Starting /dee2/code/volunteer_pipeline.sh SRR6945014 current disk space = 1552308981760 free memory = 1602174636 SRR6945014 SRAfilesize edffee507ecdf1dc04eb34ec40f3af1b SRR6945014.sra SRR6945014.sra file validated SRR6945014 is paired end SRR6945014 is conventional basespace SRR6945014 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6945014_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.29825 33.0 33.0 33.0 33.0 33.0 2 32.17175 33.0 33.0 33.0 33.0 33.0 3 32.31175 33.0 33.0 33.0 33.0 33.0 4 32.413 33.0 33.0 33.0 33.0 33.0 5 32.468 33.0 33.0 33.0 33.0 33.0 6 35.93725 37.0 37.0 37.0 33.0 37.0 7 36.1215 37.0 37.0 37.0 37.0 37.0 8 36.299 37.0 37.0 37.0 37.0 37.0 9 36.20875 37.0 37.0 37.0 37.0 37.0 10-11 36.194500000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.158 37.0 37.0 37.0 37.0 37.0 14-15 36.074875 37.0 37.0 37.0 37.0 37.0 16-17 36.069 37.0 37.0 37.0 37.0 37.0 18-19 35.81175 37.0 37.0 37.0 37.0 37.0 20-21 35.93325 37.0 37.0 37.0 37.0 37.0 22-23 35.78875 37.0 37.0 37.0 37.0 37.0 24-25 35.354875 37.0 37.0 37.0 35.0 37.0 26-27 35.47775 37.0 37.0 37.0 35.0 37.0 28-29 35.59325 37.0 37.0 37.0 35.0 37.0 30-31 35.32325 37.0 37.0 37.0 33.0 37.0 32-33 35.520375 37.0 37.0 37.0 35.0 37.0 34-35 34.95125 37.0 37.0 37.0 33.0 37.0 36-37 35.3145 37.0 37.0 37.0 35.0 37.0 38-39 35.441125 37.0 37.0 37.0 33.0 37.0 40-41 35.384874999999994 37.0 37.0 37.0 33.0 37.0 42-43 35.619375000000005 37.0 37.0 37.0 35.0 37.0 44-45 35.48350000000001 37.0 37.0 37.0 33.0 37.0 46-47 35.676874999999995 37.0 37.0 37.0 35.0 37.0 48-49 35.490875 37.0 37.0 37.0 35.0 37.0 50-51 35.7445 37.0 37.0 37.0 37.0 37.0 52-53 35.5625 37.0 37.0 37.0 35.0 37.0 54-55 35.574375 37.0 37.0 37.0 35.0 37.0 56-57 35.734 37.0 37.0 37.0 37.0 37.0 58-59 35.67475 37.0 37.0 37.0 37.0 37.0 60-61 35.525875 37.0 37.0 37.0 35.0 37.0 62-63 35.535 37.0 37.0 37.0 37.0 37.0 64-65 35.537375 37.0 37.0 37.0 35.0 37.0 66-67 35.519625 37.0 37.0 37.0 33.0 37.0 68-69 35.550124999999994 37.0 37.0 37.0 37.0 37.0 70-71 35.60525 37.0 37.0 37.0 37.0 37.0 72-73 35.674875 37.0 37.0 37.0 37.0 37.0 74-75 35.638000000000005 37.0 37.0 37.0 35.0 37.0 76-77 35.65375 37.0 37.0 37.0 37.0 37.0 78-79 35.59075 37.0 37.0 37.0 37.0 37.0 80-81 35.513875 37.0 37.0 37.0 35.0 37.0 82-83 35.4375 37.0 37.0 37.0 33.0 37.0 84-85 35.329375 37.0 37.0 37.0 33.0 37.0 86-87 35.377624999999995 37.0 37.0 37.0 33.0 37.0 88-89 35.301 37.0 37.0 37.0 33.0 37.0 90-91 35.38075 37.0 37.0 37.0 33.0 37.0 92-93 35.2845 37.0 37.0 37.0 33.0 37.0 94-95 34.786874999999995 37.0 37.0 37.0 33.0 37.0 96-97 35.06975 37.0 37.0 37.0 33.0 37.0 98-99 34.654624999999996 37.0 37.0 37.0 33.0 37.0 100-101 33.966125000000005 37.0 37.0 37.0 30.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 7.0 4 4.0 5 8.0 6 7.0 7 8.0 8 4.0 9 1.0 10 2.0 11 1.0 12 3.0 13 3.0 14 2.0 15 1.0 16 1.0 17 4.0 18 2.0 19 3.0 20 4.0 21 6.0 22 5.0 23 10.0 24 15.0 25 13.0 26 14.0 27 27.0 28 31.0 29 37.0 30 38.0 31 53.0 32 73.0 33 105.0 34 130.0 35 288.0 36 3084.