Starting /dee2/code/volunteer_pipeline.sh SRR6945013 current disk space = 1552287023104 free memory = 1602248504 SRR6945013 SRAfilesize d64062a1172d2b3e97191924c55d0ace SRR6945013.sra SRR6945013.sra file validated SRR6945013 is paired end SRR6945013 is conventional basespace SRR6945013 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6945013_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12325 33.0 33.0 33.0 33.0 33.0 2 31.9345 33.0 33.0 33.0 27.0 33.0 3 32.077 33.0 33.0 33.0 33.0 33.0 4 32.18225 33.0 33.0 33.0 33.0 33.0 5 32.19925 33.0 33.0 33.0 33.0 33.0 6 35.6905 37.0 37.0 37.0 33.0 37.0 7 35.773 37.0 37.0 37.0 37.0 37.0 8 35.82825 37.0 37.0 37.0 37.0 37.0 9 35.78775 37.0 37.0 37.0 37.0 37.0 10-11 35.762625 37.0 37.0 37.0 37.0 37.0 12-13 35.718125 37.0 37.0 37.0 37.0 37.0 14-15 35.606750000000005 37.0 37.0 37.0 37.0 37.0 16-17 35.580375000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.417125 37.0 37.0 37.0 35.0 37.0 20-21 35.423500000000004 37.0 37.0 37.0 35.0 37.0 22-23 35.34725 37.0 37.0 37.0 35.0 37.0 24-25 34.90525 37.0 37.0 37.0 33.0 37.0 26-27 35.03825 37.0 37.0 37.0 33.0 37.0 28-29 35.088499999999996 37.0 37.0 37.0 33.0 37.0 30-31 34.88275 37.0 37.0 37.0 30.0 37.0 32-33 35.048375 37.0 37.0 37.0 33.0 37.0 34-35 34.449749999999995 37.0 37.0 37.0 27.0 37.0 36-37 34.772375 37.0 37.0 37.0 30.0 37.0 38-39 34.900999999999996 37.0 37.0 37.0 33.0 37.0 40-41 34.916875 37.0 37.0 37.0 33.0 37.0 42-43 35.173625 37.0 37.0 37.0 33.0 37.0 44-45 34.985125 37.0 37.0 37.0 33.0 37.0 46-47 35.12425 37.0 37.0 37.0 33.0 37.0 48-49 34.8655 37.0 37.0 37.0 33.0 37.0 50-51 35.142250000000004 37.0 37.0 37.0 33.0 37.0 52-53 34.98375 37.0 37.0 37.0 33.0 37.0 54-55 35.087375 37.0 37.0 37.0 33.0 37.0 56-57 35.291 37.0 37.0 37.0 35.0 37.0 58-59 35.20525 37.0 37.0 37.0 33.0 37.0 60-61 35.008125 37.0 37.0 37.0 33.0 37.0 62-63 35.041 37.0 37.0 37.0 33.0 37.0 64-65 35.036625 37.0 37.0 37.0 33.0 37.0 66-67 34.984875 37.0 37.0 37.0 33.0 37.0 68-69 34.96575 37.0 37.0 37.0 33.0 37.0 70-71 35.051625 37.0 37.0 37.0 33.0 37.0 72-73 35.187625 37.0 37.0 37.0 33.0 37.0 74-75 35.02125 37.0 37.0 37.0 33.0 37.0 76-77 35.171375 37.0 37.0 37.0 33.0 37.0 78-79 35.0985 37.0 37.0 37.0 33.0 37.0 80-81 35.08225 37.0 37.0 37.0 33.0 37.0 82-83 34.903875 37.0 37.0 37.0 33.0 37.0 84-85 34.796125 37.0 37.0 37.0 33.0 37.0 86-87 34.76875 37.0 37.0 37.0 33.0 37.0 88-89 34.7235 37.0 37.0 37.0 33.0 37.0 90-91 34.76825 37.0 37.0 37.0 33.0 37.0 92-93 34.8345 37.0 37.0 37.0 33.0 37.0 94-95 34.2905 37.0 37.0 37.0 27.0 37.0 96-97 34.627375 37.0 37.0 37.0 33.0 37.0 98-99 34.065124999999995 37.0 37.0 37.0 27.0 37.0 100-101 33.392125 37.0 37.0 37.0 27.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 25.0 4 10.0 5 7.0 6 7.0 7 7.0 8 2.0 9 1.0 10 3.0 11 3.0 12 3.0 13 4.0 14 2.0 15 1.0 16 3.0 17 0.0 18 3.0 19 4.0 20 5.0 21 3.0 22 6.0 23 6.0 24 18.0 25 15.0 26 25.0 27 34.0 28 35.0 29 45.0 30 45.0 31 52.0 32 66.0 33 106.0 34 158.0 35 320.0 36 2946.