Starting /dee2/code/volunteer_pipeline.sh SRR6958151 current disk space = 1550590955520 free memory = 1603480256 SRR6958151 SRAfilesize 84a09623b3597aa06d69f02112071b32 SRR6958151.sra SRR6958151.sra file validated SRR6958151 is paired end SRR6958151 is conventional basespace SRR6958151 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958151_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.08425 32.0 25.0 33.0 18.0 34.0 2 31.01975 33.0 29.0 33.0 27.0 34.0 3 31.393 33.0 31.0 33.0 28.0 33.0 4 32.578 33.0 33.0 33.0 31.0 34.0 5 32.4855 33.0 33.0 33.0 31.0 34.0 6 36.238 38.0 36.0 38.0 33.0 38.0 7 37.4095 38.0 38.0 38.0 37.0 38.0 8 37.567 38.0 38.0 38.0 37.0 38.0 9 37.6835 38.0 38.0 38.0 38.0 38.0 10-14 37.7223 38.0 38.0 38.0 38.0 38.0 15-19 37.6405 38.0 38.0 38.0 38.0 38.0 20-24 37.68055 38.0 38.0 38.0 38.0 38.0 25-29 37.66015 38.0 38.0 38.0 38.0 38.0 30-34 37.63955 38.0 38.0 38.0 37.8 38.0 35-39 37.57195 38.0 38.0 38.0 37.8 38.0 40-44 37.60485 38.0 38.0 38.0 38.0 38.0 45-49 37.6392 38.0 38.0 38.0 38.0 38.0 50-54 37.5419 38.0 38.0 38.0 38.0 38.0 55-59 37.5302 38.0 38.0 38.0 38.0 38.0 60-64 37.49825 38.0 38.0 38.0 37.6 38.0 65-69 37.38595 38.0 38.0 38.0 37.0 38.0 70-74 37.41295 38.0 38.0 38.0 37.0 38.0 75-79 37.37655 38.0 38.0 38.0 37.0 38.0 80-84 37.350550000000005 38.0 38.0 38.0 37.0 38.0 85-89 37.025400000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.1769 38.0 38.0 38.0 36.0 38.0 95-99 37.1505 38.0 38.0 38.0 36.0 38.0 100-104 36.966750000000005 38.0 38.0 38.0 35.6 38.0 105-109 36.92545 38.0 38.0 38.0 35.4 38.0 110-114 36.76775 38.0 38.0 38.0 34.8 38.0 115-119 36.6877 38.0 38.0 38.0 34.6 38.0 120-124 36.581900000000005 38.0 38.0 38.0 34.2 38.0 125-129 36.424549999999996 38.0 38.0 38.0 34.0 38.0 130-134 36.43295 38.0 38.0 38.0 34.0 38.0 135-139 36.2895 38.0 38.0 38.0 33.8 38.0 140-144 34.4859 37.8 34.4 38.0 27.2 38.0 145-149 35.149449999999995 38.0 35.2 38.0 31.2 38.0 150-151 32.528000000000006 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 3.0 20 2.0 21 2.0 22 0.0 23 0.0 24 8.0 25 5.0 26 4.0 27 10.0 28 10.0 29 17.0 30 17.0 31 35.0 32 43.0 33 80.0 34 98.0 35 195.0 36 638.0 37 2829.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.003880983182405 10.711513583441139 6.28719275549806 33.997412677878394 2 23.875 13.025 36.725 26.375 3 20.275000000000002 18.3 26.150000000000002 35.275 4 25.174999999999997 28.65 21.525 24.65 5 24.15 31.15 24.975 19.725 6 20.775 32.925 25.05 21.25 7 17.1 24.025 40.5 18.375 8 19.05 23.9 31.225 25.825 9 18.925 23.325000000000003 33.025 24.725 10-14 22.23 27.965 26.02 23.785 15-19 22.235 27.37 26.02 24.375 20-24 22.384999999999998 26.784999999999997 26.39 24.44 25-29 22.314999999999998 26.724999999999998 26.66 24.3 30-34 22.085 26.810000000000002 26.545 24.560000000000002 35-39 22.185 26.645000000000003 26.575 24.595 40-44 21.88 26.56 26.834999999999997 24.725 45-49 22.040000000000003 26.939999999999998 26.505000000000003 24.515 50-54 22.134999999999998 26.25 26.640000000000004 24.975 55-59 22.220000000000002 26.365 26.584999999999997 24.83 60-64 22.18 26.790000000000003 26.119999999999997 24.91 65-69 21.81 26.625 26.52 25.045 70-74 22.105 26.51 26.515 24.87 75-79 22.15 26.77 26.395000000000003 24.685000000000002 80-84 