Starting /dee2/code/volunteer_pipeline.sh SRR6958152 current disk space = 1550590656512 free memory = 1601641704 SRR6958152 SRAfilesize 0ec28ff75b74360f317c67dd462fe140 SRR6958152.sra SRR6958152.sra file validated SRR6958152 is paired end SRR6958152 is conventional basespace SRR6958152 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958152_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.27575 27.0 18.0 32.0 18.0 33.0 2 24.0155 25.0 18.0 29.0 18.0 33.0 3 28.699 29.0 27.0 31.0 25.0 33.0 4 30.27325 31.0 29.0 33.0 27.0 33.0 5 32.3025 33.0 32.0 33.0 32.0 33.0 6 36.67325 38.0 37.0 38.0 34.0 38.0 7 37.31875 38.0 38.0 38.0 36.0 38.0 8 36.844 38.0 38.0 38.0 35.0 38.0 9 37.51325 38.0 38.0 38.0 37.0 38.0 10-14 37.564800000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.51664999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.481100000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.42700000000001 38.0 38.0 38.0 37.4 38.0 30-34 37.142849999999996 38.0 38.0 38.0 36.4 38.0 35-39 37.536649999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.5269 38.0 38.0 38.0 37.8 38.0 45-49 37.4981 38.0 38.0 38.0 37.8 38.0 50-54 37.23470000000001 38.0 38.0 38.0 36.8 38.0 55-59 37.283100000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.426249999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.01815 38.0 38.0 38.0 35.8 38.0 70-74 36.3874 38.0 37.0 38.0 31.0 38.0 75-79 37.222899999999996 38.0 38.0 38.0 36.6 38.0 80-84 37.297250000000005 38.0 38.0 38.0 37.0 38.0 85-89 36.3477 38.0 37.4 38.0 32.4 38.0 90-94 34.41005 37.8 34.4 38.0 22.6 38.0 95-99 35.88375 38.0 36.8 38.0 31.8 38.0 100-104 35.6237 38.0 36.6 38.0 30.0 38.0 105-109 35.82 38.0 36.6 38.0 31.2 38.0 110-114 35.9524 38.0 37.2 38.0 32.4 38.0 115-119 36.4074 38.0 38.0 38.0 34.0 38.0 120-124 36.55185 38.0 38.0 38.0 34.0 38.0 125-129 36.52055 38.0 38.0 38.0 34.0 38.0 130-134 36.46835 38.0 38.0 38.0 34.0 38.0 135-139 36.111250000000005 38.0 37.4 38.0 33.2 38.0 140-144 35.47330000000001 38.0 36.0 38.0 31.0 38.0 145-149 34.85845 38.0 35.8 38.0 29.4 38.0 150-151 30.742375000000003 35.5 29.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 2.0 24 7.0 25 7.0 26 16.0 27 15.0 28 19.0 29 36.0 30 33.0 31 51.0 32 94.0 33 104.0 34 187.0 35 339.0 36 964.0 37 2119.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.319783197831978 16.016260162601625 11.463414634146343 44.200542005420054 2 16.004001000250064 19.10477619404851 33.28332083020755 31.607901975493874 3 22.775000000000002 19.475 23.1 34.65 4 23.625 28.449999999999996 20.45 27.474999999999998 5 23.599999999999998 32.0 23.150000000000002 21.25 6 20.8 33.2 24.6 21.4 7 15.6 23.65 42.3 18.45 8 20.3 25.324999999999996 27.85 26.525 9 18.35 21.375 34.275 26.0 10-14 21.12 27.565 26.450000000000003 24.865000000000002 15-19 21.385 25.979999999999997 27.134999999999998 25.5 20-24 21.439287857571514 26.660332066413282 26.590318063612724 25.31006201240248 25-29 21.64 26.889999999999997 26.025 25.445 30-34 21.565 26.76 26.900000000000002 24.775 35-39 21.995 26.169999999999998 26.63 25.205 40-44 22.11 26.615 26.424999999999997 