Starting /dee2/code/volunteer_pipeline.sh SRR6958153 current disk space = 1550593388544 free memory = 1603445552 SRR6958153 SRAfilesize 2dde399f041ef778ef8b25fec40d9e58 SRR6958153.sra SRR6958153.sra file validated SRR6958153 is paired end SRR6958153 is conventional basespace SRR6958153 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958153_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9235 33.0 33.0 34.0 32.0 34.0 2 32.8315 33.0 33.0 34.0 31.0 34.0 3 32.9515 33.0 33.0 34.0 31.0 34.0 4 32.79575 33.0 33.0 34.0 31.0 34.0 5 33.1835 33.0 33.0 34.0 33.0 34.0 6 36.01975 38.0 36.0 38.0 33.0 38.0 7 37.04525 38.0 38.0 38.0 35.0 38.0 8 37.30775 38.0 38.0 38.0 36.0 38.0 9 37.52525 38.0 38.0 38.0 37.0 38.0 10-14 37.55785 38.0 38.0 38.0 37.8 38.0 15-19 37.59425 38.0 38.0 38.0 38.0 38.0 20-24 37.591049999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.582550000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.544549999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.49405 38.0 38.0 38.0 38.0 38.0 40-44 37.4787 38.0 38.0 38.0 37.4 38.0 45-49 37.43475 38.0 38.0 38.0 37.2 38.0 50-54 37.41844999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.386700000000005 38.0 38.0 38.0 37.0 38.0 60-64 36.78615 38.0 38.0 38.0 36.2 38.0 65-69 37.104949999999995 38.0 38.0 38.0 36.2 38.0 70-74 37.2572 38.0 38.0 38.0 37.0 38.0 75-79 37.17230000000001 38.0 38.0 38.0 36.2 38.0 80-84 37.11514999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.0737 38.0 38.0 38.0 36.0 38.0 90-94 37.0195 38.0 38.0 38.0 36.0 38.0 95-99 36.9182 38.0 38.0 38.0 35.2 38.0 100-104 36.892700000000005 38.0 38.0 38.0 35.2 38.0 105-109 36.73455 38.0 38.0 38.0 34.8 38.0 110-114 36.62645 38.0 38.0 38.0 34.6 38.0 115-119 36.577000000000005 38.0 38.0 38.0 34.2 38.0 120-124 36.31825 38.0 38.0 38.0 33.6 38.0 125-129 35.998850000000004 38.0 37.8 38.0 32.6 38.0 130-134 35.48195 38.0 36.0 38.0 31.0 38.0 135-139 35.1622 38.0 36.0 38.0 30.4 38.0 140-144 34.7745 38.0 36.0 38.0 28.2 38.0 145-149 34.234750000000005 38.0 35.4 38.0 27.0 38.0 150-151 29.47025 35.5 26.5 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 1.0 20 2.0 21 1.0 22 7.0 23 7.0 24 4.0 25 11.0 26 15.0 27 12.0 28 22.0 29 23.0 30 27.0 31 41.0 32 64.0 33 68.0 34 134.0 35 253.0 36 635.0 37 2666.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.925 9.950000000000001 8.05 38.074999999999996 2 22.0 11.924999999999999 34.925 31.15 3 20.45 16.175 24.825 38.550000000000004 4 23.674999999999997 24.525 23.175 28.625 5 24.275 29.549999999999997 24.075 22.1 6 21.85 32.5 23.65 22.0 7 16.5 24.85 39.825 18.825 8 19.5 24.15 30.8 25.55 9 19.8 22.325 33.775 24.099999999999998 10-14 22.00830124518678 27.029054358153726 26.583987598139718 24.378656798519778 15-19 21.935 25.83 26.700000000000003 25.535000000000004 20-24 21.834999999999997 26.265 26.905 24.995 25-29 22.43 26.590000000000003 26.19 24.79 30-34 21.7 26.345000000000002 26.77 25.185000000000002 35-39 22.39 26.035000000000004 26.205000000000002 25.369999999999997 40-44 21.725 26.314999999999998 26.41 25.55 45-49 22.67 26.025 26.064999999999998 25.240000000000002 50-54 22.545 26.08 26.419999999999998 24.955 55-59 22.12831924788718 26.18892833925089 26.033905085762864 25.648847327099066 60-64 22.47322199096401 26.508959845677442 25.66627747601401 25.35154068734454 65-69 22.697450793809786 26.118094856513245 26.26834276556318 24.916111584113786 70-74 22.14 26.275 26.19 25.395 75-79 22.35 25.795 26.41 