22.465 26.525 26.279999999999998 24.73 85-89 22.24 26.86 26.3 24.6 90-94 22.625 26.634999999999998 26.25 24.490000000000002 95-99 22.165000000000003 27.16 25.590000000000003 25.085 100-104 22.899464544863132 26.517539908922583 26.24731021368163 24.335685332532652 105-109 22.325 26.665 25.82 25.19 110-114 22.440708495947163 26.568598018613027 26.02821975382768 24.96247373161213 115-119 23.02727045283963 26.579934951213406 26.029522141606204 24.363272454340756 120-124 22.770000000000003 26.865 25.679999999999996 24.685000000000002 125-129 22.035172102810762 27.275915627035424 25.58244401022095 25.106468259932864 130-134 22.96 26.810000000000002 25.430000000000003 24.8 135-139 22.585 27.075 24.83 25.509999999999998 140-144 22.195 26.715 25.509999999999998 25.580000000000002 145-149 22.475 26.650000000000002 25.435000000000002 25.44 150-151 22.400000000000002 26.387500000000003 25.924999999999997 25.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 4.0 29 10.0 30 13.0 31 17.5 32 23.0 33 24.5 34 33.5 35 52.5 36 68.0 37 73.5 38 92.0 39 121.0 40 149.0 41 183.0 42 215.0 43 225.0 44 234.0 45 241.5 46 224.0 47 208.0 48 206.0 49 199.0 50 177.5 51 156.5 52 128.5 53 97.0 54 92.0 55 89.5 56 76.0 57 64.0 58 59.0 59 59.0 60 53.5 61 49.0 62 36.5 63 30.5 64 35.5 65 30.5 66 24.5 67 20.5 68 19.0 69 18.0 70 14.5 71 12.5 72 8.5 73 6.5 74 7.5 75 5.5 76 2.5 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.0 110-114 0.06999999999999999 115-119 0.075 120-124 0.0 125-129 0.20500000000000002 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.3375 0.0 0.0 0.0 0.0 114-115 3.825 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.775 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.2125 0.0 0.0 0.0 0.0 126-127 6.7375 0.0 0.0 0.0 0.0 128-129 7.35 0.0 0.0 0.0 0.0 130-131 7.925 0.0 0.0 0.0 0.0 132-133 8.6125 0.0 0.0 0.0 0.0 134-135 9.2 0.0 0.0 0.0 0.0 136-137 9.7375 0.0 0.0 0.0 0.0 138-139 10.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958151 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958151_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.80625 32.0 25.0 33.0 18.0 34.0 2 31.63025 33.0 32.0 34.0 27.0 34.0 3 32.45875 33.0 32.0 34.0 31.0 34.0 4 32.996 33.0 33.0 34.0 32.0 34.0 5 33.12175 33.0 33.0 34.0 33.0 34.0 6 37.5265 38.0 38.0 38.0 38.0 38.0 7 37.522 38.0 38.0 38.0 38.0 38.0 8 37.507 38.0 38.0 38.0 38.0 38.0 9 37.521 38.0 38.0 38.0 38.0 38.0 10-14 37.539100000000005 38.0 38.0 38.0 38.0 38.0 15-19 36.44775 38.0 36.8 38.0 32.0 38.0 20-24 36.33645 38.0 37.0 38.0 31.6 38.0 25-29 37.40965 38.0 38.0 38.0 37.6 38.0 30-34 37.56945 38.0 38.0 38.0 38.0 38.0 35-39 37.481100000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.414500000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.0652 38.0 38.0 38.0 36.0 38.0 50-54 37.47455 38.0 38.0 38.0 38.0 38.0 55-59 37.474000000000004 38.0 38.0 38.0 38.0 38.0 60-64 37.42915 38.0 38.0 38.0 38.0 38.0 65-69 37.418899999999994 38.0 38.0 38.0 38.0 38.0 70-74 37.3447 38.0 38.0 38.0 37.8 38.0 75-79 37.3232 38.0 38.0 38.0 37.8 38.0 80-84 37.296049999999994 38.0 38.0 38.0 37.4 38.0 85-89 37.2538 38.0 38.0 38.0 37.2 38.0 90-94 37.278650000000006 38.0 38.0 38.0 37.2 38.0 95-99 37.137299999999996 38.0 38.0 38.0 37.0 38.0 100-104 