Starting /dee2/code/volunteer_pipeline.sh SRR6958150 current disk space = 1550592417792 free memory = 1603486460 SRR6958150 SRAfilesize 971267088392e014758a1563747686f7 SRR6958150.sra SRR6958150.sra file validated SRR6958150 is paired end SRR6958150 is conventional basespace SRR6958150 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958150_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.3015 18.0 18.0 28.0 18.0 32.0 2 26.2265 26.0 25.0 30.0 18.0 33.0 3 28.45175 29.0 27.0 31.0 25.0 33.0 4 29.68725 31.0 29.0 33.0 25.0 33.0 5 31.2285 33.0 31.0 33.0 29.0 33.0 6 36.29225 38.0 36.0 38.0 33.0 38.0 7 36.92975 38.0 38.0 38.0 35.0 38.0 8 37.14375 38.0 38.0 38.0 36.0 38.0 9 37.31075 38.0 38.0 38.0 37.0 38.0 10-14 37.3068 38.0 38.0 38.0 36.8 38.0 15-19 37.4255 38.0 38.0 38.0 36.8 38.0 20-24 37.3173 38.0 38.0 38.0 36.8 38.0 25-29 37.16564999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.9861 38.0 38.0 38.0 35.6 38.0 35-39 36.971999999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.838 38.0 38.0 38.0 35.0 38.0 45-49 36.7445 38.0 38.0 38.0 34.8 38.0 50-54 36.38395 38.0 37.6 38.0 33.6 38.0 55-59 36.418400000000005 38.0 38.0 38.0 33.8 38.0 60-64 36.72955 38.0 38.0 38.0 34.6 38.0 65-69 36.853 38.0 38.0 38.0 34.8 38.0 70-74 36.522999999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.11895 38.0 37.2 38.0 32.4 38.0 80-84 36.1232 38.0 37.0 38.0 32.8 38.0 85-89 36.23415 38.0 37.2 38.0 33.4 38.0 90-94 36.166000000000004 38.0 37.2 38.0 33.2 38.0 95-99 35.7835 38.0 36.2 38.0 31.2 38.0 100-104 35.2179 38.0 35.6 38.0 28.6 38.0 105-109 34.64465 38.0 34.6 38.0 25.4 38.0 110-114 34.84224999999999 38.0 35.0 38.0 27.0 38.0 115-119 34.52589999999999 38.0 34.4 38.0 24.8 38.0 120-124 34.28 38.0 34.6 38.0 23.4 38.0 125-129 34.30325 38.0 34.4 38.0 24.8 38.0 130-134 33.7774 38.0 33.6 38.0 23.0 38.0 135-139 33.0484 37.8 32.4 38.0 19.8 38.0 140-144 32.1572 36.2 31.0 38.0 14.2 38.0 145-149 29.990049999999997 35.2 28.8 38.0 8.6 38.0 150-151 24.297125 32.0 11.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 0.0 15 1.0 16 0.0 17 3.0 18 2.0 19 8.0 20 4.0 21 1.0 22 8.0 23 17.0 24 19.0 25 21.0 26 33.0 27 39.0 28 40.0 29 55.0 30 78.0 31 106.0 32 161.0 33 233.0 34 358.0 35 529.0 36 1162.0 37 1118.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.89118198874296 25.569552398820694 3.055481104261592 45.48378450817475 2 18.95 14.424999999999999 29.15 37.475 3 18.05 14.149999999999999 29.475 38.324999999999996 4 24.7 18.8 23.575 32.925 5 25.874999999999996 23.65 23.400000000000002 27.075 6 25.900000000000002 29.25 22.675 22.175 7 18.65 23.5 37.45 20.4 8 21.05 24.0 28.275 26.674999999999997 9 20.175 21.95 32.0 25.874999999999996 10-14 22.545 25.745 25.735000000000003 25.974999999999998 15-19 23.02 24.66 25.83 26.490000000000002 20-24 23.04 24.695 26.02 26.245 25-29 22.895 24.38 26.3 26.424999999999997 30-34 23.445 24.215 25.669999999999998 26.669999999999998 35-39 23.32 25.055 25.89 25.735000000000003 40-44 23.79 24.91 25.285000000000004 26.015 45-49 23.36 24.895 25.564999999999998 26.179999999999996 