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.578125 9.010416666666666 7.135416666666666 46.276041666666664 2 21.95 9.775 35.55 32.725 3 21.95 12.75 21.825 43.475 4 27.075 19.0 22.35 31.574999999999996 5 28.799999999999997 24.85 23.3 23.05 6 23.65 29.099999999999998 24.375 22.875 7 19.1 24.099999999999998 38.6 18.2 8 18.475 23.775 32.574999999999996 25.174999999999997 9 19.950000000000003 21.675 34.225 24.15 10-11 21.712500000000002 31.0125 25.8125 21.462500000000002 12-13 23.3875 23.7 26.8625 26.05 14-15 23.2125 25.374999999999996 26.0125 25.4 16-17 24.5125 24.875 25.2125 25.4 18-19 23.3875 25.887500000000003 24.8625 25.8625 20-21 22.6875 26.0625 25.374999999999996 25.874999999999996 22-23 23.3375 24.925 26.0125 25.724999999999998 24-25 22.9875 24.887500000000003 25.3 26.825 26-27 22.675 26.7125 25.374999999999996 25.2375 28-29 23.625 25.124999999999996 25.525 25.724999999999998 30-31 24.04050506313289 24.70308788598575 24.815601950243778 26.440805100637583 32-33 23.225 25.15 25.85 25.775 34-35 23.225 25.112499999999997 25.724999999999998 25.937500000000004 36-37 23.5 24.825 25.35 26.325 38-39 23.4625 25.5375 24.4375 26.5625 40-41 23.9375 26.387500000000003 24.087500000000002 25.587500000000002 42-43 23.974999999999998 24.962500000000002 24.3625 26.700000000000003 44-45 23.075000000000003 25.8125 25.2625 25.85 46-47 23.3875 26.375 24.1375 26.1 48-49 23.875 24.425 25.6125 26.087500000000002 50-51 22.9625 25.4 25.124999999999996 26.5125 52-53 24.45 25.7 24.1125 25.7375 54-55 23.7375 26.0 24.4375 25.825 56-57 24.0625 25.25 24.8625 25.825 58-59 24.1125 25.887500000000003 24.7875 25.2125 60-61 22.85 24.4875 25.0125 27.650000000000002 62-63 22.4375 25.387500000000003 25.525 26.650000000000002 64-65 23.8875 25.374999999999996 24.875 25.8625 66-67 23.7375 25.025 24.2 27.037499999999998 68-69 23.4125 26.0125 24.375 26.200000000000003 70-71 22.900000000000002 25.525 25.362499999999997 26.2125 72-73 24.65 24.9375 24.2875 26.125 74-75 23.45 24.5375 25.124999999999996 26.887499999999996 76-77 24.2375 25.55 24.2875 25.924999999999997 78-79 24.0625 24.95 24.85 26.137500000000003 80-81 23.95 25.874999999999996 24.712500000000002 25.4625 82-83 24.224999999999998 25.0625 24.762500000000003 25.95 84-85 24.0375 24.65 25.224999999999998 26.087500000000002 86-87 23.5125 25.1875 25.6 25.7 88-89 24.9 25.0125 25.575 24.5125 90-91 24.025 24.775 24.8 26.400000000000002 92-93 23.962500000000002 25.662499999999998 25.4375 24.9375 94-95 24.265533191648956 25.690711338917367 23.952994124265533 26.090761345168147 96-97 23.724999999999998 25.424999999999997 23.825 27.025 98-99 23.7 25.162499999999998 25.124999999999996 26.0125 100-101 23.775 24.9125 25.2875 26.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.5 26 1.5 27 2.5 28 4.0 29 2.5 30 5.5 31 11.5 32 12.5 33 14.0 34 20.5 35 30.0 36 41.0 37 55.5 38 68.0 39 82.5 40 101.5 41 121.5 42 152.5 43 181.5 44 195.0 45 209.0 46 207.0 47 193.5 48 199.5 49 188.0 50 163.0 51 150.5 52 143.5 53 133.0 54 123.5 55 112.5 56 98.0 57 92.0 58 84.5 59 75.5 60 70.0 61 72.0 62 68.5 63 67.0 64 62.5 65 61.0 66 61.0 67 49.5 68 46.5 69 39.5 70 31.5 71 25.0 72 15.5 73 12.0 74 12.5 75 10.0 76 6.0 77 3.