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.020301926080165 8.120770432066632 5.517959396147839 45.34096824570536 2 24.25 9.475 34.9 31.374999999999996 3 21.875 11.325000000000001 23.1 43.7 4 27.35 18.425 21.0 33.225 5 28.249999999999996 23.474999999999998 24.224999999999998 24.05 6 24.2 29.925 22.85 23.025000000000002 7 18.825 23.799999999999997 38.75 18.625 8 20.474999999999998 23.925 31.225 24.375 9 20.125 21.125 34.300000000000004 24.45 10-11 22.7 30.475 25.0125 21.8125 12-13 24.1875 23.2125 27.6875 24.9125 14-15 23.799999999999997 24.4375 27.1375 24.625 16-17 23.990498812351543 24.57807225903238 25.86573321665208 25.565695711963997 18-19 24.1625 25.1 25.424999999999997 25.3125 20-21 22.9625 25.324999999999996 27.125 24.587500000000002 22-23 23.8625 25.8125 25.4 24.925 24-25 24.087500000000002 24.1375 25.2125 26.5625 26-27 23.7125 24.4375 26.8625 24.9875 28-29 23.8125 24.5125 25.15 26.525 30-31 22.715339417427177 25.62820352544068 24.603075384423054 27.053381672709087 32-33 22.825 24.675 25.775 26.724999999999998 34-35 23.799999999999997 25.137500000000003 25.0375 26.025 36-37 24.2 24.3125 25.0375 26.450000000000003 38-39 23.6625 25.412499999999998 25.374999999999996 25.55 40-41 23.674999999999997 25.2 25.05 26.075 42-43 23.974999999999998 26.1 24.8125 25.112499999999997 44-45 24.45 24.3875 25.137500000000003 26.025 46-47 24.5625 25.2125 24.3875 25.837500000000002 48-49 24.587500000000002 24.9125 24.712500000000002 25.7875 50-51 23.125 24.825 25.2625 26.787499999999998 52-53 24.725 25.05 24.962500000000002 25.2625 54-55 23.19039879984998 24.678084760595073 25.465683210401302 26.665833229153645 56-57 23.4875 24.7375 25.8625 25.912499999999998 58-59 23.962500000000002 25.587500000000002 24.575 25.874999999999996 60-61 23.775 25.25 24.7875 26.187500000000004 62-63 23.5125 24.325 25.6125 26.55 64-65 24.375 24.825 24.8 26.0 66-67 24.0125 24.075 25.174999999999997 26.737499999999997 68-69 23.65 25.15 24.75 26.450000000000003 70-71 23.3 25.825 24.6875 26.187500000000004 72-73 24.515564445555693 24.753094136767096 24.253031628953618 26.478309788723593 74-75 24.1875 24.7 24.887500000000003 26.224999999999998 76-77 24.4375 25.2125 23.9375 26.4125 78-79 24.0375 24.775 24.9 26.2875 80-81 24.6875 25.05 24.3 25.9625 82-83 24.224999999999998 25.4375 24.1125 26.224999999999998 84-85 24.5375 24.0125 25.025 26.424999999999997 86-87 24.175 25.2 24.337500000000002 26.2875 88-89 24.975 25.412499999999998 23.674999999999997 25.937500000000004 90-91 24.478059757469683 25.015626953369168 24.253031628953618 26.253281660207527 92-93 24.925 26.174999999999997 23.5125 25.387500000000003 94-95 23.92799099887486 25.678209776222026 24.40305038129766 25.99074884360545 96-97 25.2625 24.5125 23.7875 26.437500000000004 98-99 25.203150393799223 23.952994124265533 24.74059257407176 26.103262907863485 100-101 25.5125 24.075 24.85 25.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 0.0 28 0.5 29 1.0 30 3.5 31 10.0 32 11.0 33 16.0 34 24.0 35 31.5 36 43.5 37 53.5 38 74.5 39 87.5 40 106.5 41 137.5 42 164.0 43 179.5 44 166.5 45 176.0 46 192.5 47 185.0 48 191.0 49 193.5 50 165.5 51 139.5 52 137.0 53 134.5 54 126.5 55 115.0 56 96.5 57 89.0 58 90.5 59 83.5 60 72.5 61 71.0 62 67.5 63 58.5 64 57.0 65 60.0 66 59.0 67 60.0 68 57.5 69 42.5 70 35.5 71 36.0 72 29.0 73 19.5 74 15.0 75 12.0 76 9.5 77 5.5 78 1.