50-54 23.549999999999997 24.485 26.105 25.86 55-59 23.724999999999998 25.045 25.505 25.724999999999998 60-64 23.65 24.945 25.324999999999996 26.08 65-69 23.955000000000002 24.560000000000002 25.105 26.38 70-74 24.215 24.93 24.825 26.029999999999998 75-79 23.674999999999997 24.325 25.900000000000002 26.1 80-84 24.4 24.54 25.095 25.965 85-89 23.494999999999997 24.775 25.430000000000003 26.3 90-94 24.395 24.375 25.595000000000002 25.635 95-99 23.955000000000002 24.09 25.895000000000003 26.06 100-104 24.21 24.165 25.085 26.540000000000003 105-109 24.45 23.965 25.615 25.97 110-114 23.935000000000002 24.57 25.380000000000003 26.115 115-119 24.404999999999998 24.59 25.11 25.895000000000003 120-124 24.240000000000002 24.485 25.069999999999997 26.205000000000002 125-129 24.19 24.65 24.79 26.369999999999997 130-134 24.84 23.54 25.480000000000004 26.14 135-139 24.525 24.64 24.81 26.025 140-144 24.485 24.455 25.09 25.97 145-149 24.63 23.845 25.195 26.33 150-151 24.5125 24.3 24.525 26.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 2.5 29 3.0 30 5.0 31 9.0 32 11.0 33 17.0 34 22.0 35 30.5 36 46.5 37 57.0 38 63.5 39 83.5 40 115.0 41 136.0 42 152.5 43 168.5 44 189.0 45 198.5 46 198.0 47 213.5 48 211.5 49 198.5 50 177.0 51 152.0 52 140.0 53 126.0 54 104.5 55 100.0 56 101.0 57 84.0 58 82.0 59 80.5 60 73.0 61 71.0 62 67.0 63 61.5 64 59.0 65 58.5 66 51.0 67 44.5 68 43.5 69 43.0 70 41.5 71 33.0 72 21.0 73 15.0 74 14.0 75 10.5 76 5.0 77 2.0 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.7250000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.0374999999999996 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTACT 10 0.006836113 144.9625 6 AACTAAA 10 0.006836113 144.9625 6 >>END_MODULE SRR6958150 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958150_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54475 33.0 33.0 34.0 32.0 34.0 2 32.45775 33.0 33.0 34.0 31.0 34.0 3 32.57875 33.0 33.0 34.0 32.0 34.0 4 32.47325 33.0 33.0 34.0 32.0 34.0 5 32.49325 33.0 33.0 34.0 32.0 34.0 6 36.634 38.0 38.0 38.0 35.0 38.0 7 36.515 38.0 38.0 38.0 34.0 38.0 8 36.519 38.0 38.0 38.0 34.0 38.0 9 36.666 38.0 38.0 38.0 35.0 38.0 10-14 36.565749999999994 38.0 38.0 38.0 34.4 38.0 15-19 36.725049999999996 38.0 38.0 38.0 35.4 38.0 20-24 36.70785 38.0 38.0 38.0 35.0 38.0 25-29 36.75554999999999 38.0 38.0 38.0 35.4 38.0 30-34 36.7789 38.0 38.0 38.0 35.4 38.0 35-39 36.5955 38.0 38.0 38.0 34.8 38.0 40-44 36.504900000000006 38.0 38.0 38.0 34.4 38.0 45-49 36.52695 38.0 38.0 38.0 34.6 38.0 50-54 36.46075 38.0 38.0 38.0 34.2 38.0 55-59 36.3984 38.0 38.0 38.0 34.2 38.0 60-64 36.2721 38.0 38.0 38.0 33.8 38.0 65-69 36.04385 38.0 37.8 38.0 32.8 38.0 70-74 36.0749 38.0 38.0 38.0 33.0 38.0 75-79 35.95485 38.0 37.4 38.0 33.0 38.0 80-84 35.752300000000005 38.0 37.2 38.0 31.8 38.0 85-89 35.815999999999995 38.0 37.2 38.0 32.2 38.0 90-94 35.64765 38.0 36.8 38.0 31.4 38.0 95-99 35.3702 38.0 36.2 38.0 29.4 38.0 100-104 35.13785 38.0 36.0 38.0 28.6 38.0 105-109 34.71215 38.0 35.0 38.0 26.8 38.0 110-114 34.2192 38.0 34.4 38.0 23.8 38.0 115-119 34.12305 38.0 34.2 38.0 23.4 38.0 120-124 33.8472 38.0 33.2 38.0 22.8 38.0 125-129 33.04025 38.0 32.8 38.0 18.6 38.0 130-134 31.984699999999997 37.2 30.8 38.0 13.0 38.0 135-139 31.608849999999997 36.2 30.2 38.0 13.0 38.0 140-144 31.149649999999998 36.4 29.2 38.0 12.2 38.0 145-149 29.441449999999996 36.0 26.2 38.0 3.8 38.0 150-151 23.13125 30.0 6.