24.85 45-49 21.365000000000002 26.515 26.729999999999997 25.39 50-54 22.06 26.064999999999998 26.645000000000003 25.230000000000004 55-59 21.6 26.77 26.705000000000002 24.925 60-64 22.220000000000002 26.22 26.490000000000002 25.069999999999997 65-69 22.025 26.145000000000003 26.590000000000003 25.240000000000002 70-74 22.335 26.52 26.06 25.085 75-79 22.634999999999998 25.895000000000003 26.369999999999997 25.1 80-84 21.73 26.205000000000002 26.71 25.355 85-89 22.155 26.484999999999996 25.915 25.445 90-94 22.27 26.450000000000003 26.38 24.9 95-99 22.264999999999997 26.419999999999998 26.185000000000002 25.130000000000003 100-104 22.16 26.72 25.96 25.16 105-109 21.959999999999997 26.38 26.125 25.535000000000004 110-114 21.88 25.869999999999997 26.584999999999997 25.665 115-119 22.43 26.595000000000002 25.445 25.53 120-124 22.814999999999998 25.745 25.905 25.535000000000004 125-129 22.07 26.455000000000002 26.424999999999997 25.05 130-134 22.855 25.8 26.290000000000003 25.055 135-139 22.15 26.790000000000003 25.990000000000002 25.069999999999997 140-144 22.495 26.105 25.624999999999996 25.775 145-149 22.02 26.44 26.36 25.180000000000003 150-151 22.275 26.150000000000002 25.7875 25.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 1.5 28 3.5 29 6.0 30 10.0 31 14.0 32 21.0 33 29.5 34 37.0 35 52.5 36 74.0 37 89.0 38 105.0 39 133.0 40 155.5 41 182.0 42 205.0 43 220.5 44 222.5 45 219.5 46 226.0 47 220.0 48 204.0 49 167.5 50 153.5 51 156.5 52 127.5 53 107.5 54 98.0 55 89.5 56 82.5 57 67.5 58 57.0 59 51.5 60 52.0 61 48.5 62 41.0 63 36.5 64 35.5 65 34.0 66 30.0 67 26.0 68 22.0 69 18.5 70 15.0 71 14.5 72 10.5 73 5.5 74 3.5 75 2.5 76 4.5 77 4.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.75 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCGCG 10 0.006841402 144.925 7 >>END_MODULE SRR6958152 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958152_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78975 33.0 33.0 34.0 32.0 34.0 2 33.147 34.0 33.0 34.0 32.0 34.0 3 33.0595 34.0 33.0 34.0 32.0 34.0 4 33.0835 34.0 33.0 34.0 33.0 34.0 5 33.08425 34.0 33.0 34.0 32.0 34.0 6 37.25675 38.0 38.0 38.0 37.0 38.0 7 37.324 38.0 38.0 38.0 37.0 38.0 8 37.25225 38.0 38.0 38.0 37.0 38.0 9 37.12475 38.0 38.0 38.0 37.0 38.0 10-14 37.0847 38.0 38.0 38.0 36.8 38.0 15-19 36.98065 38.0 38.0 38.0 36.6 38.0 20-24 36.7162 38.0 38.0 38.0 35.2 38.0 25-29 36.67015 38.0 38.0 38.0 34.6 38.0 30-34 36.92625 38.0 38.0 38.0 35.8 38.0 35-39 36.941500000000005 38.0 38.0 38.0 35.2 38.0 40-44 35.86045 38.0 36.2 38.0 31.4 38.0 45-49 36.6672 38.0 37.4 38.0 34.6 38.0 50-54 36.94205 38.0 38.0 38.0 36.4 38.0 55-59 36.95295 38.0 38.0 38.0 36.0 38.0 60-64 35.5635 38.0 35.6 38.0 30.2 38.0 65-69 35.76155 38.0 36.4 38.0 30.8 38.0 70-74 35.01285 38.0 34.6 38.0 27.6 38.0 75-79 36.398 38.0 38.0 38.0 34.0 38.0 80-84 36.315749999999994 38.0 38.0 38.0 34.0 38.0 85-89 36.1382 38.0 38.0 38.0 33.0 38.0 90-94 36.521 38.0 38.0 38.0 34.6 38.0 95-99 36.6282 38.0 38.0 38.0 34.8 38.0 100-104 36.61075 38.0 38.0 38.0 35.0 38.0 105-109 36.304950000000005 38.0 38.0 38.0 33.8 38.0 