37.0069 38.0 38.0 38.0 36.2 38.0 105-109 36.9174 38.0 38.0 38.0 36.0 38.0 110-114 36.7453 38.0 38.0 38.0 35.2 38.0 115-119 36.87565 38.0 38.0 38.0 36.0 38.0 120-124 36.74555 38.0 38.0 38.0 35.0 38.0 125-129 35.30175 38.0 35.8 38.0 29.0 38.0 130-134 35.7491 38.0 36.8 38.0 31.4 38.0 135-139 35.48010000000001 38.0 37.2 38.0 29.8 38.0 140-144 35.07365 38.0 35.8 38.0 29.6 38.0 145-149 33.1602 37.6 32.6 38.0 22.2 38.0 150-151 29.24 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 1.0 5 1.0 6 0.0 7 1.0 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 2.0 19 1.0 20 4.0 21 3.0 22 4.0 23 6.0 24 4.0 25 3.0 26 9.0 27 8.0 28 16.0 29 16.0 30 28.0 31 38.0 32 39.0 33 82.0 34 124.0 35 238.0 36 733.0 37 2622.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.875 21.425 11.125 27.575 2 29.925 24.05 28.999999999999996 17.025000000000002 3 22.1 25.124999999999996 31.275 21.5 4 25.3 32.2 22.325 20.175 5 26.75 35.449999999999996 19.675 18.125 6 22.900000000000002 36.825 20.974999999999998 19.3 7 22.325 18.7 36.95 22.025 8 23.525 23.7 25.15 27.625 9 21.9 24.224999999999998 27.875 26.0 10-14 25.575 26.334999999999997 24.355 23.735 15-19 25.39 26.32 25.56 22.73 20-24 25.130000000000003 26.43 25.1 23.34 25-29 24.705 25.840000000000003 26.145000000000003 23.31 30-34 24.925 26.265 26.275 22.535 35-39 25.115 26.35 25.785000000000004 22.75 40-44 24.945 26.355 26.064999999999998 22.634999999999998 45-49 24.79 25.94 26.195 23.075000000000003 50-54 25.235000000000003 25.915 26.21 22.64 55-59 24.875 25.86 26.55 22.715 60-64 25.095 26.365 26.19 22.35 65-69 24.795 26.76 25.805 22.64 70-74 25.290000000000003 26.200000000000003 26.415 22.095000000000002 75-79 24.93 26.534999999999997 25.72 22.814999999999998 80-84 24.54 27.185 25.8 22.475 85-89 25.21 26.085 26.51 22.195 90-94 25.155 26.455000000000002 26.135 22.255 95-99 24.775 26.71 26.07 22.445 100-104 25.064999999999998 26.345000000000002 26.045 22.545 105-109 25.11 26.71 25.855 22.325 110-114 25.124999999999996 26.76 26.174999999999997 21.94 115-119 25.624999999999996 26.26 26.090000000000003 22.025 120-124 25.645 26.640000000000004 26.02 21.695 125-129 25.865 27.24 25.355 21.54 130-134 26.26 26.325 26.090000000000003 21.325 135-139 26.415 27.150000000000002 25.16 21.275 140-144 26.505000000000003 26.905 25.629999999999995 20.96 145-149 26.69 26.88 25.96 20.47 150-151 26.200000000000003 26.25 25.75 21.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 1.0 29 3.0 30 9.0 31 13.0 32 18.0 33 24.0 34 35.5 35 54.5 36 65.5 37 81.0 38 97.0 39 117.5 40 141.0 41 165.5 42 199.5 43 220.0 44 222.0 45 216.0 46 210.0 47 213.0 48 203.5 49 183.0 50 169.5 51 144.5 52 116.0 53 107.0 54 98.5 55 83.5 56 82.5 57 77.5 58 76.5 59 71.5 60 64.5 61 64.0 62 51.5 63 47.5 64 45.5 65 33.0 66 30.0 67 34.0 68 31.0 69 22.5 70 15.5 71 11.5 72 11.0 73 6.5 74 3.0 75 3.