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 1.0 5 5.0 6 2.0 7 1.0 8 3.0 9 1.0 10 5.0 11 0.0 12 3.0 13 3.0 14 1.0 15 1.0 16 3.0 17 7.0 18 3.0 19 13.0 20 11.0 21 11.0 22 15.0 23 16.0 24 24.0 25 29.0 26 48.0 27 50.0 28 50.0 29 71.0 30 64.0 31 100.0 32 149.0 33 186.0 34 250.0 35 448.0 36 954.0 37 1455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.1 19.325 11.85 31.724999999999998 2 28.95 23.925 25.2 21.925 3 22.475 27.125 26.174999999999997 24.224999999999998 4 25.974999999999998 30.525000000000002 19.05 24.45 5 26.375 31.3 21.0 21.325 6 23.35 34.275 21.05 21.325 7 23.175 19.975 33.650000000000006 23.200000000000003 8 24.75 23.474999999999998 22.775000000000002 28.999999999999996 9 24.025 23.0 26.700000000000003 26.275 10-14 26.085 26.075 22.5 25.34 15-19 26.195 25.119999999999997 23.87 24.815 20-24 25.41 25.180000000000003 24.240000000000002 25.169999999999998 25-29 26.314999999999998 25.305 23.765 24.615000000000002 30-34 25.790000000000003 25.445 23.905 24.86 35-39 26.0 25.41 23.51 25.080000000000002 40-44 26.27 25.345000000000002 23.47 24.915000000000003 45-49 25.95 25.495 23.974999999999998 24.58 50-54 26.255 25.715 23.185 24.845 55-59 26.384999999999998 24.755 24.25 24.610000000000003 60-64 26.22 25.419999999999998 24.32 24.04 65-69 26.490000000000002 24.75 23.77 24.990000000000002 70-74 26.43 24.515 24.025 25.03 75-79 26.985 24.87 24.32 23.825 80-84 26.545 24.845 24.08 24.529999999999998 85-89 26.384999999999998 24.88 24.085 24.65 90-94 25.965 25.814999999999998 23.395 24.825 95-99 26.090000000000003 25.474999999999998 23.69 24.745 100-104 26.71 24.895 23.755000000000003 24.64 105-109 26.21 25.44 24.15 24.2 110-114 26.31 25.380000000000003 24.610000000000003 23.7 115-119 26.965 25.380000000000003 23.57 24.085 120-124 26.775 25.61 23.990000000000002 23.625 125-129 27.474999999999998 24.765 23.835 23.925 130-134 26.919999999999998 25.86 23.794999999999998 23.425 135-139 27.495000000000005 25.485000000000003 24.065 22.955000000000002 140-144 27.13 25.495 23.96 23.415 145-149 27.389999999999997 24.845 24.265 23.5 150-151 27.175 25.937500000000004 23.7 23.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 1.5 27 1.5 28 4.0 29 5.0 30 7.0 31 7.5 32 6.0 33 8.5 34 14.0 35 21.0 36 27.5 37 44.0 38 60.0 39 78.0 40 104.5 41 128.0 42 146.0 43 159.5 44 170.5 45 181.0 46 191.5 47 194.0 48 189.5 49 188.0 50 169.5 51 139.0 52 131.5 53 118.5 54 118.0 55 120.0 56 101.0 57 101.0 58 97.0 59 100.5 60 96.5 61 80.5 62 83.0 63 80.5 64 73.5 65 67.5 66 66.0 67 56.5 68 44.0 69 47.0 70 42.0 71 32.5 72 26.5 73 21.0 74 14.5 75 8.5 76 8.5 77 5.0 78 3.