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0125 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.16249999999999998 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.2375 0.0 0.0 0.0 0.0 64-65 0.2875 0.0 0.0 0.0 0.0 66-67 0.3125 0.0 0.0 0.0 0.0 68-69 0.36250000000000004 0.0 0.0 0.0 0.0 70-71 0.48750000000000004 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.6625 0.0 0.0 0.0 0.0 76-77 0.775 0.0 0.0 0.0 0.0 78-79 0.925 0.0 0.0 0.0 0.0 80-81 1.125 0.0 0.0 0.0 0.0 82-83 1.2374999999999998 0.0 0.0 0.0 0.0 84-85 1.4 0.0 0.0 0.0 0.0 86-87 1.5875 0.0 0.0 0.0 0.0 88-89 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6945013 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6945013_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4055 33.0 33.0 33.0 33.0 33.0 2 31.387 33.0 33.0 33.0 33.0 33.0 3 31.33025 33.0 33.0 33.0 33.0 33.0 4 31.446 33.0 33.0 33.0 33.0 33.0 5 31.4735 33.0 33.0 33.0 33.0 33.0 6 34.82575 37.0 37.0 37.0 33.0 37.0 7 34.72975 37.0 37.0 37.0 33.0 37.0 8 34.79625 37.0 37.0 37.0 33.0 37.0 9 34.94125 37.0 37.0 37.0 33.0 37.0 10-11 35.042500000000004 37.0 37.0 37.0 33.0 37.0 12-13 35.052125000000004 37.0 37.0 37.0 33.0 37.0 14-15 34.948750000000004 37.0 37.0 37.0 33.0 37.0 16-17 34.980125 37.0 37.0 37.0 33.0 37.0 18-19 35.0275 37.0 37.0 37.0 33.0 37.0 20-21 35.131375 37.0 37.0 37.0 33.0 37.0 22-23 34.99325 37.0 37.0 37.0 33.0 37.0 24-25 34.999875 37.0 37.0 37.0 33.0 37.0 26-27 35.041875 37.0 37.0 37.0 33.0 37.0 28-29 34.69025 37.0 37.0 37.0 33.0 37.0 30-31 34.859375 37.0 37.0 37.0 33.0 37.0 32-33 34.727500000000006 37.0 37.0 37.0 33.0 37.0 34-35 34.744625 37.0 37.0 37.0 33.0 37.0 36-37 34.625125 37.0 37.0 37.0 30.0 37.0 38-39 34.81925 37.0 37.0 37.0 33.0 37.0 40-41 34.7005 37.0 37.0 37.0 33.0 37.0 42-43 34.80325 37.0 37.0 37.0 33.0 37.0 44-45 34.921499999999995 37.0 37.0 37.0 33.0 37.0 46-47 34.942499999999995 37.0 37.0 37.0 33.0 37.0 48-49 34.787375 37.0 37.0 37.0 33.0 37.0 50-51 34.775000000000006 37.0 37.0 37.0 33.0 37.0 52-53 34.797124999999994 37.0 37.0 37.0 33.0 37.0 54-55 34.791 37.0 37.0 37.0 33.0 37.0 56-57 34.822625 37.0 37.0 37.0 33.0 37.0 58-59 34.479 37.0 37.0 37.0 30.0 37.0 60-61 34.5275 37.0 37.0 37.0 33.0 37.0 62-63 34.6255 37.0 37.0 37.0 33.0 37.0 64-65 34.431749999999994 37.0 37.0 37.0 30.0 37.0 66-67 34.443375 37.0 37.0 37.0 33.0 37.0 68-69 34.5125 37.0 37.0 37.0 33.0 37.0 70-71 34.424625 37.0 37.0 37.0 30.0 37.0 72-73 34.057249999999996 37.0 37.0 37.0 27.0 37.0 74-75 34.240375 37.0 37.0 37.0 27.0 37.0 76-77 34.1965 37.0 37.0 37.0 27.0 37.0 78-79 34.06325 37.0 37.0 37.0 27.0 37.0 80-81 34.13375 37.0 37.0 37.0 27.0 37.0 82-83 34.286375 37.0 37.0 37.0 30.0 37.0 84-85 34.341875 37.0 37.0 37.0 30.0 37.0 86-87 34.406125 37.0 37.0 37.0 33.0 37.0 88-89 34.34025 37.0 37.0 37.0 30.0 37.0 90-91 34.054875 37.0 37.0 37.0 27.0 37.0 92-93 33.971875 37.0 37.0 37.0 30.0 37.0 94-95 33.864999999999995 37.0 37.0 37.0 27.0 37.0 96-97 33.7415 37.0 37.0 37.0 27.0 37.0 98-99 33.66875 37.0 37.0 37.0 27.0 37.0 100-101 32.04375 37.0 35.0 37.0 14.