25.445 80-84 22.720000000000002 25.540000000000003 26.13 25.61 85-89 22.025 26.135 26.185000000000002 25.655 90-94 22.384999999999998 25.905 26.22 25.490000000000002 95-99 22.64 25.81 26.229999999999997 25.319999999999997 100-104 22.68 25.874999999999996 26.125 25.319999999999997 105-109 22.25 26.125 25.995 25.629999999999995 110-114 22.155 26.145000000000003 26.055 25.645 115-119 22.509999999999998 26.229999999999997 26.105 25.155 120-124 22.3 26.224999999999998 25.729999999999997 25.745 125-129 22.38 25.775 25.974999999999998 25.869999999999997 130-134 22.585 26.009999999999998 26.165 25.240000000000002 135-139 22.305 26.05 25.75 25.895000000000003 140-144 22.96 26.32 25.82 24.9 145-149 22.55 26.27 25.795 25.385 150-151 23.175 26.2125 25.35 25.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 3.0 28 4.5 29 3.0 30 7.5 31 12.5 32 14.5 33 23.0 34 30.0 35 42.5 36 59.0 37 74.5 38 100.0 39 118.5 40 142.0 41 171.0 42 185.0 43 202.0 44 221.0 45 227.0 46 231.5 47 230.5 48 219.5 49 195.5 50 176.5 51 162.5 52 131.5 53 107.5 54 99.5 55 89.5 56 72.5 57 62.0 58 62.5 59 57.0 60 47.5 61 43.5 62 41.0 63 39.0 64 40.0 65 39.0 66 34.5 67 35.0 68 29.0 69 22.5 70 19.0 71 17.5 72 15.5 73 10.5 74 7.0 75 5.0 76 5.0 77 3.0 78 0.5 79 2.0 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.015 60-64 1.505 65-69 0.165 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.037500000000000006 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.1 0.0 0.025 0.0 0.0 98-99 0.1375 0.0 0.025 0.0 0.0 100-101 0.1875 0.0 0.025 0.0 0.0 102-103 0.3375 0.0 0.025 0.0 0.0 104-105 0.3625 0.0 0.025 0.0 0.0 106-107 0.4125 0.0 0.025 0.0 0.0 108-109 0.425 0.0 0.025 0.0 0.0 110-111 0.525 0.0 0.025 0.0 0.0 112-113 0.675 0.0 0.025 0.0 0.0 114-115 0.725 0.0 0.025 0.0 0.0 116-117 0.75 0.0 0.025 0.0 0.0 118-119 0.8875 0.0 0.025 0.0 0.0 120-121 0.9875 0.0 0.025 0.0 0.0 122-123 1.1125 0.0 0.025 0.0 0.0 124-125 1.275 0.0 0.025 0.0 0.0 126-127 1.475 0.0 0.025 0.0 0.0 128-129 1.7125 0.0 0.025 0.0 0.0 130-131 2.0 0.0 0.025 0.0 0.0 132-133 2.225 0.0 0.025 0.0 0.0 134-135 2.45 0.0 0.025 0.0 0.0 136-137 2.6375 0.0 0.025 0.0 0.0 138-139 2.8 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATAA 10 0.0068661636 144.75 3 AAATAAG 10 0.0068661636 144.75 4 GGGAAAT 10 0.0068661636 144.75 1 AATAAGA 10 0.0068661636 144.75 5 >>END_MODULE SRR6958153 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958153_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.897 33.0 33.0 34.0 32.0 34.0 2 33.05175 34.0 33.0 34.0 32.0 34.0 3 33.09625 34.0 33.0 34.0 33.0 34.0 4 33.02725 34.0 33.0 34.0 33.0 34.0 5 33.0925 34.0 33.0 34.0 33.0 34.0 6 37.27225 38.0 38.0 38.0 37.0 38.0 7 37.37925 38.0 38.0 38.0 37.0 38.0 8 37.3395 38.0 38.0 38.0 37.0 38.0 9 37.36025 38.0 38.0 38.0 37.0 38.0 10-14 37.3264 38.0 38.0 38.0 37.0 38.0 15-19 37.271899999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.27905 38.0 38.0 38.0 37.0 38.0 25-29 37.239050000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.25515 38.0 38.0 38.0 37.0 38.0 35-39 37.22905000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.20205 38.0 38.0 38.0 37.0 38.0 45-49 37.1759 38.0 38.0 38.0 37.0 38.0 50-54 37.105000000000004 38.0 38.0 38.0 36.6 38.0 55-59 37.04395 38.0 38.0 38.0 36.2 38.0 60-64 37.076750000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.00155 38.0 38.0 38.0 36.2 38.0 70-74 36.96045 38.0 38.0 38.0 36.0 38.0 75-79 36.9699 38.0 38.0 38.0 36.0 38.0 80-84 