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.3125 0.0 0.0 0.0 0.0 114-115 3.775 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.6625 0.0 0.0 0.0 0.0 120-121 5.050000000000001 0.0 0.0 0.0 0.0 122-123 5.475 0.0 0.0 0.0 0.0 124-125 6.0 0.0 0.0 0.0 0.0 126-127 6.5125 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.6625 0.0 0.0 0.0 0.0 132-133 8.2625 0.0 0.0 0.0 0.0 134-135 8.85 0.0 0.0 0.0 0.0 136-137 9.3875 0.0 0.0 0.0 0.0 138-139 9.837499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCATCC 10 0.006830828 145.0 3 TTGCTGA 10 0.006830828 145.0 2 >>END_MODULE Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851164 spots for SRR6958151.sra Written 851164 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra Read 851157 spots for SRR6958151.sra Written 851157 spots for SRR6958151.sra SRR ids: ['SRR6958151.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k9uddr2q SRR6958151.sra spots: 17023147 blocks: [[1, 851157], [851158, 1702314], [1702315, 2553471], [2553472, 3404628], [3404629, 4255785], [4255786, 5106942], [5106943, 5958099], [5958100, 6809256], [6809257, 7660413], [7660414, 8511570], [8511571, 9362727], [9362728, 10213884], [10213885, 11065041], [11065042, 11916198], [11916199, 12767355], [12767356, 13618512], [13618513, 14469669], [14469670, 15320826], [15320827, 16171983], [16171984, 17023147]] SRR6958151 file size 5746885 SRR6958151 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958151 SRR6958151_1.fastq SRR6958151_2.fastq Input file: SRR6958151_1.fastq Paired file: SRR6958151_2.fastq trimmed: SRR6958151-trimmed-pair1.fastq, SRR6958151-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:22:25 2024 >> started Fri Dec 6 14:22:43 2024 >> done (17.544s) 17023147 read pairs processed; of these: 8195 ( 0.05%) short read pairs filtered out after trimming by size control 11224 ( 0.07%) empty read pairs filtered out after trimming by size control 17003728 (99.89%) read pairs available; of these: 6482454 (38.12%) trimmed read pairs available after processing 10521274 (61.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 14 0.00% 21 12 0.00% 22 5 0.00% 23 12 0.00% 24 14 0.00% 25 22 0.00% 26 15 0.00% 27 13 0.00% 28 17 0.00% 29 17 0.00% 30 20 0.00% 31 16 0.00% 32 16 0.00% 33 16 0.00% 34 10 0.00% 35 21 0.00% 36 22 0.00% 37 21 0.00% 38 26 0.00% 39 36 0.00% 40 32 0.00% 41 38 0.00% 42 30 0.00% 43 46 0.00% 44 35 0.00% 45 59 0.00% 46 53 0.00% 47 51 0.00% 48 63 0.00% 49 82 0.00% 50 92 0.00% 51 97 0.00% 52 118 0.00% 53 127 0.00% 54 130 0.00% 55 139 0.00% 56 166 0.00% 57 181 0.00% 58 228 0.00% 59 281 0.00% 60 316 0.00% 61 372 0.00% 62 408 0.00% 63 473 0.00% 64 465 0.00% 65 530 0.00% 66 604 0.00% 67 641 0.00% 68 803 0.00% 69 883 0.01% 70 1008 0.01% 71 1177 0.01% 72 1355 0.01% 73 1450 0.01% 74 1566 0.01% 75 1722 0.01% 76 2045 0.01% 77 2325 0.01% 78 2572 0.02% 79 2915 0.02% 80 3182 0.02% 81 3765 0.02% 82 4166 0.02% 83 4638 0.03% 84 5555 0.03% 85 6103 0.04% 86 6655 0.04% 87 7123 0.04% 88 7743 0.05% 89 8428 0.05% 90 9066 0.05% 91 10071 0.06% 92 11124 0.07% 93 12012 0.07% 94 13119 0.08% 95 13892 0.08% 96 14924 0.09% 97 15821 0.09% 98 16386 0.10% 99 17838 0.10% 100 20708 0.12% 101 22902 0.13% 102 21535 0.13% 103 22749 0.13% 104 24150 0.14% 105 25049 0.15% 106 26552 0.16% 107 27245 0.16% 108 28015 0.16% 109 29325 0.17% 110 30107 0.18% 111 31934 0.19% 112 33438 0.20% 113 34944 0.21% 114 36656 0.22% 115 38449 0.23% 116 38684 0.23% 117 40292 0.24% 118 41199 0.24% 119 41784 0.25% 120 43052 0.25% 121 44466 0.26% 122 45849 0.27% 123 48047 0.28% 124 49777 0.29% 125 51248 0.30% 126 52647 0.31% 127 53935 0.32% 128 53888 0.32% 129 55522 0.33% 130 56890 0.33% 131 