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 94.0 3 11.0 4 6.0 5 6.0 6 6.0 7 2.0 8 3.0 9 5.0 10 1.0 11 4.0 12 5.0 13 6.0 14 3.0 15 4.0 16 6.0 17 3.0 18 4.0 19 5.0 20 6.0 21 6.0 22 11.0 23 14.0 24 18.0 25 19.0 26 21.0 27 21.0 28 39.0 29 45.0 30 48.0 31 73.0 32 67.0 33 95.0 34 136.0 35 285.0 36 2922.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.98687200201969 20.449381469325928 9.593536985609695 37.97020954304469 2 29.235041656147438 22.999242615501135 30.57308760414037 17.19262812421106 3 21.282504418076243 24.160565513759153 30.093410754859885 24.463519313304722 4 25.927796011108306 27.467811158798284 22.82251956576622 23.781873264327192 5 28.975265017667844 32.685512367491164 19.081272084805654 19.257950530035338 6 23.810722376038257 33.60181223256984 22.45154794865341 20.135917442738485 7 24.337957124842372 18.991172761664565 33.2156368221942 23.455233291298867 8 23.30978809283552 20.938446014127145 26.437941473259336 29.313824419778 9 22.69521410579345 22.821158690176322 27.984886649874056 26.498740554156168 10-11 25.610677411231432 26.718710652228655 22.916142029715438 24.75446990682448 12-13 26.996724615772234 22.91509196271101 24.35122197026959 25.736961451247165 14-15 25.26461693548387 24.697580645161292 25.0 25.037802419354836 16-17 27.08490803728899 24.263038548752835 23.507180650037792 25.144872763920382 18-19 26.070528967254408 24.83627204030227 22.896725440806044 26.19647355163728 20-21 26.111041168324313 25.582273700113305 23.983381593856226 24.323303537706156 22-23 26.320433631665196 23.950586159082317 23.849741585780915 25.879238623471572 24-25 25.21410579345088 24.43324937027708 24.34508816120907 26.007556675062972 26-27 25.352822580645164 24.886592741935484 25.226814516129032 24.53377016129032 28-29 26.22826908541194 24.94331065759637 22.650541698160744 26.17787855883094 30-31 26.197680282400405 23.44931921331316 25.39082198688855 24.96217851739788 32-33 25.90027700831025 25.698816419038025 24.401913875598087 23.99899269705364 34-35 27.44678171054289 24.058445648066506 23.730948482176597 24.763824159214007 36-37 25.210930613272886 25.12278050623347 25.525752424127944 24.140536456365698 38-39 26.38871394382164 25.292858042574633 24.700843935004407 23.617584078599318 40-41 26.727936547903813 24.58768727181166 23.58051114188594 25.103865038398588 42-43 26.114328884411986 24.099722991689752 25.24553009317552 24.54041803072274 44-45 26.509813789632613 24.559637644690486 24.194765978862605 24.73578258681429 46-47 26.094614997483646 24.119275289380976 24.24509310518369 25.54101660795169 48-49 24.977990189913218 24.361715507483336 25.569110803672494 25.091183498930953 50-51 26.372104733131923 24.57200402819738 24.886706948640484 24.169184290030213 52-53 26.3946606220879 24.480544012089158 24.316836670444527 24.807958695378414 54-55 25.554435483870968 24.495967741935484 24.382560483870968 25.56703629032258 56-57 25.997733853707665 25.569683998489236 24.134458013345082 24.298124134458014 58-59 26.73891129032258 25.239415322580644 23.639112903225808 24.382560483870968 60-61 26.533954894796523 25.387425979589267 24.127504094746126 23.95111503086809 62-63 25.6323140807852 25.846231282244876 24.197810494526237 24.32364414244369 64-65 25.968797181680927 24.81127327629592 