110-114 36.2351 38.0 38.0 38.0 34.0 38.0 115-119 36.02419999999999 38.0 38.0 38.0 33.6 38.0 120-124 35.317899999999995 38.0 36.8 38.0 28.6 38.0 125-129 35.20815 38.0 35.8 38.0 28.8 38.0 130-134 35.59824999999999 38.0 36.8 38.0 31.2 38.0 135-139 35.322700000000005 38.0 36.0 38.0 31.0 38.0 140-144 35.083499999999994 38.0 36.0 38.0 31.0 38.0 145-149 34.705799999999996 38.0 36.0 38.0 29.6 38.0 150-151 29.73725 35.5 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 4.0 5 0.0 6 0.0 7 2.0 8 1.0 9 2.0 10 0.0 11 1.0 12 0.0 13 4.0 14 1.0 15 1.0 16 3.0 17 4.0 18 5.0 19 2.0 20 8.0 21 8.0 22 5.0 23 7.0 24 10.0 25 13.0 26 24.0 27 22.0 28 33.0 29 43.0 30 38.0 31 48.0 32 89.0 33 119.0 34 180.0 35 265.0 36 667.0 37 2382.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.825 18.5 15.5 32.175 2 29.675 24.375 28.875 17.075000000000003 3 23.1 27.55 27.450000000000003 21.9 4 24.75 32.800000000000004 21.9 20.549999999999997 5 26.0 33.575 20.424999999999997 20.0 6 22.975 35.275 21.825 19.925 7 21.7 20.549999999999997 36.7 21.05 8 24.5 22.650000000000002 25.05 27.800000000000004 9 23.05 23.0 28.625 25.324999999999996 10-14 25.41 26.555 24.490000000000002 23.544999999999998 15-19 24.795 26.51 25.480000000000004 23.215 20-24 25.215 26.87 25.180000000000003 22.735 25-29 25.3 26.82 25.485000000000003 22.395 30-34 25.53 26.055 25.624999999999996 22.79 35-39 25.09 26.474999999999998 25.695 22.74 40-44 25.740000000000002 26.490000000000002 25.319999999999997 22.45 45-49 25.295 26.435 25.595000000000002 22.675 50-54 24.959999999999997 26.43 26.11 22.5 55-59 25.6 26.105 25.545 22.75 60-64 25.105 26.745 26.045 22.105 65-69 25.135 26.155 26.08 22.63 70-74 25.575 26.02 25.665 22.74 75-79 25.795 26.384999999999998 25.685000000000002 22.134999999999998 80-84 25.005 26.275 26.05 22.67 85-89 25.935000000000002 26.36 25.21 22.495 90-94 25.064999999999998 26.25 26.529999999999998 22.155 95-99 25.34 26.545 26.05 22.065 100-104 25.324999999999996 26.775 25.085 22.814999999999998 105-109 24.935 26.705000000000002 25.88 22.48 110-114 26.115 26.224999999999998 25.679999999999996 21.98 115-119 25.424999999999997 26.045 26.169999999999998 22.36 120-124 25.669999999999998 26.615 25.650000000000002 22.065 125-129 25.729999999999997 26.939999999999998 25.509999999999998 21.82 130-134 25.5 26.650000000000002 25.924999999999997 21.925 135-139 25.935000000000002 26.545 25.995 21.525 140-144 25.66 26.985 25.7 21.654999999999998 145-149 25.635 26.13 26.240000000000002 21.995 150-151 26.575 26.1625 26.125 21.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.5 26 3.0 27 3.5 28 4.0 29 6.0 30 7.5 31 9.5 32 16.0 33 22.0 34 34.5 35 47.5 36 61.0 37 76.0 38 103.5 39 140.5 40 146.5 41 162.0 42 186.5 43 196.0 44 209.0 45 229.0 46 238.0 47 216.0 48 200.0 49 177.0 50 156.0 51 147.5 52 127.5 53 108.0 54 91.5 55 84.0 56 73.0 57 63.5 58 61.5 59 53.0 60 45.5 61 46.0 62 48.0 63 52.0 64 57.5 65 52.0 66 46.0 67 40.5 68 34.5 69 29.0 70 20.5 71 18.0 72 13.5 73 8.5 74 7.5 75 6.0 76 4.0 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.6 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCGC 10 0.006830828 145.0 7 >>END_MODULE Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921328 spots for SRR6958152.sra Written 921328 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra Read 921322 spots for SRR6958152.sra Written 921322 spots for SRR6958152.sra SRR ids: ['SRR6958152.