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0125 96-97 0.0 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.44999999999999996 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.7125 0.0 0.0 0.0 0.0 80-81 0.8875 0.0 0.0 0.0 0.0 82-83 1.05 0.0 0.0 0.0 0.0 84-85 1.2375 0.0 0.0 0.0 0.0 86-87 1.3625 0.0 0.0 0.0 0.0 88-89 1.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6945014 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6945014_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.46175 33.0 33.0 33.0 33.0 33.0 2 31.47625 33.0 33.0 33.0 33.0 33.0 3 31.496 33.0 33.0 33.0 33.0 33.0 4 31.5175 33.0 33.0 33.0 33.0 33.0 5 31.75875 33.0 33.0 33.0 33.0 33.0 6 35.046 37.0 37.0 37.0 33.0 37.0 7 35.1045 37.0 37.0 37.0 33.0 37.0 8 35.0955 37.0 37.0 37.0 33.0 37.0 9 35.25325 37.0 37.0 37.0 33.0 37.0 10-11 35.3755 37.0 37.0 37.0 35.0 37.0 12-13 35.379999999999995 37.0 37.0 37.0 35.0 37.0 14-15 35.317750000000004 37.0 37.0 37.0 33.0 37.0 16-17 35.2565 37.0 37.0 37.0 33.0 37.0 18-19 35.408 37.0 37.0 37.0 33.0 37.0 20-21 35.518625 37.0 37.0 37.0 37.0 37.0 22-23 35.40825 37.0 37.0 37.0 35.0 37.0 24-25 35.420125 37.0 37.0 37.0 35.0 37.0 26-27 35.402125 37.0 37.0 37.0 35.0 37.0 28-29 35.122625 37.0 37.0 37.0 33.0 37.0 30-31 35.212374999999994 37.0 37.0 37.0 33.0 37.0 32-33 35.076375 37.0 37.0 37.0 33.0 37.0 34-35 35.070750000000004 37.0 37.0 37.0 33.0 37.0 36-37 34.992374999999996 37.0 37.0 37.0 33.0 37.0 38-39 35.17375 37.0 37.0 37.0 33.0 37.0 40-41 35.117125 37.0 37.0 37.0 33.0 37.0 42-43 35.217749999999995 37.0 37.0 37.0 33.0 37.0 44-45 35.329499999999996 37.0 37.0 37.0 33.0 37.0 46-47 35.2685 37.0 37.0 37.0 33.0 37.0 48-49 35.16725 37.0 37.0 37.0 33.0 37.0 50-51 35.239125 37.0 37.0 37.0 33.0 37.0 52-53 35.20625 37.0 37.0 37.0 33.0 37.0 54-55 35.108374999999995 37.0 37.0 37.0 33.0 37.0 56-57 35.2195 37.0 37.0 37.0 33.0 37.0 58-59 34.926500000000004 37.0 37.0 37.0 33.0 37.0 60-61 34.942499999999995 37.0 37.0 37.0 33.0 37.0 62-63 35.025125 37.0 37.0 37.0 33.0 37.0 64-65 34.939375 37.0 37.0 37.0 33.0 37.0 66-67 34.844375 37.0 37.0 37.0 33.0 37.0 68-69 34.907375 37.0 37.0 37.0 33.0 37.0 70-71 34.724374999999995 37.0 37.0 37.0 33.0 37.0 72-73 34.26075 37.0 37.0 37.0 27.0 37.0 74-75 34.622375 37.0 37.0 37.0 30.0 37.0 76-77 34.577625 37.0 37.0 37.0 30.0 37.0 78-79 34.44925 37.0 37.0 37.0 30.0 37.0 80-81 34.565875 37.0 37.0 37.0 33.0 37.0 82-83 34.57625 37.0 37.0 37.0 30.0 37.0 84-85 34.671 37.0 37.0 37.0 33.0 37.0 86-87 34.71925 37.0 37.0 37.0 33.0 37.0 88-89 34.570875 37.0 37.0 37.0 33.0 37.0 90-91 34.40875 37.0 37.0 37.0 30.0 37.0 92-93 34.284875 37.0 37.0 37.0 30.0 37.0 94-95 34.302125000000004 37.0 37.0 37.0 30.0 37.0 96-97 34.0965 37.0 37.0 37.0 30.0 37.0 98-99 34.027 37.0 37.0 37.0 27.0 37.0 100-101 32.47625 37.0 35.0 37.0 14.