36.87375 38.0 38.0 38.0 35.8 38.0 85-89 36.8121 38.0 38.0 38.0 35.8 38.0 90-94 36.79025 38.0 38.0 38.0 35.6 38.0 95-99 36.61785 38.0 38.0 38.0 34.8 38.0 100-104 36.61585 38.0 38.0 38.0 34.6 38.0 105-109 36.37425 38.0 38.0 38.0 34.0 38.0 110-114 36.24795 38.0 38.0 38.0 33.8 38.0 115-119 36.11659999999999 38.0 38.0 38.0 33.2 38.0 120-124 36.0303 38.0 37.6 38.0 33.4 38.0 125-129 35.96255000000001 38.0 37.6 38.0 33.2 38.0 130-134 35.757400000000004 38.0 36.6 38.0 32.6 38.0 135-139 35.5243 38.0 36.0 38.0 31.4 38.0 140-144 35.280950000000004 38.0 36.0 38.0 31.0 38.0 145-149 34.61149999999999 38.0 35.4 38.0 28.8 38.0 150-151 30.3615 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 2.0 13 1.0 14 2.0 15 0.0 16 3.0 17 3.0 18 1.0 19 0.0 20 2.0 21 3.0 22 5.0 23 8.0 24 11.0 25 7.0 26 8.0 27 20.0 28 17.0 29 34.0 30 33.0 31 53.0 32 49.0 33 85.0 34 114.0 35 202.0 36 503.0 37 2816.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.68302453680521 18.678017025538306 11.592388582874312 31.046569854782174 2 29.81708844901027 23.12703583061889 27.887747431721372 19.16812828864946 3 22.80130293159609 26.083688298672016 28.213480330744172 22.90152843898772 4 27.204408817635272 30.636272545090183 20.89178356713427 21.26753507014028 5 27.136056126284142 33.14958656978201 21.172638436482085 18.541718867451767 6 22.7 36.4 21.175 19.725 7 23.025000000000002 20.424999999999997 36.025 20.525 8 24.425 23.375 24.725 27.474999999999998 9 23.474999999999998 24.099999999999998 27.800000000000004 24.625 10-14 25.490000000000002 26.775 23.995 23.74 15-19 25.69142285571393 25.55138784696174 25.571392848212053 23.185796449112278 20-24 25.415 26.51 24.39 23.685000000000002 25-29 25.306265313265662 26.151307565378268 24.891244562228113 23.651182559127957 30-34 26.02 26.245 25.05 22.685 35-39 25.711285564278214 26.021301065053255 25.011250562528126 23.256162808140406 40-44 25.47 26.355 25.11 23.064999999999998 45-49 25.7 25.715 25.605 22.98 50-54 25.677567756775677 26.302630263026305 25.02250225022502 22.997299729972998 55-59 26.424999999999997 25.91 25.1 22.564999999999998 60-64 25.685000000000002 26.16 25.71 22.445 65-69 25.615 26.27 24.87 23.244999999999997 70-74 25.83016603320664 25.76515303060612 25.86517303460692 22.539507901580315 75-79 25.509999999999998 25.495 25.615 23.380000000000003 80-84 25.39 26.27 25.569999999999997 22.770000000000003 85-89 25.645 25.615 26.205000000000002 22.535 90-94 25.645 26.290000000000003 25.624999999999996 22.439999999999998 95-99 26.207620762076207 25.967596759675963 25.26252625262526 22.562256225622562 100-104 26.251312565628282 26.061303065153258 25.236261813090653 22.451122556127807 105-109 25.002500250025 26.21762176217622 25.77257725772577 23.00730073007301 110-114 25.843876581487223 26.19892983947592 25.36880532079812 22.588388258238737 115-119 25.85258525852585 26.25262526252625 25.18751875187519 22.707270727072707 120-124 26.238935840376055 25.80387058058709 25.643846576986544 22.313347002050307 125-129 25.89258925892589 26.392639263926394 25.312531253125314 22.402240224022403 130-134 25.816290814540725 26.75133756687834 25.486274313715683 21.94609730486524 135-139 25.624999999999996 27.025 25.119999999999997 22.23 140-144 26.09630481524076 26.581329066453325 25.071253562678137 22.25111255562778 145-149 26.105 26.46 25.27 22.165000000000003 150-151 26.174999999999997 26.737499999999997 25.4875 21.