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08952959028832 97.95 2 0.7334344967121902 1.4500000000000002 3 0.12645422357106728 0.375 4 0.025290844714213456 0.1 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.7625 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.2875 0.0 0.0 0.0 0.0 136-137 3.7874999999999996 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGATCA 10 0.006830828 145.0 3 >>END_MODULE Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045748 spots for SRR6958150.sra Written 1045748 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra Read 1045745 spots for SRR6958150.sra Written 1045745 spots for SRR6958150.sra SRR ids: ['SRR6958150.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wuy0qz8q SRR6958150.sra spots: 20914903 blocks: [[1, 1045745], [1045746, 2091490], [2091491, 3137235], [3137236, 4182980], [4182981, 5228725], [5228726, 6274470], [6274471, 7320215], [7320216, 8365960], [8365961, 9411705], [9411706, 10457450], [10457451, 11503195], [11503196, 12548940], [12548941, 13594685], [13594686, 14640430], [14640431, 15686175], [15686176, 16731920], [16731921, 17777665], [17777666, 18823410], [18823411, 19869155], [19869156, 20914903]] SRR6958150 file size 7065673 SRR6958150 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958150 SRR6958150_1.fastq SRR6958150_2.fastq Input file: SRR6958150_1.fastq Paired file: SRR6958150_2.fastq trimmed: SRR6958150-trimmed-pair1.fastq, SRR6958150-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:24:07 2024 >> started Fri Dec 6 14:24:31 2024 >> done (24.377s) 20914903 read pairs processed; of these: 27454 ( 0.13%) short read pairs filtered out after trimming by size control 24690 ( 0.12%) empty read pairs filtered out after trimming by size control 20862759 (99.75%) read pairs available; of these: 9585126 (45.94%) trimmed read pairs available after processing 11277633 (54.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 7 0.00% 23 1 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 10 0.00% 28 8 0.00% 29 5 0.00% 30 7 0.00% 31 10 0.00% 32 4 0.00% 33 8 0.00% 34 12 0.00% 35 9 0.00% 36 5 0.00% 37 10 0.00% 38 11 0.00% 39 19 0.00% 40 14 0.00% 41 18 0.00% 42 12 0.00% 43 13 0.00% 44 21 0.00% 45 23 0.00% 46 30 0.00% 47 27 0.00% 48 26 0.00% 49 27 0.00% 50 44 0.00% 51 54 0.00% 52 44 0.00% 53 57 0.00% 54 53 0.00% 55 64 0.00% 56 72 0.00% 57 93 0.00% 58 86 0.00% 59 114 0.00% 60 110 0.00% 61 134 0.00% 62 161 0.00% 63 164 0.00% 64 168 0.00% 65 212 0.00% 66 222 0.00% 67 249 0.00% 68 275 0.00% 69 291 0.00% 70 373 0.00% 71 395 0.00% 72 438 0.00% 73 473 0.00% 74 550 0.00% 75 671 0.00% 76 795 0.00% 77 770 0.00% 78 911 0.00% 79 942 0.00% 80 1166 0.01% 81 1339 0.01% 82 1572 0.01% 83 1835 0.01% 84 3005 0.01% 85 3800 0.02% 86 3959 0.02% 87 4035 0.02% 88 4164 0.02% 89 4289 0.02% 90 4657 0.02% 91 4931 0.02% 92 5203 0.02% 93 5766 0.03% 94 6313 0.03% 95 6568 0.03% 96 7133 0.03% 97 7504 0.04% 98 8212 0.04% 99 8580 0.04% 100 9376 0.04% 101 10069 0.05% 102 10708 0.05% 103 11539 0.06% 104 12593 0.06% 105 13520 0.06% 106 14254 0.07% 107 15122 0.07% 108 16086 0.08% 109 16885 0.08% 110 17977 0.09% 111 18737 0.09% 112 20381 