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 62.0 3 5.0 4 3.0 5 3.0 6 1.0 7 6.0 8 3.0 9 1.0 10 2.0 11 3.0 12 0.0 13 3.0 14 3.0 15 7.0 16 5.0 17 6.0 18 6.0 19 6.0 20 5.0 21 7.0 22 11.0 23 19.0 24 16.0 25 25.0 26 21.0 27 29.0 28 41.0 29 47.0 30 56.0 31 49.0 32 73.0 33 105.0 34 140.0 35 311.0 36 2920.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.72396359959555 18.832153690596563 10.06066734074823 39.383215369059656 2 28.986606014657568 22.340156684356835 30.45236290118777 18.220874399797825 3 20.96489012376863 25.511492801212427 29.401363980803236 24.12225309421571 4 25.58726951250316 27.506946198534983 22.37938873452892 24.526395554432938 5 31.616161616161616 30.12626262626263 17.9040404040404 20.353535353535353 6 23.11760261898766 36.71619239486276 19.239486275497356 20.926718710652228 7 23.5249621785174 20.675743822491174 32.07261724659607 23.72667675239536 8 24.62159434914228 22.250252270433904 25.45408678102926 27.674066599394553 9 24.666162761400855 21.869488536155202 28.72260015117158 24.741748551272362 10-11 25.598387503149407 28.080120937263793 21.22700932224742 25.09448223733938 12-13 26.65406427221172 23.364839319470697 23.831127914303718 26.149968494013866 14-15 25.769036812909736 24.77307110438729 24.117498739283914 25.34039334341906 16-17 26.767485822306234 23.95715185885318 23.301827347195967 25.973534971644614 18-19 25.630040322580644 24.508568548387096 23.462701612903224 26.398689516129032 20-21 27.2612748803225 24.90551776266062 23.87251196775006 23.960695389266817 22-23 26.676752395360566 24.420070600100857 23.5249621785174 25.37821482602118 24-25 25.201612903225808 25.806451612903224 23.387096774193548 25.60483870967742 26-27 26.61961179732796 25.031509957146458 24.212251071338542 24.13662717418704 28-29 26.175173282923758 24.083175803402646 23.67989918084436 26.061751732829237 30-31 24.92435703479576 25.025214321734744 24.609178013111446 25.44125063035804 32-33 26.278659611992943 24.237843285462333 25.321239606953895 24.16225749559083 34-35 25.75929426591052 24.763705103969755 23.868935097668555 25.608065532451164 36-37 25.456606625519584 25.091321325103916 23.466431540496284 25.98564050888021 38-39 25.557655954631382 25.683679899180845 24.24700693131695 24.511657214870823 40-41 26.671703815640345 24.744994333207405 23.397556982747762 25.18574486840448 42-43 25.056689342403626 24.5275888133031 24.5527840765936 25.862937767699673 44-45 25.771119224474383 24.60027697343573 24.36107264257837 25.26753115951152 46-47 26.0448136958711 23.91742195367573 24.15659617321249 25.88116817724068 48-49 25.69811320754717 24.364779874213838 24.9811320754717 24.955974842767294 50-51 26.146095717884133 25.579345088161208 23.702770780856422 24.571788413098236 52-53 27.05052286758221 24.064508000503967 23.762126748141615 25.122842383772202 54-55 25.598689185782707 25.53566927148979 24.073607259894125 24.792034282833374 56-57 25.119677500629884 25.08188460569413 24.842529604434365 24.95590828924162 58-59 27.410207939508506 23.931947069943288 23.81852551984877 24.839319470699433 60-61 26.65070564516129 