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 1.5 26 2.0 27 2.0 28 1.5 29 3.5 30 7.5 31 9.0 32 12.5 33 19.5 34 20.5 35 25.0 36 39.0 37 64.0 38 88.5 39 105.5 40 127.5 41 178.0 42 208.5 43 208.5 44 225.5 45 224.0 46 208.5 47 207.0 48 196.0 49 175.5 50 159.0 51 148.5 52 129.0 53 113.5 54 101.0 55 89.0 56 88.5 57 80.0 58 71.0 59 66.5 60 57.5 61 59.0 62 62.5 63 55.0 64 48.5 65 42.5 66 46.5 67 45.0 68 36.0 69 33.5 70 29.5 71 22.0 72 15.5 73 10.5 74 10.5 75 8.0 76 3.5 77 2.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.22499999999999998 3 0.22499999999999998 4 0.2 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.005 105-109 0.01 110-114 0.015 115-119 0.01 120-124 0.015 125-129 0.01 130-134 0.005 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.275 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTCT 10 0.006830828 145.0 3 CCATGGG 10 0.006830828 145.0 1 GCGAAAG 10 0.006830828 145.0 7 CATGGGC 10 0.006830828 145.0 2 >>END_MODULE Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409536 spots for SRR6958153.sra Written 1409536 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra Read 1409531 spots for SRR6958153.sra Written 1409531 spots for SRR6958153.sra SRR ids: ['SRR6958153.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pbwsej_u SRR6958153.sra spots: 28190625 blocks: [[1, 1409531], [1409532, 2819062], [2819063, 4228593], [4228594, 5638124], [5638125, 7047655], [7047656, 8457186], [8457187, 9866717], [9866718, 11276248], [11276249, 12685779], [12685780, 14095310], [14095311, 15504841], [15504842, 16914372], [16914373, 18323903], [18323904, 19733434], [19733435, 21142965], [21142966, 22552496], [22552497, 23962027], [23962028, 25371558], [25371559, 26781089], [26781090, 28190625]] SRR6958153 file size 9531177 SRR6958153 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958153 SRR6958153_1.fastq SRR6958153_2.fastq Input file: SRR6958153_1.fastq Paired file: SRR6958153_2.fastq trimmed: SRR6958153-trimmed-pair1.fastq, SRR6958153-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:24:25 2024 >> started Fri Dec 6 14:25:07 2024 >> done (42.033s) 28190625 read pairs processed; of these: 25065 ( 0.09%) short read pairs filtered out after trimming by size control 46409 ( 0.16%) empty read pairs filtered out after trimming by size control 28119151 (99.75%) read pairs available; of these: 9728647 (34.60%) trimmed read pairs available after processing 18390504 (65.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 5 0.00% 24 8 0.00% 25 5 0.00% 26 6 0.00% 27 4 0.00% 28 7 0.00% 29 8 0.00% 30 6 0.00% 31 7 0.00% 32 5 0.00% 33 7 0.00% 34 5 0.00% 35 11 0.00% 36 7 0.00% 37 13 0.00% 38 6 0.00% 39 10 0.00% 40 11 0.00% 41 13 0.00% 42 6 0.00% 43 14 0.00% 44 13 0.00% 45 17 0.00% 46 26 0.00% 47 19 0.00% 48 28 0.00% 49 26 0.00% 50 33 0.00% 51 28 0.00% 52 35 0.00% 53 37 0.00% 54 54 0.00% 55 46 0.00% 56 43 0.00% 57 65 0.00% 58 67 0.00% 59 60 0.00% 60 92 0.00% 61 68 0.00% 62 107 0.00% 63 103 0.00% 64 118 0.00% 65 151 0.00% 66 147 0.00% 67 156 0.00% 68 174 0.00% 69 242 0.00% 70 243 0.00% 71 279 0.00% 72 356 0.00% 73 338 0.00% 74 425 0.00% 75 519 0.00% 76 544 0.00% 77 614 0.00% 78 659 0.00% 79 732 0.00% 80 866 0.00% 81 974 0.00% 82 1115 0.00% 83 1310 0.00% 84 2275 0.01% 85 2823 0.01% 86 3059 0.01% 87 3402 0.01% 88 3470 0.01% 89 3702 0.01% 90 3991 0.01% 91 3972 0.01% 92 4387 0.02% 93 4572 0.02% 94 4982 0.02% 95 5364 0.02% 96 5680 0.02% 97 6086 0.02% 98 6461 0.02% 99 6923 0.02% 100 7482 0.03% 101 7944 0.03% 102 