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p6a5dgzr SRR6958152.sra spots: 18426446 blocks: [[1, 921322], [921323, 1842644], [1842645, 2763966], [2763967, 3685288], [3685289, 4606610], [4606611, 5527932], [5527933, 6449254], [6449255, 7370576], [7370577, 8291898], [8291899, 9213220], [9213221, 10134542], [10134543, 11055864], [11055865, 11977186], [11977187, 12898508], [12898509, 13819830], [13819831, 14741152], [14741153, 15662474], [15662475, 16583796], [16583797, 17505118], [17505119, 18426446]] SRR6958152 file size 6222417 SRR6958152 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958152 SRR6958152_1.fastq SRR6958152_2.fastq Input file: SRR6958152_1.fastq Paired file: SRR6958152_2.fastq trimmed: SRR6958152-trimmed-pair1.fastq, SRR6958152-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:23:07 2024 >> started Fri Dec 6 14:23:28 2024 >> done (20.375s) 18426446 read pairs processed; of these: 8879 ( 0.05%) short read pairs filtered out after trimming by size control 6987 ( 0.04%) empty read pairs filtered out after trimming by size control 18410580 (99.91%) read pairs available; of these: 6500619 (35.31%) trimmed read pairs available after processing 11909961 (64.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 5 0.00% 31 6 0.00% 32 4 0.00% 33 1 0.00% 34 7 0.00% 35 10 0.00% 36 4 0.00% 37 5 0.00% 38 6 0.00% 39 9 0.00% 40 4 0.00% 41 8 0.00% 42 10 0.00% 43 6 0.00% 44 12 0.00% 45 7 0.00% 46 10 0.00% 47 19 0.00% 48 16 0.00% 49 23 0.00% 50 22 0.00% 51 29 0.00% 52 24 0.00% 53 29 0.00% 54 29 0.00% 55 31 0.00% 56 45 0.00% 57 44 0.00% 58 46 0.00% 59 53 0.00% 60 66 0.00% 61 65 0.00% 62 84 0.00% 63 87 0.00% 64 93 0.00% 65 104 0.00% 66 123 0.00% 67 134 0.00% 68 176 0.00% 69 198 0.00% 70 210 0.00% 71 214 0.00% 72 282 0.00% 73 297 0.00% 74 329 0.00% 75 433 0.00% 76 415 0.00% 77 509 0.00% 78 507 0.00% 79 594 0.00% 80 681 0.00% 81 829 0.00% 82 984 0.01% 83 1174 0.01% 84 1647 0.01% 85 1935 0.01% 86 2122 0.01% 87 2282 0.01% 88 2350 0.01% 89 2463 0.01% 90 2697 0.01% 91 2863 0.02% 92 3241 0.02% 93 3408 0.02% 94 3573 0.02% 95 3843 0.02% 96 4228 0.02% 97 4432 0.02% 98 4616 0.03% 99 4983 0.03% 100 5502 0.03% 101 5919 0.03% 102 6240 0.03% 103 6949 0.04% 104 7415 0.04% 105 7910 0.04% 106 8072 0.04% 107 8510 0.05% 108 8765 0.05% 109 9302 0.05% 110 9683 0.05% 111 10424 0.06% 112 11136 0.06% 113 11987 0.07% 114 12683 0.07% 115 13707 0.07% 116 14158 0.08% 117 14543 0.08% 118 15086 0.08% 119 15693 0.09% 120 16370 0.09% 121 17302 0.09% 122 18039 0.10% 123 19235 0.10% 124 20532 0.11% 125 21507 0.12% 126 22946 0.12% 127 23709 0.13% 128 24625 0.13% 129 25519 0.14% 130 26507 0.14% 131 27527 0.15% 132 29600 0.16% 133 31451 0.17% 134 33207 0.18% 135 35482 0.19% 136 37972 0.21% 137 40190 0.22% 138 42695 0.23% 139 45949 0.25% 140 49236 0.27% 141 