0.10% 113 21297 0.10% 114 22588 0.11% 115 24240 0.12% 116 25818 0.12% 117 27189 0.13% 118 28485 0.14% 119 29533 0.14% 120 30927 0.15% 121 32575 0.16% 122 33884 0.16% 123 36127 0.17% 124 38543 0.18% 125 40551 0.19% 126 42954 0.21% 127 44688 0.21% 128 46949 0.23% 129 49416 0.24% 130 51783 0.25% 131 54730 0.26% 132 57979 0.28% 133 61426 0.29% 134 65209 0.31% 135 69019 0.33% 136 73572 0.35% 137 77838 0.37% 138 82164 0.39% 139 89579 0.43% 140 96088 0.46% 141 105305 0.50% 142 117635 0.56% 143 132871 0.64% 144 153744 0.74% 145 184178 0.88% 146 231827 1.11% 147 315519 1.51% 148 487893 2.34% 149 989873 4.74% 150 5220505 25.02% 151 11277633 54.06% 20862759 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=21 prefix-density=0.63 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=119.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.5 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=63.65 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=11.6 sequence=GCCGCCGCCGCC SRR6958150 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:25:36 Started mapping on | Dec 06 14:25:36 Finished on | Dec 06 14:27:13 Mapping speed, Million of reads per hour | 774.29 Number of input reads | 20862759 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20403373 Uniquely mapped reads % | 97.80% Average mapped length | 296.07 Number of splices: Total | 23512387 Number of splices: Annotated (sjdb) | 22038310 Number of splices: GT/AG | 23206663 Number of splices: GC/AG | 280257 Number of splices: AT/AC | 9187 Number of splices: Non-canonical | 16280 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 145327 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 16912 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.90% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 330320 330320 330320 N_multimapping 145327 145327 145327 N_noFeature 615664 19852845 768161 N_ambiguous 475051 2593 78046 UnstrandedReadsAssigned:19312658 PositiveStrandReadsAssigned:547935 NegativeStrandReadsAssigned:19557166 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958150 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958150-trimmed-pair1.fastq SRR6958150-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,862,759 reads, 19,580,454 reads pseudoaligned [quant] estimated average fragment length: 250.49 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR6958150.ke.tsv 35125 SRR6958150.se.tsv 88098 total ==> SRR6958150.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.885 0 0 PNS24247 1044 794.51 76.3228 7.22502 PNS24249 1928 1678.51 58.5533 2.62368 PNS24246 1044 794.51 76.3228 7.22502 PNS24248 1044 794.51 76.3228 7.22502 PNS24244 1471 1221.51 27.4783 1.69191 PNS24243 293 87.0012 0 0 KQK14069 1603 1353.51 6680.63 371.227 KQK14071 474 234.633 142.845 45.7889 ==> SRR6958150.se.tsv <== BRADI_1g14170v3 7445 BRADI_1g53295v3 242 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 235 BRADI_1g74790v3 150 BRADI_1g09890v3 0 BRADI_1g77505v3 310 BRADI_1g48960v3 0 SRR6958150 completed mapping pipeline successfully