25.17641129032258 23.815524193548388 24.35735887096774 62-63 26.72120830711139 25.185651353052236 23.763373190685964 24.32976714915041 64-65 26.42245720040282 24.307653575025174 23.841893252769385 25.42799597180262 66-67 25.179403248143018 25.355659070880023 24.977968022157874 24.486969658819085 68-69 26.31975867269985 25.51533433886375 24.09502262443439 24.06988436400201 70-71 27.34365169246257 23.920976469107842 24.361394236818924 24.373977601610672 72-73 26.09571788413098 24.710327455919394 25.1007556675063 24.093198992443323 74-75 26.596146581035136 24.908701674852036 24.807958695378414 23.687193048734418 76-77 26.84800402971918 24.49313688452336 23.724971666037025 24.93388741972044 78-79 26.16740088105727 25.475141598489614 24.279421019509126 24.078036500943988 80-81 26.883345930964982 24.981103552532126 24.741748551272362 23.393801965230537 82-83 26.240866717057195 25.031494079113127 23.456790123456788 25.27084908037289 84-85 26.656588561350464 24.6031746031746 24.615772234819854 24.124464600655077 86-87 26.3416477702192 25.044091710758376 24.666162761400855 23.948097757621568 88-89 26.186579378068743 24.638046078307944 23.958202190608084 25.217172353015233 90-91 26.211758781316885 24.726173989676443 24.36107264257837 24.7009945864283 92-93 25.9944612286002 25.528700906344408 25.528700906344408 22.948136958710975 94-95 27.2108843537415 24.77954144620811 23.708742756361804 24.300831443688587 96-97 26.781884697868048 24.927463100794753 23.577646019931876 24.713006181405323 98-99 25.817404426559353 25.33953722334004 24.308350100603622 24.53470824949698 100-101 27.044025157232703 25.295597484276726 23.371069182389938 24.28930817610063 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 20.0 1 11.5 2 1.5 3 0.0 4 1.5 5 2.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.0 27 1.5 28 2.0 29 2.0 30 5.5 31 6.5 32 6.0 33 14.5 34 25.0 35 32.0 36 36.5 37 46.5 38 71.0 39 96.5 40 106.0 41 114.5 42 134.0 43 153.0 44 173.0 45 186.0 46 198.5 47 187.5 48 156.5 49 158.0 50 169.5 51 156.5 52 136.0 53 115.0 54 100.0 55 94.0 56 93.0 57 94.5 58 101.5 59 102.5 60 84.0 61 78.5 62 82.5 63 78.5 64 72.5 65 76.5 66 78.5 67 67.0 68 56.0 69 48.5 70 41.5 71 32.5 72 21.5 73 18.0 74 12.5 75 13.0 76 15.5 77 6.0 78 3.5 79 4.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 1.075 3 1.0250000000000001 4 1.0250000000000001 5 1.0 6 0.7250000000000001 7 0.8500000000000001 8 0.8999999999999999 9 0.775 10-11 0.775 12-13 0.8125 14-15 0.8500000000000001 16-17 0.8125 18-19 0.8 20-21 0.775 22-23 0.8500000000000001 24-25 0.8 26-27 0.8250000000000001 28-29 0.8125 30-31 0.8500000000000001 32-33 0.775 34-35 0.8125 36-37 0.7625 38-39 0.8125 40-41 0.7374999999999999 42-43 0.775 44-45 0.7125 46-47 0.7000000000000001 48-49 0.625 50-51 0.75 52-53 0.7875 54-55 0.8250000000000001 56-57 0.775 58-59 0.8125 60-61 0.8 62-63 0.6875 64-65 0.7000000000000001 66-67 0.7125 68-69 0.5499999999999999 70-71 0.6625 72-73 0.75 74-75 0.7374999999999999 76-77 0.7374999999999999 78-79 0.6875 80-81 0.775 82-83 0.775 84-85 0.775 86-87 0.775 88-89 0.7125 