24.081529944640163 25.13839959738299 66-67 25.758147728702657 24.927645652447463 24.449477790361144 24.86472882848874 68-69 26.21322604978627 25.094292180035204 24.98114156399296 23.711340206185564 70-71 25.534591194968552 25.295597484276726 24.61635220125786 24.553459119496857 72-73 26.230333543108873 24.946507237256135 24.782882315921963 24.040276903713025 74-75 25.75852952285031 25.657811909857735 24.977968022157874 23.60569054513408 76-77 26.591995972816513 25.069217216209417 23.82330732443997 24.515479486534105 78-79 27.12632108706593 24.77352793155511 24.14443885254152 23.955712128837444 80-81 25.893756294058406 25.037764350453173 25.730110775427995 23.338368580060422 82-83 26.076555023923444 25.056660790732817 24.087131704860237 24.779652480483506 84-85 25.07868563515045 25.305300264383735 25.053506231902308 24.562507868563515 86-87 26.813602015113354 24.34508816120907 24.798488664987406 24.042821158690174 88-89 26.617165869619935 24.339290208910143 24.842688144978606 24.200855776491316 90-91 25.78007045797685 25.213890286864622 24.81127327629592 24.194765978862605 92-93 26.727066817667044 25.292563231408078 24.826978734113503 23.153391216811375 94-95 27.33224222585925 25.443786982248522 23.69381845650258 23.53015233538965 96-97 26.59105229993699 25.822306238185256 24.700693131695022 22.885948330182735 98-99 26.223116589108287 25.506225631995978 24.47490881650107 23.795748962394665 100-101 27.216702301597284 23.97182744308892 24.764180606213053 24.04728964910074 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 12.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.0 26 2.5 27 3.0 28 4.0 29 4.5 30 4.5 31 6.5 32 9.0 33 13.0 34 17.0 35 21.5 36 35.0 37 52.5 38 66.0 39 86.5 40 118.0 41 128.5 42 140.5 43 173.0 44 169.5 45 170.5 46 181.0 47 177.5 48 173.0 49 174.5 50 170.5 51 159.5 52 141.5 53 122.5 54 116.5 55 106.0 56 102.0 57 94.0 58 89.0 59 98.5 60 90.0 61 81.5 62 87.5 63 73.0 64 71.5 65 73.0 66 60.5 67 57.5 68 49.0 69 43.5 70 41.5 71 30.0 72 23.0 73 17.5 74 12.0 75 10.0 76 6.5 77 3.5 78 3.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.975 3 0.975 4 0.975 5 0.95 6 0.675 7 0.8750000000000001 8 0.8999999999999999 9 0.75 10-11 0.7250000000000001 12-13 0.775 14-15 0.8 16-17 0.775 18-19 0.75 20-21 0.7125 22-23 0.8375 24-25 0.75 26-27 0.8 28-29 0.775 30-31 0.8500000000000001 32-33 0.7250000000000001 34-35 0.7625 36-37 0.7374999999999999 38-39 0.7625 40-41 0.7125 42-43 0.7250000000000001 44-45 0.65 46-47 0.65 48-49 0.6125 50-51 0.7000000000000001 52-53 0.7374999999999999 54-55 0.8 56-57 0.7125 58-59 0.8 60-61 0.7875 62-63 0.6625 64-65 0.65 66-67 0.6625 68-69 0.575 70-71 0.625 72-73 0.6875 74-75 0.7125 76-77 0.675 78-79 0.65 80-81 0.7000000000000001 82-83 0.7250000000000001 84-85 0.7125 86-87 0.75 88-89 0.675 90-91 0.65 92-93 0.6625 94-95 0.7125 96-97 0.8125 98-99 0.6125 100-101 0.