8722 0.03% 103 9178 0.03% 104 9853 0.04% 105 10580 0.04% 106 11369 0.04% 107 11763 0.04% 108 12598 0.04% 109 13389 0.05% 110 14037 0.05% 111 15246 0.05% 112 16147 0.06% 113 16805 0.06% 114 18327 0.07% 115 19479 0.07% 116 20493 0.07% 117 21860 0.08% 118 22949 0.08% 119 24008 0.09% 120 25163 0.09% 121 26430 0.09% 122 28582 0.10% 123 29199 0.10% 124 31096 0.11% 125 32305 0.11% 126 33901 0.12% 127 35686 0.13% 128 37523 0.13% 129 39208 0.14% 130 41014 0.15% 131 42769 0.15% 132 45477 0.16% 133 48029 0.17% 134 51038 0.18% 135 54458 0.19% 136 58021 0.21% 137 61904 0.22% 138 65667 0.23% 139 71245 0.25% 140 76872 0.27% 141 83036 0.30% 142 92831 0.33% 143 104007 0.37% 144 120452 0.43% 145 144638 0.51% 146 182093 0.65% 147 240704 0.86% 148 373439 1.33% 149 801892 2.85% 150 6275478 22.32% 151 18390504 65.40% 28119151 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=21 prefix-density=0.28 prefix-fanout=2.8 sequence=GAGCTGGAGCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=335.03 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=34.6 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.64 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=3.7 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=137.59 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=21.4 sequence=CGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR6958153 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:25:59 Started mapping on | Dec 06 14:25:59 Finished on | Dec 06 14:29:13 Mapping speed, Million of reads per hour | 521.80 Number of input reads | 28119151 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 26991584 Uniquely mapped reads % | 95.99% Average mapped length | 297.77 Number of splices: Total | 30661033 Number of splices: Annotated (sjdb) | 28828379 Number of splices: GT/AG | 30229685 Number of splices: GC/AG | 346835 Number of splices: AT/AC | 14430 Number of splices: Non-canonical | 70083 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326132 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 21548 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.23% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 815867 815867 815867 N_multimapping 326132 326132 326132 N_noFeature 1206012 26298427 1446286 N_ambiguous 547393 3833 96504 UnstrandedReadsAssigned:25238179 PositiveStrandReadsAssigned:689324 NegativeStrandReadsAssigned:25448794 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958153 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958153-trimmed-pair1.fastq SRR6958153-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,119,151 reads, 25,339,679 reads pseudoaligned [quant] estimated average fragment length: 274.576 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR6958153.ke.tsv 35125 SRR6958153.se.tsv 88098 total ==> SRR6958153.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.996 239.142 21.9554 PNS24247 1044 770.424 39.5133 3.12184 PNS24249 1928 1654.42 105.593 3.88493 PNS24246 1044 770.424 39.5133 3.12184 PNS24248 1044 770.424 39.5133 3.12184 PNS24244 1471 1197.42 49.7259 2.52774 PNS24243 293 79.4516 3 2.29835 KQK14069 1603 1329.42 915.268 41.9065 KQK14071 474 218.153 12.0983 3.37568 ==> SRR6958153.se.tsv <== BRADI_1g14170v3 992 BRADI_1g53295v3 1878 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 980 BRADI_1g74790v3 1079 BRADI_1g09890v3 0 BRADI_1g77505v3 280 BRADI_1g48960v3 0 SRR6958153 completed mapping pipeline successfully