90-91 0.7125 92-93 0.7000000000000001 94-95 0.775 96-97 0.9125 98-99 0.6 100-101 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82376636455186 99.125 2 0.12588116817724068 0.25 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 22 0.5499999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.42500000000000004 0.0 0.0 0.0 0.0 76-77 0.5125 0.0 0.0 0.0 0.0 78-79 0.7 0.0 0.0 0.0 0.0 80-81 0.8875 0.0 0.0 0.0 0.0 82-83 1.025 0.0 0.0 0.0 0.0 84-85 1.2125 0.0 0.0 0.0 0.0 86-87 1.35 0.0 0.0 0.0 0.0 88-89 1.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra Read 3187846 spots for SRR6945014.sra Written 3187846 spots for SRR6945014.sra Read 3187833 spots for SRR6945014.sra Written 3187833 spots for SRR6945014.sra SRR ids: ['SRR6945014.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ej4f_yb8 SRR6945014.sra spots: 63756673 blocks: [[1, 3187833], [3187834, 6375666], [6375667, 9563499], [9563500, 12751332], [12751333, 15939165], [15939166, 19126998], [19126999, 22314831], [22314832, 25502664], [25502665, 28690497], [28690498, 31878330], [31878331, 35066163], [35066164, 38253996], [38253997, 41441829], [41441830, 44629662], [44629663, 47817495], [47817496, 51005328], [51005329, 54193161], [54193162, 57380994], [57380995, 60568827], [60568828, 63756673]] SRR6945014 file size 15357106 SRR6945014 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6945014 SRR6945014_1.fastq SRR6945014_2.fastq Input file: SRR6945014_1.fastq Paired file: SRR6945014_2.fastq trimmed: SRR6945014-trimmed-pair1.fastq, SRR6945014-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:53:48 2024 >> started Fri Dec 6 09:55:57 2024 >> done (129.472s) 63756673 read pairs processed; of these: 575804 ( 0.90%) short read pairs filtered out after trimming by size control 1227270 ( 1.92%) empty read pairs filtered out after trimming by size control 61953599 (97.17%) read pairs available; of these: 12775312 (20.62%) trimmed read pairs available after processing 49178287 (79.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 232 0.00% 19 516 0.00% 20 696 0.00% 21 844 0.00% 22 953 0.00% 23 1086 0.00% 24 1200 0.00% 25 1308 0.00% 26 1504 0.00% 27 1568 0.00% 28 1759 0.00% 29 2024 0.00% 30 2145 0.00% 31 2330 0.00% 32 2347 0.00% 33 2448 0.00% 34 2633 0.00% 35 2844 0.00% 36 3184 0.01% 37 3394 0.01% 38 3601 0.01% 39 3910 0.01% 40 4626 0.01% 41 4696 0.01% 42 4888 0.01% 43 5144 0.01% 44 5184 0.01% 45 5369 0.01% 46 5866 0.01% 47 6665 0.01% 48 7542 0.01% 49 8426 0.01% 50 9462 0.02% 51 10466 0.02% 52 11427 0.02% 53 12096 0.02% 54 12885 0.02% 55 13834 0.02% 56 15063 0.02% 57 17240 0.03% 58 20763 0.03% 59 35587 0.06% 60 41468 0.07% 61 40069 0.06% 62 41498 0.07% 63 42127 0.07% 64 42095 0.07% 65 43856 0.07% 66 43473 0.07% 67 44301 0.07% 68 46385 0.07% 69 49863 0.08% 70 51353 0.08% 71 54385 0.09% 72 55449 0.09% 73 58063 0.09% 74 60298 0.10% 75 63698 0.10% 76 67502 0.11% 77 69433 0.11% 78 73423 0.12% 79 78385 0.13% 80 81884 0.13% 81 87103 0.14% 82 94277 0.15% 83 100632 0.16% 84 109063 0.18% 85 118054 0.19% 86 128154 0.21% 87 135398 0.22% 