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49482192472847 98.475 2 0.47991917150795654 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 23 0.575 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.1375 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.3375 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.5875 0.0 0.0 0.0 0.0 76-77 0.6875 0.0 0.0 0.0 0.0 78-79 0.825 0.0 0.0 0.0 0.0 80-81 1.0 0.0 0.0 0.0 0.0 82-83 1.0875 0.0 0.0 0.0 0.0 84-85 1.2125 0.0 0.0 0.0 0.0 86-87 1.375 0.0 0.0 0.0 0.0 88-89 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192979 spots for SRR6945013.sra Written 3192979 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra Read 3192965 spots for SRR6945013.sra Written 3192965 spots for SRR6945013.sra SRR ids: ['SRR6945013.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cykwz5t1 SRR6945013.sra spots: 63859314 blocks: [[1, 3192965], [3192966, 6385930], [6385931, 9578895], [9578896, 12771860], [12771861, 15964825], [15964826, 19157790], [19157791, 22350755], [22350756, 25543720], [25543721, 28736685], [28736686, 31929650], [31929651, 35122615], [35122616, 38315580], [38315581, 41508545], [41508546, 44701510], [44701511, 47894475], [47894476, 51087440], [51087441, 54280405], [54280406, 57473370], [57473371, 60666335], [60666336, 63859314]] SRR6945013 file size 15381864 SRR6945013 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6945013 SRR6945013_1.fastq SRR6945013_2.fastq Input file: SRR6945013_1.fastq Paired file: SRR6945013_2.fastq trimmed: SRR6945013-trimmed-pair1.fastq, SRR6945013-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:53:01 2024 >> started Fri Dec 6 09:54:03 2024 >> done (61.471s) 63859314 read pairs processed; of these: 825637 ( 1.29%) short read pairs filtered out after trimming by size control 1498152 ( 2.35%) empty read pairs filtered out after trimming by size control 61535525 (96.36%) read pairs available; of these: 12973029 (21.08%) trimmed read pairs available after processing 48562496 (78.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 269 0.00% 19 536 0.00% 20 753 0.00% 21 920 0.00% 22 1068 0.00% 23 1274 0.00% 24 1313 0.00% 25 1479 0.00% 26 1652 0.00% 27 1953 0.00% 28 2233 0.00% 29 2412 0.00% 30 2677 0.00% 31 2775 0.00% 32 2996 0.00% 33 3201 0.01% 34 3467 0.01% 35 3636 0.01% 36 4012 0.01% 37 4485 0.01% 38 4893 0.01% 39 5447 0.01% 40 5922 0.01% 41 6327 0.01% 42 6612 0.01% 43 6838 0.01% 44 7066 0.01% 45 7334 0.01% 46 8054 0.01% 47 9125 0.01% 48 10467 0.02% 49 11879 0.02% 50 13098 0.02% 51 14160 0.02% 52 15792 0.03% 53 15519 0.03% 54 15725 0.03% 55 17003 0.03% 56 18496 0.03% 57 20848 0.03% 58 24824 0.04% 59 42202 0.07% 60 50825 0.08% 61 49103 0.08% 62 50099 0.08% 63 49992 0.08% 64 50098 0.08% 65 51693 0.08% 66 53663 0.09% 67 58429 0.09% 68 78718 0.13% 69 176331 0.29% 70 92508 0.15% 71 66239 0.11% 72 61887 0.10% 73 62197 0.10% 74 63493 0.10% 75 65376 0.11% 76 69980 0.11% 77 71323 0.12% 78 74201 0.12% 79 78012 0.13% 80 81957 0.13% 81 85984 0.14% 82 92259 0.15% 83 98121 0.16% 84 105736 0.17% 85 113679 0.18% 86 123524 0.20% 87 130011 0.21% 88 136382 0.22% 89 146290 0.24% 90 158952 0.26% 91 175274 0.28% 92 194245 0.32% 93 216010 0.35% 94 249138 0.40% 95 294893 0.48% 96 360136 0.59% 97 479125 0.78% 98 694947 1.13% 99 1220570 1.98% 100 6110887 9.93% 101 48562496 78.92% 61535525 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=31 