53760 0.29% 142 59943 0.33% 143 67202 0.37% 144 77559 0.42% 145 91979 0.50% 146 115285 0.63% 147 156293 0.85% 148 245147 1.33% 149 521841 2.83% 150 4238493 23.02% 151 11909961 64.69% 18410580 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=35 prefix-density=0.27 prefix-fanout=2.6 sequence=GAGCTGGAGCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=278.22 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=28.4 sequence=TTCTTCTTGTCCA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=34.31 fanout-score-rank=7 prefix-density=0.88 prefix-fanout=7.6 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGCGCCTCGCAGTCGCAGGTTGCCTAGCTCGACTTGTGAGAGTTGAGCTACGTATAGTACCAGCTGGCCACCCTCTGAGAATACTATACTGTAATAAGATGAAGAAGAATAAAATTCCCACGATCACATGTACTGTTATACTGAGAGTAGAGTCTGTACCGTGGGATTTATACCGTACGTCGTTGTGTAAATTTCCTTTTAATTTGTTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=114.52 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=19.5 sequence=CGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR6958152 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:24:22 Started mapping on | Dec 06 14:24:23 Finished on | Dec 06 14:26:15 Mapping speed, Million of reads per hour | 591.77 Number of input reads | 18410580 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17816427 Uniquely mapped reads % | 96.77% Average mapped length | 297.97 Number of splices: Total | 20286561 Number of splices: Annotated (sjdb) | 19130764 Number of splices: GT/AG | 20022627 Number of splices: GC/AG | 222067 Number of splices: AT/AC | 9826 Number of splices: Non-canonical | 32041 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166057 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 18714 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.48% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 434693 434693 434693 N_multimapping 166057 166057 166057 N_noFeature 875269 17345952 1032359 N_ambiguous 373975 2520 61724 UnstrandedReadsAssigned:16567183 PositiveStrandReadsAssigned:467955 NegativeStrandReadsAssigned:16722344 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958152 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958152-trimmed-pair1.fastq SRR6958152-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,410,580 reads, 16,698,893 reads pseudoaligned [quant] estimated average fragment length: 278.606 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR6958152.ke.tsv 35125 SRR6958152.se.tsv 88098 total ==> SRR6958152.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.838 70.2594 9.77839 PNS24247 1044 766.394 45.7167 5.46972 PNS24249 1928 1650.39 88.7647 4.93168 PNS24246 1044 766.394 45.7167 5.46972 PNS24248 1044 766.394 45.7167 5.46972 PNS24244 1471 1193.39 47.8257 3.67467 PNS24243 293 78.8848 0 0 KQK14069 1603 1325.39 267.201 18.4856 KQK14071 474 214.664 5.60325 2.39344 ==> SRR6958152.se.tsv <== BRADI_1g14170v3 299 BRADI_1g53295v3 630 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 447 BRADI_1g74790v3 530 BRADI_1g09890v3 0 BRADI_1g77505v3 248 BRADI_1g48960v3 0 SRR6958152 completed mapping pipeline successfully