287.27 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=23.4 sequence=AAGAAGAAGGACCACAAGGAGGCCCAGGAGGTCAGCGGCGAGAAGAAGGGCCACCACCTCTTCGGCTAAGCGACGTCGCTAGACCCGCCGATCGATACGCCACGTAAGCTCGCTGGCGCCGAAGTTTGTTTGTGTGTGTG SRR6945012 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:14:25 Started mapping on | Dec 06 10:14:26 Finished on | Dec 06 10:44:54 Mapping speed, Million of reads per hour | 105.83 Number of input reads | 53736892 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 50161424 Uniquely mapped reads % | 93.35% Average mapped length | 199.02 Number of splices: Total | 30838480 Number of splices: Annotated (sjdb) | 29355997 Number of splices: GT/AG | 30401955 Number of splices: GC/AG | 370133 Number of splices: AT/AC | 18831 Number of splices: Non-canonical | 47561 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505307 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 402746 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 4.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3110580 3110580 3110580 N_multimapping 505307 505307 505307 N_noFeature 1465220 48820931 1836508 N_ambiguous 1097359 4413 134566 UnstrandedReadsAssigned:47598845 PositiveStrandReadsAssigned:1336080 NegativeStrandReadsAssigned:48190350 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6945012 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6945012-trimmed-pair1.fastq SRR6945012-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 53,736,892 reads, 48,449,746 reads pseudoaligned [quant] estimated average fragment length: 171.895 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR6945012.ke.tsv 35125 SRR6945012.se.tsv 88098 total ==> SRR6945012.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.222 34.8064 1.3643 PNS24247 1044 873.105 80.3012 2.75862 PNS24249 1928 1757.11 201.547 3.44045 PNS24246 1044 873.105 80.3012 2.75862 PNS24248 1044 873.105 80.3012 2.75862 PNS24244 1471 1300.11 399.743 9.2223 PNS24243 293 131.597 0 0 KQK14069 1603 1432.11 2677.96 56.0876 KQK14071 474 304.805 143.736 14.1443 ==> SRR6945012.se.tsv <== BRADI_1g14170v3 3086 BRADI_1g53295v3 290 BRADI_1g59795v3 655 BRADI_1g07683v3 0 BRADI_1g00485v3 317 BRADI_1g20270v3 2781 BRADI_1g74790v3 2441 BRADI_1g09890v3 0 BRADI_1g77505v3 470 BRADI_1g48960v3 0 SRR6945012 completed mapping pipeline successfully