prefix-density=0.11 prefix-fanout=2.8 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=3 fanout-score=67.84 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=13.2 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.87 fanout-score-rank=25 prefix-density=0.23 prefix-fanout=3.8 sequence=CGGCCATGGCGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=235.09 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=24.0 sequence=AGAAGAAGAAGCTGGCCGGGTCATTTGACTTCATCGGCATCAACTATTATACCAGCAACTACGCCAAGCACGCCCCGGCGCCCAACGCGCTCACGCCGGCCTATGGCACCGACAACAACGCCAACCAGACCGGCTACCGCAACGGCGTCCCCATCGGCCCACCGGCTTTCACGCCCATCTTCTTTAACTACCCGCCGGGGCTGAGGGAGCTGCTGCTGTACATCAAGAGGACATACAAAGACCCCGCCATCTACATCACGGAGAACGGGACTGACGAGGCGAACAACAGCACGATCCCGATCAAGGAAGCGCTCAAGGACAACACCCGGATCATGTTCCACTACAAGCACCTCGAGTTCGTCTACAGGGCCATCCGGGAGGGCGTGAACGTGAAGGGGTACTTCACGTGGACGTTCATGGACTGCTTCGAGTTCGGGGACGGGTTCAAGGACCGGTTTGGGCTCATCTACGTGGACCGGGCCACGCTCGCCAGGTACCGCAAGAAGTCCAG SRR6945013 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:58:21 Started mapping on | Dec 06 09:58:21 Finished on | Dec 06 10:00:51 Mapping speed, Million of reads per hour | 1476.85 Number of input reads | 61535525 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 59314409 Uniquely mapped reads % | 96.39% Average mapped length | 198.71 Number of splices: Total | 39585966 Number of splices: Annotated (sjdb) | 37902603 Number of splices: GT/AG | 39081054 Number of splices: GC/AG | 437001 Number of splices: AT/AC | 22062 Number of splices: Non-canonical | 45849 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 593836 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 140084 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 1.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1695785 1695785 1695785 N_multimapping 593836 593836 593836 N_noFeature 1519581 57829158 1987774 N_ambiguous 1178647 5857 171218 UnstrandedReadsAssigned:56616181 PositiveStrandReadsAssigned:1479394 NegativeStrandReadsAssigned:57155417 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6945013 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6945013-trimmed-pair1.fastq SRR6945013-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,535,525 reads, 57,435,711 reads pseudoaligned [quant] estimated average fragment length: 204.657 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,487 rounds 52973 SRR6945013.ke.tsv 35125 SRR6945013.se.tsv 88098 total ==> SRR6945013.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.559 53.8405 1.91635 PNS24247 1044 840.343 99.235 3.07905 PNS24249 1928 1724.34 154.941 2.34288 PNS24246 1044 840.343 99.235 3.07905 PNS24248 1044 840.343 99.235 3.07905 PNS24244 1471 1267.34 295.514 6.07984 PNS24243 293 110.896 0 0 KQK14069 1603 1399.34 451.013 8.40377 KQK14071 474 273.741 14.7918 1.40894 ==> SRR6945013.se.tsv <== BRADI_1g14170v3 553 BRADI_1g53295v3 336 BRADI_1g59795v3 581 BRADI_1g07683v3 0 BRADI_1g00485v3 195 BRADI_1g20270v3 2645 BRADI_1g74790v3 1976 BRADI_1g09890v3 0 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR6945013 completed mapping pipeline successfully