88 143138 0.23% 89 154278 0.25% 90 167501 0.27% 91 184557 0.30% 92 204613 0.33% 93 226623 0.37% 94 260124 0.42% 95 305199 0.49% 96 370636 0.60% 97 487527 0.79% 98 702059 1.13% 99 1215216 1.96% 100 6172397 9.96% 101 49178287 79.38% 61953599 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=93.32 fanout-score-rank=5 prefix-density=0.52 prefix-fanout=16.1 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=311.87 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=22.4 sequence=AGCAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGGGTGTGGGAGATGAAGAGCACCTCGTAAATCACCCCAGCAAGGCCACCGCCGATGAGGGGGCCAACCCAGTACACCCACTGGTACCCCCATTCCCAGCTAACCAACGCCGGGCCAAAGGAAACAGCCGGGTTCATGGAAGCGCCATCAAACGCGCCACCAACAAGGATGT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=155.05 fanout-score-rank=9 prefix-density=0.92 prefix-fanout=21.6 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=300.11 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=21.6 sequence=CGCCGCCGCCGA SRR6945014 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:58:35 Started mapping on | Dec 06 09:58:36 Finished on | Dec 06 10:00:55 Mapping speed, Million of reads per hour | 1604.55 Number of input reads | 61953599 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 60565740 Uniquely mapped reads % | 97.76% Average mapped length | 198.88 Number of splices: Total | 41995761 Number of splices: Annotated (sjdb) | 40166592 Number of splices: GT/AG | 41418574 Number of splices: GC/AG | 500534 Number of splices: AT/AC | 27612 Number of splices: Non-canonical | 49041 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 671632 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 56797 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 766501 766501 766501 N_multimapping 671632 671632 671632 N_noFeature 1577777 59141015 1998450 N_ambiguous 1150321 5692 152704 UnstrandedReadsAssigned:57837642 PositiveStrandReadsAssigned:1419033 NegativeStrandReadsAssigned:58414586 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6945014 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6945014-trimmed-pair1.fastq SRR6945014-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,953,599 reads, 58,744,567 reads pseudoaligned [quant] estimated average fragment length: 197.298 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,284 rounds 52973 SRR6945014.ke.tsv 35125 SRR6945014.se.tsv 88098 total ==> SRR6945014.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 739.886 23.8467 0.816245 PNS24247 1044 847.702 167.104 4.9923 PNS24249 1928 1731.7 349.099 5.10544 PNS24246 1044 847.702 167.104 4.9923 PNS24248 1044 847.702 167.104 4.9923 PNS24244 1471 1274.7 224.743 4.46513 PNS24243 293 114.954 0 0 KQK14069 1603 1406.7 3264.11 58.7652 KQK14071 474 280.327 154.401 13.949 ==> SRR6945014.se.tsv <== BRADI_1g14170v3 3702 BRADI_1g53295v3 404 BRADI_1g59795v3 780 BRADI_1g07683v3 0 BRADI_1g00485v3 289 BRADI_1g20270v3 4516 BRADI_1g74790v3 2362 BRADI_1g09890v3 0 BRADI_1g77505v3 535 BRADI_1g48960v3 0 SRR6945014 completed mapping pipeline successfully