57607 0.34% 132 59939 0.35% 133 61838 0.36% 134 63253 0.37% 135 66125 0.39% 136 67944 0.40% 137 69307 0.41% 138 71340 0.42% 139 73227 0.43% 140 76193 0.45% 141 79913 0.47% 142 84880 0.50% 143 90138 0.53% 144 98841 0.58% 145 112944 0.66% 146 132370 0.78% 147 160819 0.95% 148 245840 1.45% 149 467394 2.75% 150 2953854 17.37% 151 10521274 61.88% 17003728 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=5.60 fanout-score-rank=17 prefix-density=0.41 prefix-fanout=3.8 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=47.74 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.2 sequence=GGCGGCGGCGGCCTCGAAGCCTGACTTGGTCGCCGGCGGCGCAACGCCCATGACGAGTGTCTGGGAAGAAGTCGCCTCCTCGGCCATCATCTCTGGGTACAT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.66 fanout-score-rank=15 prefix-density=0.28 prefix-fanout=4.1 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=82.97 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=14.4 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGCGCCTCGCAGTCGCAGGTTGCCTAGCTCGACTTGTGAGAGTTGAGCTACGTATAGTACCAGCTGGCCACCCTCTGAGAATAATATACTGTAATAAGATGAAGAAGAATAAAATTCCCACGATCACATGTACTGTTATACTGAGAGTAGAGTCTGTACCGTGGGATTTATACCGGACGTCGTTGTGTAAATTTCCTTTTAATTTGTTTG SRR6958151 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:23:32 Started mapping on | Dec 06 14:23:33 Finished on | Dec 06 14:24:42 Mapping speed, Million of reads per hour | 887.15 Number of input reads | 17003728 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16664057 Uniquely mapped reads % | 98.00% Average mapped length | 293.23 Number of splices: Total | 18427552 Number of splices: Annotated (sjdb) | 17315388 Number of splices: GT/AG | 18198106 Number of splices: GC/AG | 203343 Number of splices: AT/AC | 8352 Number of splices: Non-canonical | 17751 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 130187 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 12458 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 216289 216289 216289 N_multimapping 130187 130187 130187 N_noFeature 807548 16210280 971632 N_ambiguous 342084 2162 53318 UnstrandedReadsAssigned:15514425 PositiveStrandReadsAssigned:451615 NegativeStrandReadsAssigned:15639107 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958151 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958151-trimmed-pair1.fastq SRR6958151-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,003,728 reads, 15,664,618 reads pseudoaligned [quant] estimated average fragment length: 234.269 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR6958151.ke.tsv 35125 SRR6958151.se.tsv 88098 total ==> SRR6958151.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.074 66.4934 9.46431 PNS24247 1044 810.731 42.8827 5.29319 PNS24249 1928 1694.73 44.4273 2.62338 PNS24246 1044 810.731 42.8827 5.29319 PNS24248 1044 810.731 42.8827 5.29319 PNS24244 1471 1237.73 48.4312 3.91571 PNS24243 293 99.9688 0 0 KQK14069 1603 1369.73 683.132 49.9093 KQK14071 474 249.117 6.69507 2.68945 ==> SRR6958151.se.tsv <== BRADI_1g14170v3 781 BRADI_1g53295v3 434 BRADI_1g59795v3 310 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 477 BRADI_1g74790v3 369 BRADI_1g09890v3 0 BRADI_1g77505v3 245 BRADI_1g48960v3 0 SRR6958151 completed mapping pipeline successfully